فعالیت بازدارنده برخی از باکتری‌های اندوفیت برگSatureja khuzestanica در برابر باکتری‌های بیماری‌زای گیاهی

نوع مقاله : پژوهشی- انگلیسی

نویسندگان

1 دانشجوی دکتری گروه گیاه‌پزشکی، دانشکدۀ کشاورزی، دانشگاه بوعلی‌سینا، همدان، ایران

2 استاد گروه گیاه‌پزشکی، دانشکدۀ کشاورزی، دانشگاه بوعلی‌سینا، همدان، ایران

چکیده

چکیده
مقدمه: میکروب‌هایی که درون بافت‌های گیاهی قرار دارند، به نام اندوفیت شناخته می‌شوند. این میکروب‌ها مجموعه‌ای از ترکیبات را تولید می‌کنند که قابلیت استفاده در پزشکی و کشاورزی مدرن را دارند. هدف از این مطالعه جداسازی، غربالگری و شناسایی باکتری‌های اندوفیت با فعالیت ضدمیکروبی علیه باکتری‌های پاتوژن گیاهی بود. گیاهان دارویی مانند Satureja khuzestanica به‌دلیل داشتن برخی متابولیت‌های ثانویه در طب سنتی استفاده می‌شوند؛ اما اطلاعات مربوط به اندوفیت‌های باکتریایی طبیعی آن محدود است.
مواد و روش‏‏ها: در مطالعه حاضر، 27 سویه اندوفیت از S. khuzestanica جداسازی شد. براساس توالی‌یابی ژن 16S rRNA، سویه‌های باکتریایی جداشده با بیشترین فعالیت در برابر باکتری‌های بیماری‌زای گیاهی متعلق به جنس‌های Bacillus، Streptomyces و Pseudomonas بودند. متابولیت‌های ثانویه زیست‌فعال این باکتری‌های اندوفیت با استفاده از اتیل استات استخراج شدند و سپس آنالیز کروماتوگرافی گازی - طیف‌سنجی جرمی (GC-MS) در شرایط استاندارد انجام شد. حداقل غلظت مهاری (MIC) برای پنج گونه باکتری با روش رقت میکروبراث تعیین شد.
نتایج: تجزیه و تحلیل داده‌ها نشان دادند تفاوت معنی‌داری برای فعالیت ضدمیکروبی ثبت شد که حداقل غلظت بازداری آن از 312/0 میلی‌گرم بر میلی‌لیتر تا 5/2 میلی‌گرم بر میلی‌لیتر بود. حداقل غلظت باکتری‌کشی 625/0 میلی‌گرم بر میلی‌لیتر تا 10 میلی‌گرم بر میلی‌لیتر بود.
بحث و نتیجه‏ گیری: ترکیبات اصلی در تجزیه و تحلیل GC-MS باکتری‌های اندوفیت در این مطالعه 2،4-di-tert-butylphenol ، beta-d-glucopyranose ، hexadecane، tetradecane، eicosane و dibutyl phthalate بودند. این مطالعه برای نخستین‌بار اندوفیت‌های باکتریایی S. khuzestanica با فعالیت ضدمیکروبی علیه فیتوپاتوژن‌های باکتریایی را گزارش می‌دهد. یافته‌های ما بینش جدیدی را دربارة فعالیت‌های ضدمیکروبی باکتری‌های اندوفیت طبیعی S. khuzestanica ارائه می‌دهد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

The Inhibitory Activity of Some Endophytic Bacteria from Satureja Khuzestanica Leaves against Phythopathogenic Bacteria

نویسندگان [English]

  • Mitra Omidi Nasab 1
  • Gholam Khodakaramian 2
1 Department of Plant Protection, Faculty of Agriculture, Bu Ali Sina University, Hamadan, Iran
2 Department of Plant Protection, Faculty of Agriculture, Bu Ali Sina University, Hamadan, Iran
چکیده [English]

Abstract
Introduction: Microbes that reside inside the plant tissues are known as endophytes. These microbes produce an array of compounds that have the potential to be used in modern medicine and agriculture. The aim of this study was to isolate, screen, and identify endophytic bacteria that have antimicrobial activity toward phytopathogenic bacteria. Aromatic plants such as Satureja khuzestanica are used in traditional medicine due to their secondary metabolites but information regarding their naturally occurring bacterial endophytes is limited.
Materials and Methods: In the present study, 27 strains of endophytes were isolated from S. khuzestanica. Based on the sequencing of the 16S rRNA gene, isolated bacterial strains with the highest activity against phytopathogenic bacteria belong to Bacillus, Streptomyces, and Pseudomonas genera. The bioactive secondary metabolites of these endophyte bacteria were extracted using ethyl acetate, followed by Gas Chromatography-Mass Spectrometry (GC-MS) analysis under standard conditions. The minimum inhibitory concentration (MIC) values were determined for five species of bacteria via the microbroth dilution technique. The crude extracts of the five selected bacterial endophytes indicated an antimicrobial activity against five phytopathogenic species.
Results: Data analysis showed significant differences in antimicrobial activity that ranged from 0.312 mg/ml to 2. 5 mg/ml. The minimum bactericidal concentrations ranged from 0.625 mg/ml to 10 mg/ml.
Discussion and Conclusion: The major compounds in GC-MS analysis of endophyte bacteria in this study were 2,4-di-tert-butylphenol, beta-d-glucopyranose, hexadecane, tetradecane,  eicosane, and dibutyl phthalate. This study reports for the first-time bacterial endophytes of S. khuzestanica, with antimicrobial activity against bacterial phypathogens. Our findings provide new insights into the antimicrobial activities of natural bacteria endophytes from S. khuzestanica.

