نوع مقاله : پژوهشی- فارسی

نویسندگان

1 دانشجوی کارشناسی ارشد گروه زیست‌شناسی، دانشکدۀ علوم پایه، دانشگاه آزاد اسلامی، واحد مشهد، مشهد، ایران

2 استادیار گروه زیست‌شناسی، دانشکدۀ علوم پایه، دانشگاه آزاد اسلامی، واحد مشهد، مشهد، ایران

3 دانشیار گروه زیست‌شناسی، دانشکدۀ علوم پایه، دانشگاه آزاد اسلامی، واحد مشهد، مشهد، ایران

چکیده

مقدمه: تاکنون نتایج نشان داده است دلیل مهم مقاومت باکتری اشرشیا کلی به آنتی‌بیوتیک بتالاکتام، وجود بتالاکتامازهای وسیع‌الطیف (ESBLs) است که محصول بیان ژن‌های SHV و TEM هستند. همچنین، مطالعات زیادی نشان می‌دهند استفاده از نانوذرات می‌تواند برای از بین بردن مقاومت باکتری‌ها مؤثر باشد؛ بنابراین، هدف از این تحقیق، بررسی تأثیر نانوذرات نقره بر میزان بیان ژن مقاومت به بتالاکتاماز blaTEM و تعیین الگوی مقاومت آنتی‌بیوتیکی در سویه‌های اشرشیا کلی است.
مواد و روش‏‏ها: در این مطالعة مقطعی - توصیفی 64 اشرشیا کلی از 11 آزمایشگاه تشخیص طبی جمع‌آوری شده و با استفاده از روش‌های استاندارد آزمایشگاهی و کشت اختصاصی تأیید هویت شده‌اند. برای بررسی وجود ژن‌ blaTEM از روش PCR استفاده شد. به‌منظور ارزیابی الگوی حساسیت آنتی‌بیوتیکی سویه‌ها، روش انتشار دیسک براساس پروتکل CLSI انجام شد. نانوذرة نقره با عصارة زنجبیل ساخته و برای بررسی اثر نانوذرة نقره بر بیان ژن  blaTEMاز روش Real time PCR استفاده شد.
نتایج: از 64 سویة اشرشیا کلی مقاوم 61 سویه به بتالاکتام مقاوم بودند. ارزیابی فنوتیپی الگوی مقاومت آنتی‌بیوتیکی سویه‌های اشرشیا کلی مقاوم به بتالاکتام نشان داد 90 درصد به پنی‌سیلین، 66 درصد به کربنی‌سیلین، 87 درصد به اریترومایسین، 85 درصد به سفوتاکسیم، 84 درصد به سفتریاکسون، 49 درصد به جنتامایسین، 37 درصد به سپیروفلوکساسین 22 درصد به ایمی‌پنم و 12 درصد به لینزولید مقاومت داشتند؛ یعنی بیشترین میزان مقاومت آنتی‌بیوتیکی به‌ترتیب متعلق به پنی‌سیلین (90 درصد) و اریترومایسین (87 درصد) و کمترین نسبت به ایمی‌پنم (22 درصد) و لینزولید (12 درصد) بود. بررسی مولکولی نشان‌دهندة حضور ژن blaTEM در تمام سویه‌ها بود. نتیجة بررسی ریل تایم روی 3 سویه که وجود ژن blaTEM در آنها توسط PCR تأیید شده بود و تحت تیمار نانوذرات نقره قرار گرفته بودند نشان داد تأثیر نانوذرات نقره بر بیان ژن blaTEM معنادار و کاهنده است و می‌تواند با کاهش بیان ژن blaTEMو کاهش ترشحآنزیم‌های بتالاکتاماز در باکتری، اثربخشی آنتی‌بیوتیک‌های بتالاکتام را افزایش و مقاومت باکتری را به این گروه از آنتی‌بیوتیک‌ها کاهش دهد.
بحث و نتیجه‏گیری: وجود 61 سویة مقاوم از 64 سویه در مطالعة حاضر نشان‌دهندة افزایش مقاومت اشرشیا کلی مقاوم نسبت به آنتی‌بیوتیک‌های مختلف بوده که این مسئله یک هشدار جدی برای درمان عفونت‌های ناشی از اشرشیا کلی است. موثربودن نانوذرة نقره بر بیان ژن blaTEM نشان می‌دهد این ماده می‌تواند یک جایگزین خوب یا همراه مناسب برای آنتی‌بیوتیک‌های موجود مدنظر باشد.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Evaluating Antibacterial Effects of Silver Nanoparticles on blaTEM Gene Expression in Escherichia Coli Strain Resistant to Beta-Lactam Antibiotic

نویسندگان [English]

  • Valid Albadiri 1
  • Farahnaz Molavi 2
  • Maryam Tehranipoor 3

1 Department of Biology, Faculty of Basic Sciences, Islamic Azad University, Mashhad Branch, Mashhad, Iran,