کلیدواژه‌ها [English]

  • Bacillus
  • Streptomyces
  • Pseudomonas
  • Chromatography

Introduction

How did medicinal herbs usage start- from nature or planting is unknown. However, historically, in the great civilizations of the world, medicinal plants have been used as the main agent in the healing and treatment of pain. In the late eighteenth and early nineteenth centuries, scientific studies on medicinal plants were expanded and medicinal plants were used as scientifically important medicinal agents (1). Iran is one of the centers of diversity of Satureja species. The genus Satureja belongs to the Lamiaceae family and the Nepetoideae subfamily. S. khuzestanica grows naturally in the western and northwestern parts of Iran (2, 3). S. khuzistanica and S. reshingeri are valuable herbs used in pharmaceutical and food industries due to their pharmacological and biological properties (4). Recently a wide range of biological activities of S. khuzestanica have been reported such as antibacterial (5, 6, 7, 8), antifungal (9, 10), antiparasitic (11, 12), antioxidant (13, 14, 15, 16, 17, 18), and anti-inflammatory (7, 15, 19, 20, 21,( properties. Bacterial endophytes are obligate symbiotic microorganisms, which live in apparently healthy internal plant tissues, without causing disease (22). Endophytic bacteria can be found in most plant species and can be recovered from various parts of the plant including roots, leaves, stems, and a few from flowers, fruits, and seeds (23). Endophytic microorganisms affect plant physiology through activities such as biocontrol roles, plant growth regulation, bioremediation, symbiotic-mutualistic, commensalistic, and trophobiotic interactions, control of pathogens, and support of host plants (24). Endophytes help to improve crop yields, through an immune response and stimulating plant growth, excluding plant pathogens through niche competition, and antioxidant activities (25). They have the potential to produce a variety of secondary metabolites with applications in the agriculture and pharmaceutical sectors (23, 24, 26).

Several secondary metabolites produced by bacterial endophytes act as antimicrobial agents against human, animal, and plant pathogens. Whereas the antimicrobial effect against phytopathogens will have a positive effect on the host plant, the efficacies of endophyte metabolites may show great clinical potential for medical and livestock treatments. Indeed, antibiotics are low-molecular-weight products made by microbes that inhibit the growth or kill phytopathogens agents such as bacteria, fungi, viruses, and protozoans (27, 28). Many important antibiotics are produced by endophytes in different plant species (29). However, only a few of all the plants existing on earth have ever been studied regarding their bacterial endophytic pool (30), increasing the probability to find new and beneficial endophytes with the potential to be applied in biotechnology. The microbiome of medicinal plants is extremely important because of increasing evidence on the spectrum of bioactive metabolites related to the activity of associated bacterial endophytes (31). Plant diseases caused by bacterial pathogens pose major constraints in crop production and cause significant annual damage worldwide (32). New and emerging bacterial disease problems and established problems in new geographical regions grab the headlines (32).  Many bacterial pathogens predominantly colonize internal locations within plants that are inaccessible to most spray-applied chemical and biological pesticides that target plant surfaces (33). Management strategies for plant bacterial diseases require great knowledge of the environmental conditions in order to identify the most suitable time for targeting the pathogen populations and to determine when the acute host tissues are sensitive to infection. The major pathogens of plants are parasitic plants, fungi, viruses, nematodes, and bacteria. (34). The most important bacterial ones belong to the genera of Agrobacterium, Ralstonia, Pectobacterium, Xylella, Erwinia, Xanthomonas, Pseudomonas, and Dickeya. An integrated management approach, including the use of plant host resistance, chemical intervention and biological controls, and cultural practices for inoculum reduction, typically represents the best strategy for effective and stable disease management

 

Materials and Methods                                                                             

Plant Material/Samples Collection: S. khuzestanica leaves samples were collected from three different areas including Lorestan, Khuzestan, and Ilam provinces located in the south and southwest of Iran. Plant leaves were cut and placed separately in polythene bags to avoid moisture losses and stored at 4oC for further investigation.

Isolation of Endophytic Bacteria: Briefly, leaves were washed under tap water to remove dust, and disinfected by sequential immersion in 70% ethanol for 5 minutes or sodium hypochloride for 20 minutes. Finally, and disinfected leaves were washed three times in sterilized distilled water and soaked in 10% NaHCO3 solution to disrupt the plant tissues and inhibit the growth of fungi (35). A gram of each leave sample was homogenized in potassium phosphate buffer (pH 7.0) followed by serial dilutions preparation. For isolation of endophytic bacterial strains, a loopful of homogenate samples was stork on modified Tryptic soy agar (TSA) and nutrient agar (NA) in three replications and incubated at 28 ºC for three days. Bacterial single colonies were selected based on their phenotypic characteristics such as colony morphology, color, and growth rate. They were kept in sterilized distilled water at 4 °C for further investigation.

Determination of Antibacterial Activity: Purified endophytic bacterial strains were grown on Tryptic Soy Broth (TSB) medium and their antibacterial activity against the phytopathogens R. solanacearum, P. carotovorum, and C. michiganensis, was determined in a randomized design in three replicates, and inhibition zone data were recorded and analyzed (24). Analysis of the variance of data was done based on a randomized complete design with three replications. The resulting data were analyzed using SAS software, and a comparison of means was done through Duncan's multiple range test.

Identification of Efficient Endophytic Bacteria: Phenotypic features of the efficient bacterial strains were determined based on standard bacteriological methods followed by 16S rRNA amplification and sequencing. For the extraction of bacterial genomic DNA, 50 mg of the freshly grown colonies was transferred into a 1.5 ml Eppendorf tube, and 480 µl TE buffer and 20 µl lysozyme solution (2 mg/ml) were added. The bacterial suspension was mixed and placed in a shaker incubator for 1 h, treated with 50 µl SDS solution 20 % and 5 µl Proteinase K solution, and kept in a bain-marie at 55 °C for 1 h. The bacterial DNA was extracted twice with phenol-chloroform-isoamyl alcohol, followed by precipitation with 80 µl sodium acetate (3 mol/l, pH 5) and 800 µl absolute ethanol. The DNA precipitate was centrifuged at 12000 rpm for 10 min, washed with ethanol 70 %, and air-dried. The extracted DNA was resuspended in 40 µl sterilized distilled water and stored at -20°C for further use (36). For the amplification of 16S rRNA genes, the extracted DNA was subjected to a polymerase chain reaction (PCR) using 16SF- (AGAGTTTGATCCTGGCTCAG) and 16SR- (GGTTACCTTGTTACGACTT) primers (37). The PCR program for 35 cycles was as follows:  DNA denaturation at 94 °C for 5 minutes, annealing for 30 seconds at 53 °C, and extension for 60 seconds at 72 °C. The PCR products were purified with a PCR purification kit (Macherey-Nagel, Germany) and subjected to sequencing (Bioneer Korea Co.). The obtained sequences were analyzed using BLAST software in the GenBank database NCBI.

Preparation of Cell-free Supernatant from Efficient Bacterial Strains: Selected bacterial strains were cultured in 250 ml Erlenmeyer flasks containing 100 ml of standard medium (TSB+ 0.1 g of MgSO4 7H20, 0.1 g of KC1, 0.05 g of KH2PO4, 0.05 g of K2HPO4, 0.2 g of CaC12 2H20, 0.4 g of yeast extract, 0.4 g of malt extract, 0.2 mL of trace elements, pH 7.2), incubated at 27 °C for 3 days in a shaker incubator at 160 rpm.  A total of one-liter volume of culture broth was centrifuged at 8000 rpm at 4 °C for 15 min and was filtered through Whatman no.1 filter paper. The spent culture broth was aseptically transferred into 250 ml flasks, and an equal volume of 1:1 (v/v) of ethyl acetate was added. This mixture was shaken vigorously for 30 min and was kept stationary for another 15 min to phase separation. The solvent was dried in a rotary evaporator under a vacuum to obtain the crude metabolite (38). The remaining residues were dried in a vacuum desiccator, re-dissolved in a small volume of ethyl acetate (1mg/ml), and stored at -20 °C for further use (39). A total of 2 μl of the ethyl acetate extract from each bacterial strain was used for GC/MS analysis. New unknown metabolites from bacterial crud extract were characterized using GC-MS [SHIMADZU QP2010] instrument (GC column oven temperature 35 °C, injector temperature 250 °C at split mode ratio 100 with a flow rate 1.25 ml/min). The MS with ion source temperature 200 °C, interface temperature 250 °C, scan range 45-450 m/z, event time 0.3 sec, solvent cut time 1 min, MS start time: 1 min, MS end time 50 min, ionization EI (-70ev) was employed for metabolites characterization.

Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) Determination: The minimum inhibitory concentration of crude extracts of bacterial endophytes was determined according to Andrews’ method (40) with some modifications. Briefly, the extracted solutions were prepared by dissolving 0.02 g/ ml in dimethyl sulfoxide (DMSO) and diluted to a final concentration of 20 mg/ ml in nutrient broth medium followed by preparation of serial dilution including 10 mg/ ml, 5 mg/ ml, 2.5 mg/ ml, 1.25 mg/ ml, 0.625 mg/ ml, and 0.312 mg/ ml in the same medium. Using McFarland standard number 0.5 (108 × 1.58 CFU/ ml) as a reference, a volume of 50 μl suspension of each sample was inoculated in 15 ml of nutrient broth medium and incubated for 24 hours at 28 °C. The 96-well microtiter plates were employed, and a volume of 100 μl of phytopathogenic bacterial strain suspension was added horizontally followed by adding 100 μl of prepared diluted crude extract at different concentrations vertically from top to bottom. The negative controls were 100 μl DMSO and 100 μl nutrient broth medium, and the positive control was 1 mg/ ml streptomycin (Sigma-Aldrich Switzerland). Three replicates were employed for each sample and plates were incubated for 24 hours at 28 °C. MIC values (lowest concentration of each extract without visible growth) were determined visually.

Identification of Bioactive Metabolites: The volatile and semi-volatile secondary metabolites from the crude extracts of bacterial strains were analyzed by GC–MS (SHIMADZU QP2010, 41 Osama A. A. Mohamad). Accordingly, for GC-MS analysis, a Shimadzu model GC 2010 Plus (Kyoto, Japan) gas chromatograph coupled with a Shimadzu Quadruple-MS model QP2010 SE mass spectrometer was used. Secondary metabolites were separated on a 30 m × 0.22 mm i.d. fused-silica capillary column coated with 0.25 μm film of BP-5 (Shimadzu), and a splitless injector with a 1 mm internal diameter glass liner. The Shimadzu Quadruple-MS model QP2010 SE mass spectrometer was used to identify volatile and semi-volatile secondary metabolites from the crude extract of bacterial strains. Also, an HP-5MS fused silica capillary column was applied (Hewlett-Packard, 30 m × 0.25 mm i.d. 0.25 μm film, cross-linked to 5% phenyl methyl siloxane stationary phase). The entire system was checked using ChemStation software (Hewlett- Packard, version A.01.01). Electron impact mass spectra were recorded at 70 eV, and ultra-high pure (99.999%) HAE gas was used as the carrier gas at a flow rate of 1 ml. min−1. The injection volume was found to be 1 μl, and all injections were done in a split-less mode. The injector and detector temperature settings were 250 °C and 280 °C, respectively. The column oven temperature was set initially at 35 °C for 5 min, then raised to 300 °C (ramp: 4◦C/min) and held for 20 min. The database of the National Institute of Standards and Technology (NIST) was applied to interpret the mass spectrum of GC-MS with more than 62000 patterns. Using the obtained data from NIST05 (National Institute of Standards and Technology, US) and WILEY 8 libraries, the existing bioactive compounds in bacterial crude extracts were identified through comparison to mass spectra. Finally, the molecular weights and structural metabolites formula of the tested bacterial metabolites were determined.

 

Results and Discussion

Isolation and Determination of the Antibacterial Activity of Endophytic Bacterial Strains: Based on the different cultural conditions on the TSA medium, 27 endophytic bacteria were isolated from S. khuzestanica. All endophytic strains were screened for their antibacterial activity toward five plant pathogens. Based on the inhibitory activity of endophytic bacterial strains against the different species of plant pathogenic bacteria, the most bioactive five strains were selected as the representative (Table 1). They showed significant antibacterial activity against plant pathogenic bacteria strains with the diameter of inhibition zones as follows: 24 mm for P. carotovorum, 21 mm for R. solanacearum, 20 mm for B. nigrifluens, 17 mm for C. michiganensis, and 19 mm for E. amylovora. All values are the mean of three repetitions of independent experiments. The comparison of the average interaction effect of endophytic bacteria and pathogenic bacteria is presented in Table 2.

 

Table 1- Antagonistic Activity of Endophytic Bacterial Strains Isolated from Satureja khuzestanica against some Plant Pathogenic Bacteria

Streptomycin

P. oryzihabitans

P. azotoformans

P. gessardii

P.fluorescens

B.megaterium

 

23

16

15

9

19

21

R. Solanacearum

20

17

16

7

14

17

C. michiganensis

28

24

12

13

20

11

P. carotovorum

30

20

12

10

20

9

B.nigrifluens

27

19

18

8

16

9

E. amylovora

*numbers show inhibition zone in mm

 

 

Table 2- Comparison of the average inhibitory effect of the endophytic bacterial strains against plant pathogenic bacteria in vitro

Plant Pathogenic Bacteria

Endophytic Bacteria

Inhibition Zone

R. Solanacearum

B.megaterium

21 ± 1.73 de

P.fluorescens

19 ± 1 efg

P. gessardii

9 ± 1 nop

P. azotoformans

15 ± 2 hijk

P. oryzihabitans

16 ± 1.73 ghi

Streptomycin

23 ± 2 cd

C. michiganensi

B.megaterium

17 ± 2.65 fghi

P.fluorescens

14 ± 1 ijkl

P. gessardii

7 ± 1 p

P. azotoformans

16 ± 3 ghij

P. oryzihabitans

17 ± 1 fghi

Streptomycin

20 ± 1 def

P. carotovorum

B.megaterium

11 ± 1 lmno

P.fluorescens

20 ± 1 def

P. gessardii

13 ± 1.41 jklm

P. azotoformans

12 ± 1 klmn

P. oryzihabitans

24 ± 3.61 c

Streptomycin

28 ± 2.65 ab

B.nigrifluens

B.megaterium

9 ± 1 nop

P.fluorescens

20 ± 2.45 def

P. gessardii

10 ± 0.82 mnop

P. azotoformans

12 ± 1.41 klmn

P. oryzihabitans

20 ± 0.82 def

Streptomycin

30 ± 1.41 a

E. amylovora

B.megaterium

9 ± 0.82 nop

P.fluorescens

16 ± 0.82 ghij

P. gessardii

8 ± 0.82 op

P. azotoformans

18 ± 0.82 efgh

P. oryzihabitans

19 ± 0.82 efg

Streptomycin

27 ± 0.82 b

Different letters between rows indicate a significant difference at the 1% probability level

 

 

Representative bacterial strains (MON 01, MON 02, MON 05, MON 06, and MON 07) were identified based on their 16S rRNA gene sequences. They showed 99% homology with 16S rRNA encoding gene sequences of verified species and they submitted to the GenBank database with allocated accession numbers (Table 3).

Bacteriostatic and Bactericidal Activity of the Bacterial Crude Extract: Metabolites from endophytic bacterial representative strains showed bacteriostatic and bactericidal activity against three Gram-negative and one Gram-positive phytopathogenic bacteria. Ethyl acetate extracts showed bacteriostatic effects with MIC ranging from 0.312 to 5 mg/ ml and bactericidal activity ranging from 0.625 to 20 mg/ ml (Table 4, 5).

 

 

Table 3- NCBI 16S rRNA Genes of Endophytic Bacterial Strains Isolated from Satureja khuzestanica Accession Number

GenBank accession number

Bacterial name

OL342346

Bacillus(Priestia) megaterium strain MON 02

OL342347

Pseudomonas fluorescens strain MON 06

OL342348

Pseudomonas gessardii strain MON 07

OL342349

Pseudomonas azotoformans strain MON 05

OL342350

Pseudomonas oryzihabitans strain MON 01

 

Table 4- Minimum Inhibitory Concentrations of Crude Extracts of Secondary Metabolites of Bacterial Endophytes isolated from Satureja khuzestanica

Streptomycin

MIC (mg/ml)

P. oryzihabitansMIC (mg/ml)

P. azotoformans

MIC (mg/ml)

P. gessardii MIC (mg/ml)

P. Fluorescens

MIC (mg/ml)

B. megateriumMIC (mg/ml)

 

0.312

2.5

1.25

1.25

0.625

0.625

R. Solanacearum

0.312

1.25

1.25

2.5

5

0.625

C. Michiganensis

0.312

0.312

1.25

1.25

0.625

1.25

P. carotovorum

0.156

0.312

2.5

1.25

0.312

1.25

B. nigrifluens

0.156

0.625

0.625

2.5

2.5

2.5

E. amylovora

 

Table 5- Minimum Bactericidal concentrations of crude extracts of secondary metabolites of bacterial endophytes isolated from Satureja khuzestanica of bacterial endophytes isolated from Satureja khuzestanica

Streptomycin MBC (mg/ml)

P. oryzihabitans MBC (mg/ml)

P. azotoformans MBC (mg/ml)

P. gessardii MBC (mg/ml)

P. fluorescens MBC (mg/ml)

B. megaterium MBC (mg/ml)

 

0.625

5

5

2.5

1.25

2.5

R. solanacearum

0.625

5

2.5

5

10

1.25

C. michiganensis

1.25

0.625

5

5

1.25

5

P. carotovorum

0.625

0.625

5

2.5

1.25

2.5

B. nigrifluens

0.625

1.25

1.25

5

5

5

E. amylovora

               

 

 

.Detection of Bioactive Metabolites by GC-MS Analysis: Spectra of GC-MS from representative endophytic bacterial strains isolated from Satureja khuzestanica were interpreted by the database of the National Institute of Standards and Technology (NIST) with 62000 patterns. The chromatogram of bacterial metabolites was identified according to the peak area, retention time, and effect. Characterization metabolites from tested endophytic bacterial strains isolated from S. khuzestanica revealed that they have the capacity to produce bioactive agents.

Among the 27 bacterial strains isolated from S. khuzestanica on the TSA medium, the most active representative was selected for identification based on the 16S rRNA gene sequences. The strain MON 02 was identified as Bacillus (Priestia) megaterium by 99% similarity to B. megaterium which was submitted in the GenBank under accession number OL342346. Its major constituent with 67.34 % area was Prodox (2, 4-Di-tert-butylphenol) at the retention time of 20.578, which is a common natural product that exhibits potent toxicity against almost all testing microbes, including the producing species (Table 6). The 2, 4-DTBP is found in 16 species of bacteria in 10 families, such as nitrogen-fixing cyanobacteria and Gram-positive bacteria such Bacillus. Bioactivities of 2, 4-DTBP as antibacterial activities, antiviral activities, antifungal activities, pesticides (Nematicidal activities), antioxidant activities, and anti-inflammatory activities are reported in the literature.

 

 

 

Table 6- GC-MS Analysis of Bacillus (Priestia) Megaterium Crude Extract Isolated from Satureja khuzestanica

Retention time (min)

area%

metabolite

efficacy

20.578

67.34

prodox (2,4-di-tert-butylphenol)

antibacterial, antiviral, antifungal, nematicide, antioxidant, anti-inflammatory

21.476

10.59

hexadecane

antimicrobial and antioxidant

22.006

4.89

2,5-cyclohexadiene-1,4-dione, 2,6-bis(1,1-dimethylethyl)-

-

22.695

6.87

eicosane

antibacterial

24.853

4.70

isobutyl phthalate

antibacterial

25.910

5.61

dibutyl phthalate

antibacterial

antitumor

anticancer

herbicide

 

100

 

 

 

 

Bacillus is a Gram-positive bacterium that has been used industrially for decades and its product portfolio is continuously growing. Its metabolites include enzymes such as α-amylases, β-amylases, penicillin G acylase, xylanase, hydrolases, and cytochrome monooxygenase. Furthermore, it has been shown that Bacillus spp. has well biocontrol properties by promoting plant growth and reducing plant diseases caused by both plant-pathogenic fungi and bacteria (42). These properties are mostly related to their secondary metabolite profiles (43).

The strain MON 06 was identified as Pseudomonas fluorescens by 99.66 % similarity to P. fluorescens, which was submitted to the GenBank under accession number OL342347. One of its major constituents was Dibutyl phthalate (DBP) at the retention time of 13.820 (table 7).

Dibutyl phthalate (DBP) is a bioactive ester produced by actinomycetes (44, 45), fungi (46), algae (47), and also higher plants (48). It acts as an antitumor and anticancer compound (49), and herbicide (50). Also, the cytotoxic activity of DBP against tumor cell lines has been evaluated by Mabrouk et al. (2008). The other identified metabolites from P. fluorescens were beta-D-Glucopyranose (anti-bacterial and antioxidant) (51), Cyclo-Leu-Pro-diketopiperazine (antifungal) (52), and Staflex.

 

 

Table 7- GC-MS Analysis of Pseudomonas fluorescens Crude Extracts Isolated from Satureja khuzestanica

retention time (min)

area%

metabolite

efficacy

11.774

18.16

beta-d-glucopyranose

anti-bacterial/ antioxidant

13.719

10.49

l-phe-d-pro lactam

anticancer

13.820

7.22

kodaflex (dibutyl phthalate )

antibacterial

antitumor

anticancer

herbicide

14.344

1.45

staflex DBP

antibacterial

14.758

11.35

Cyclo (leucyloprolyl)

antibacterial

14.872

16.15

staflex DBP

antibacterial

14.950

28.54

cyclo-leu-pro-diketoiperazine

antifungal

15.059

5.09

cyclo-(leu-pro)

antifungal

15.125

1.56

pyrrolo(1,2-a) pyrazine-1,4-dione, hexahydrate

antifungal

 

100

 

 

 

 

Strain MON 07 was identified as P. gessardii which was submitted to the GenBank under accession number OL342348. Its major metabolites were 2, 4-di-tert-butylphenol (40.44% area), trans-2-isopropyl-trans-5-methyl-1-hexene (17.34 area), tetradecane (12.08), hexadecane (11.56), and l-phe-d-pro lactam (7.78), (Table 8).

 

2,4-Di-tert-butylphenol is a common natural product that exhibits potent toxicity against almost all testing organisms, including bacteria and fungi species (53). The antimicrobial efficacy of dibutyl phthalate (DBP) has been reported from Streptomyces (54). Also, this compound shows strong activity against Gram-positive and Gram-negative bacteria, as well as unicellular and filamentous fungi (45).

 

 

Table 8- GC-MS Analysis of Pseudomonas gessardii Crude Extracts Isolated from Satureja khuzestanica

retention time (min)

area%

metabolite

efficacy

15.722

17.34

trans-2-isopropyl-trans-5-methyl-1-hexene

antifungal

18.781

12.08

tetradecane

antibacterial

20.556

40.44

2,4-di-tert-butylphenol

antibacterial, antiviral, antifungal, nematicide, antioxidant, anti-inflammatory

21.453

11.56

hexadecane

antimicrobial and antioxidant

23.838

5.42

eicosane

antibacterial

24.780

7.78

l-phe-d-pro lactam

anticancer

25.889

5.38

dibutyl phthalate

antibacterial

antitumor

anticancer

herbicide

 

100

 

 

 

 

Strain MON05 was identified as P. azotoformans. It showed 99.66 % similarity to P. azotoformans strain D95_SO which was submitted to the GenBank under accession number OL342349. It is reported that P. azotoformans was used as an effective biocontrol bacterium against Colletotrichum orbiculare on cucumber (55). The findings of scholars indicated that P. azotoformans has efficacy on drought stress alleviation in wheat plants through various biochemical mechanisms. The P. azotoformans isolated from soil samples in China appeared to have strong inhibitory activities against Fusarium fujikuroi, a serious rice fungal pathogen. The identified metabolites from P. azotoformans include tetradecane (22.76 % area), 2,4-di-tert-butylphenol (22.44 % area), eicosane (10.40 % area), dodecane (10.88 % area), dibutyl phthalate, heptadecane, behenyl chloride, hexadecane, and isomenthone (Table 9).

 

 

Table 9- GC-MS Analysis of Pseudomonas Azotoformans Crude Extracts Isolated from Satureja khuzestanica

retention time (min)

area%

metabolite

efficacy

15.367

1.68

Iso-menthone

antibacterial, antiviral, antifungal

15.762

10.80

dodecane

antibacterial, antifungal

18.841

22.76

tetradecane

antibacterial

20.183

2.88

hexadecane

antimicrobial

antioxidant

20.590

22.44

2,4-di-tert-butylphenol

antibacterial, antiviral, antifungal nematicide, antioxidant, anti-inflammatory

21.513

21.04

hexadecane

antimicrobial

antioxidant

22.015

2.38

behenyl chloride

antibacterial

22.704

2.71

heptadecane

anti-inflammatory

antineoplastic, antibacterial, antifungal

23.883

10.40

eicosane

antibacterial

25.911

2.90

dibutyl phthalate

antibacterial

antitumor

anticancer

herbicide

 

100

 

 

 

 

Rahbar et al (2012) found the good antimicrobial activity of tetradecane, hexadecanoic acid, and pentadecane against seven Gram-positive and Gram-negative bacteria (Bacillus subtilis, Enterococcus faecalis, S. aureus, Staphylococcus epidermidis, Escherichia coli, Pseudomonas aeruginosa, and Klebsiella pneumoniae), as well as three fungi (Candida albicans, Saccharomyces cerevisiae and Aspergillus niger) (56). Also, Hexadecane is reported for antibacterial and antioxidant activities.

Bacterial strain MON 01 was identified as P. oryzihabitans and showed 99 % similarity to P. oryzihabitans strain ER34 which was submitted to the GenBank under accession number OL342350. In a study by Kleopatra Leontidou, P. oryzihabitansas was isolated as plant growth-promoting rhizobacteria from halophytes and drought-tolerant plants.

Endophytic P. oryzihabitans was isolated from soybean grown in soil treated with glyphosate. The bacterium P. oryzihabitans was the most potent antagonistic bacteria which reduced disease incidence and severity compared to the untreated control (168-2016). So far, it has shown promising results as a potential biocontrol agent against plant parasitic nematodes (s0038). In the present study, metabolites from P. oryzihabitans were phenol,2-methyl-5- (1- methylethyl) or carvacrol (26.47 % area), 2,4-di-tert-butylphenol (26.06 % area), hexadecane (13.08 % area), and tetradecane (11.74 % area) (table10).

 

 

Table 10- GC-MS Analysis of Pseudomonas Oryzihabitans Crude Extracts Isolated from Satureja khuzestanica

retention time(min)

area%

metabolite

efficacy

15.748

7.12

n-nanodecane

antibacterial

antifungal

16.054

3.29

beta.fenchyl alcohol

antibiofilm and antihyphal

17.761

26.74

phenol, 2-methyl-5-(1-methylethyl)

[carvacrol}

antibacterial, antiviral, antifungal

18.818

11.74

tetradecane

antibacterial

20.178

2.05

hexadecane

antimicrobial

antioxidant

20.593

26.05

2,4-di-tert-butylphenol

antibacterial, antiviral, antifungal, nematicidal, antioxidand, anti-inflammatory

21.496

13.08

hexadecane

antimicrobial

antioxidant

23.870

6.58

eicosane

antibacterial

25.905

1.77

dibutyl phthalate

antibacterial

antitumor

anticancer

herbicide

26.012

1.84

eicosane

antibacterial

 

100

 

 

 

 

All aspects of the interaction between microbes and plants are not fully understood. Nevertheless, more documents show that plant-associated microorganisms provide substantial benefits to agriculture and the environment. In brief, in this study, for the first time, bacterial endophytes were isolated from S. khuzestanica and their crude extracts showed notable inhibitory activities against tested phytopathogenic bacteria. The antibacterial analysis result of S. khuzestanica endophytic bacteria showed the potential use of these bacteria for the isolation of pure bioactive metabolites and the possibility of making new drugs. Further studies need to be carried out to isolate and identify pure active metabolites produced by S. khuzestanica endophytic bacteria.

 

The authors have no conflicts of interest to declare.

  • References

    • Craker LE., Gardner ZE. Medicinal plants and tomorrow’s pharmacy: An American perspective. In Bogers RJ, Craker LE, Lange D, editors. Medicinal and aromatic plants: Agricultural, commercial, ecological, legal, pharmacological and social aspects. Netherlands: Springer; 2006: 29-41.
    • Jamzad Z. Satureja rechingeri (Labiatae) – a new species from Iran. Annuals of Naturhistoriches Museum Wien 1996; 98: 75–7.
    • Jamzad Z. Thymus and Satureja species of Iran. Tehran: Research Institute of Forest and Rangelands; 2009.
    • Hadian J., Mirjalili MH., Kanani MR., Salehnia A., Ganjipoor P. Phytochemical and morphological characterization of Satureja khuzistanica Jamzad populations from Iran. Journal of Chemistry & Biodiversity 2011; 8 (5): 902-15.
    • Motaharinia Y., Hazhir MS., Rezaee MA., Vahedi S., Rashidi A., Hosseini W., Hakhamaneshi MS., Rahmani MR. Comparison of in vitro antimicrobial effect of ethanol extracts of Satureja khuzestanica, Rhus coriaria, and Ocimum basilicum L. on Helicobacter pylori. Journal of Medicinal Plants Research 2012; 6 (21): 3749-53.
    • Hadian J., Akramian M., Heydari H., Mumivand H., Asghari B. Composition and in vitro antibacterial activity of essential oils from four Satureja species growing in Iran. Journal of Natural Product Research 2012; 26 (2): 98-108.
    • Shahab A., Haghighati F., Baeeri M., Jamalifar H., Abdollahi M. A clinical, microbiological and immunological comparison between subgingival irrigation with DentolTM and chlorhexidine in advanced periodontitis. Archives of Medical Science 2011; 7 (1): 154–60.
    • Seghatoleslami S., Samadi N., Salehnia A., Azimi S. Antibacterial activity of endemic Satureja Khuzistanica Jamzad essential oil against oral pathogens. Iranian Endodontic Journal 2009; 4 (1): 5.
    • Sadeghi-Nejad, Shiravi F., Ghanbari S., Alinejadi M., Zarrin M. Antifungal activity of Satureja khuzestanica (Jamzad) leaves extracts. Jundishapur Journal of Microbiology 2010; 3 (1): 36–40.
    • Zarrin M., Amirrajab N., Sadeghi-Nejad B. In vitro antifungal activity of Satureja Khuzestanica Jamzad against Cryptococcus neoformans. Pakistan Journal of Medical Sciences 2010; 26 (4): 880–2.
    • Kheirandish F., Delfan B., Farhadi S., Ezatpour B., Khamesipour A., Kazemi B., Ebrahimzade F., Rashidpour M. The effect of Satureja khuzestanica essential oil on the lesions induced by Leishmania major in BALB/c mice. African Journal of Pharmacy and Pharmacology 2011; 5 (5): 648-53.
    • Zibaei M., Sarlak A., Delfan B., Ezatpour B., Azargoon A. Scolicidal effects of Olea europaea and Satureja khuzestanica extracts on protoscolices of hydatid cysts. The Korean Journal of Parasitology 2012, 50 (1): 53–5.
    • Abdollahi M., Salehnia A., Mortazavi SH., Ebrahimi M., Shafiee A., Fouladian F., Keshavarz K., Sorouri S., Khorasani R., Kazemi A. Antioxidant, antidiabetic, antihyerlipidemic, reproduction stimulatory properties and safely of essential oil of Satureja khuzestanica in rat in vivo: A toxicopharmacological study. Medical Science Monitor: International Medical Journal of Experimental and Clinical Research 2003; 9 (9): 331–5.
    • Rezvanfar MA., Sadrkhanlou RA., Ahmadi A., Shojaei SH., Rezvanfar MA., Mohammadirad A., Salehnia A., Abdollahi M. Protection of cyclophosphamide-induced toxicity in reproductive tract histology, sperm characteristics, and DNA damage by an herbal source; evidence for role of free-radical toxic stress. Journal of Human & Experimental Toxicology 2008; 27 (12): 901–10.
    • Rezvanfar MA., Farshid AA., Sadrkhanlou , Ahmadi A., Rezvanfar MA., Salehnia A., Abdollahi M. Benefit of Satureja khuzestanica in subchronically rat model of cyclophosphamide-induced hemorrhagic cystitis. Journal of Experimental and Toxicologic Pathology 2010; 62 (3): 323-30.
    • Ahmadvand H., Tavafi M., Khalatbary AR. Hepatoprotective and hypolipidemic effects of Satureja khuzestanica essential oil in alloxan-induced type 1 diabetic rats. Iranian Journal of Pharmaceutical Research 2012; 11 (4): 1219-26.
    • Hashemi MB., Niakousari M., Saharkhiz MJ., Eskandari MH. Effect of Satureja khuzestanica essential oil on oxidative stability of sunflower oil during accelerated storage. Journal of Natural Product Research 2012; 26 (15): 1458-63.
    • Saei-Dehkordi S., Fallah AA., Heidari-Nasirabadi M., Moradi M. Chemical composition, antioxidative capacity and interactive antimicrobial potency of Satureja khuzestanica Jamzad essential oil and antimicrobial agents against selected food-related microorganisms. International Journal of Food Science & Technology 2012; 47 (8): 1579–85.
    • Amanlou M., Dadkhah F., Salehnia A., Farsam H., Dehpour AR. An anti-inflammatory and anti-nociceptive effects of hydroalcoholic extract of Saturega khuzestanica Jamzad extract. Journal of Pharmacy and Pharmaceutical Sciences 2005; 8 (1): 102-6.
    • Ghazanfari G., Minaie B., Yasa N., Nakhai LA., Mohammadirad A., Nikfar S., Dehghan G., Boushehri VS., Jamshidi H., Khorasani R., Salehnia A., Abdolahi M. Biochemical and histopathological evidences for beneficial effects of Satureja khuzestanica Jamzad essential oil on the mouse model of inflammatory bowel diseases. Journal of Toxicology Mechanisms and Methods 2006; 16 (7): 365–72.
    • Rastegarpanah M., Omidzohour N., Vahedi H., Malekzadeh R., Hashemian F., Safarnavadeh T., Abdollahi M. Management of human ulcerative colitis by SaturexTM: A randomized controlled trial. International Journal of Pharmacology 2011; 7 (4): 516-21.
    • Schulz B., Boyle C. What are endophytes? In: Schulz BJE, Boyle CJC, Sieber TN, editors. Microbial root endophytes. Berlin: Springer-Verlag; 2006: 1-13.
    • Lodewyckx C., Vangronsveld J., Porteous F., Moore ER., Taghavi S., Mezgeay M., der Lelie DV. Endophytic bacteria and their potential applications. Critical Reviews in Plant Sciences 2002; 21 (6): 583–606.
    • Ryan RP., Germaine K., Franks A., Ryan DJ., Dowling DN. Bacterial endophytes: recent developments and applications. FEMS Microbiology Letters 2008; 278 (1): 1–9.
    • Pandey SS., Singh S., Pandey H., Srivastava M., Ray T., Soni S., Pandey A., Shanker K., Babu CS., Banerjee S., Gupta MM. Endophytes of Withania somnifera modulate in planta content and the site of withanolide biosynthesis. Journal of Scientific Reports 2018; 8 (1): 1-9.
    • Strobel G., Daisy B., Castillo U., & Harper J. Natural products from endophytic microorganisms. Journal of Natural Products 2004; 67 (2): 257–68.
    • Jakubiec-Krzesniak K., Rajnisz-Mateusiak A., Guspiel A., Ziemska J., Solecka J. Secondary metabolites of actinomycetes and their antibacterial, antifungal and antiviral properties. Polish Journal of Microbiology 2018; 67 (3): 259–72.
    • Tripathi VC., Satish S., Horam S., Raj S., Arockiaraj J., Pasupuleti M., Dikshit DK. Natural products from polar organisms: structural diversity, bioactivities and potential pharmaceutical applications. Journal of Polar Sciences 2018; 18: 147–66.
    • Eljounaidi K., Lee SK., Bae H. Bacterial endophytes as potential biocontrol agents of vascular wilt diseases–Review and future prospects. Journal of Biological Control 2016; 103: 62–8.
    • Strobel GA., Daisy B. Bioprospecting for microbial endophytes and their natural products. Microbiology and Molecular Biology Reviews 2003; 67 (4): 491–502.
    • Emiliani G., Mengoni A., Maida I., Perrin E., Chiellini C., Fondi M., Gallo E., Gori L., Maggini V., Vannacci A., Biffi S., Firenzuoli F., Fani R. Linking bacterial endophytic communities to essential oils: Clues from Lavandula angustifolia Mill. Evidence-Based Complementary and Alternative Medicine 2014; 650-905.
    • Sundin GW., Castiblanco LF., Yuan X., Zeng Q., Yang CH. Bacterial disease management: Challenges, experience, innovation and future prospects: Challenges in bacterial molecular plant pathology. Journal of Molecular Plant Pathology 2016; 17 (9): 1506–18.
    • Ajilogba , Babalola OO. GC–MS analysis of volatile organic compounds from Bambara groundnut rhizobacteria and their antibacterial properties. World Journal of Microbiology and Biotechnology 2019; 35 (6): 1-9.
    • Considine DM., Considine GD. Foods and food production encyclopedia. New York: Springer; 1995.
    • Muzzamal H. Isolation, identification and screening of endophytic bacteria antagonistic to biofilm formers. Pakistan Journal of Zoology 2012; 44 (1): 249-57.
    • Liu YH., Guo JW., Salam N., Li L., Zhang YG., Han J., Mohamad OA., Li WJ. Culturable endophytic bacteria associated with medicinal plant Ferula songorica: Molecular phylogeny, distribution and screening for industrially important traits. Biotech 2016; 6 (2): 1-9.
    • Stackebrandt E., Goodfellow M. (Eds.) Nucleic acid techniques in bacterial systematics (modern microbiological methods). XXIX + 329 S., 46 Abb., 28 Tab. Chichester — New York — Brisbane — Toronto — Singapore. John Wiley & Sons; 1991.
    • Bhardwaj A., Sharma D., Jodan N., Agrawal PK. Antimicrobial and phytochemical screening of endophytic fungi isolated from spikes of Pinus rouxburghii. Archives of Clinical Microbiology 2015; 6 (3): 1.
    • Sathiyanarayanan, Gandhimathi R., Sabarathnam B., Seghal Kiran G., Selvin J. Optimization and production of pyrrolidone antimicrobial agent from marine sponge-associated Streptomyces sp. MAPS15. Bioprocess and Biosystems Engineering 2014; 37 (3): 561-73.
    • Andrews JM. Determination of minimum inhibitory concentration. Journal of Antimicrobial Chemotherapy 2001; 48 (1): 5-16.
    • Mohamad OA., Li L., Ma JB., Hatab S., Xu L., Guo JW., Rasulov BA., Liu YH., Hedlund BP., Li WJ. Evaluation of the antimicrobial activity of endophytic bacterial populations from Chinese traditional medicinal plant licorice and characterization of the bioactive secondary metabolites produced by Bacillus atrophaeus against Verticillium dahlia. Frontiers in Microbiology 2018; 9: 924.
    • Fan B., Li YL., Li L., Peng XJ., Bu C., Wu XQ., Borriss R. Malonylome of the plant growth promoting rhizobacterium with potent biocontrol activity, Bacillus amyloliquefaciensData in Brief 2017; 10: 548–50.
    • Ongena M., Jacques P. Bacillus lipopeptides: Versatile weapons for plant disease biocontrol. Journal of Trends in Microbiology 2008; 16 (3): 115–25.
    • Morsi NM., Atef NM., El-Hendawy H. Screening for some Bacillus Inhabiting Egyptian soil for the biosynthesis of biologically active metabolites. Journal of Food, Agriculture & Environment 2010; 8 (2): 1166-73.
    • Roy RN., Laskar S., Sen SK. Dibutyl phthalate, the bioactive compound produced by Streptomyces albidoflavus 2. Journal of Microbiological Research 2006; 161 (2): 121-6.
    • Mabrouk AM., Kheiralla ZH., Hamed ER., Youssry AA., Abdel Aty AA. Production of some biologically active secondary metabolites from marine-derived fungus Varicosporina ramulosa. Malaysian Journal of Microbiology 2008; 4 (1): 14-24.
    • Babu B., Wu JT. Production of phthalate esters by nuisance freshwater algae and cyanobacteria. Science of the Total Environment 2010; 408 (21): 4969-75.
    • Ruikar AD., Gadkari TV., Phalgune UD., Puranik VG., Deshpande NR. Dibutyl phthalate, a secondary metabolite from Mimusops elengi. Journal of Chemistry of Natural Compounds 2011; 46 (6): 955-6.
    • Ogawa H., Yamashita Y., Katahira R., Chiba S., Iwasaki T., Ashizawa T., Nakano H. UCH9, a new antitumor antibiotic produced by Streptomyces: I. Producing organism, fermentation, isolation and biological activities. The Journal of Antibiotics 1998; 51 (3): 261-6.
    • Lee HB., Kim CJ., Kim JS., Hong KS., Cho KY. A bleaching herbicidal activity of methoxyhygromycin (MHM) produced by an actinomycetes strain Streptomyces sp. 8E-12. Journal of Letters in Applied Microbiology 2003; 36 (6): 387-91.
    • Matin MM., Bhuiyan MM., Debnath DC., Manchur MA. Synthesis and comparative antimicrobial studies of some acylated D-glucofuranose and D-glucopyranose derivatives. International Journal of Biosciences 2013; 3 (8): 279-87.
    • Nishanth Kumar S., Mohandas C., Nambisan B. Purification of an antifungal compound, cyclo (l-Pro-d-Leu) for cereals produced by Bacillus cereus thuringiensis associated with entomopathogenic nematode. Journal of Microbiological Research 2013; 168 (5): 278-88.
    • Zhao F., Wang P., Lucardi RD., Su Z., Li S. Natural Sources and Bioactivities of 2,4-di-tert-butylphenol and its analogs. Toxins 2020; 12 (1): 35.
    • Lee KH., Kim JH., Lim DS., Kim CH. Anti-leukaemic and anti-mutagenic effects of di (2-ethylhexyl) phthalate isolated from Aloe vera Linne. Journal of Pharmacy and Pharmacology 2000; 52 (5): 593-8
    • Sang MK., Kim EN., Han GD., Kwack MS., Jeun YC., Kim KD. Priming mediated systemic resistance in cucumber induced by Pseudomonas azotoformansGC-B19 and Paenibacillus elgii MM-B22 against Colletotrichum orbiculare. Phytopathology 2014; 104 (8): 834-42.
    • Rahbar N., Shafaghat A., Salimi F. Antimicrobial activity and constituents of the hexane extracts from leaf and stem of Origanum vulgare L. sp. Viride (Boiss.) Hayek. Growing wild in Northwest Iran. Journal of Medicinal Plants Research 2012; 6 (13): 2681-5.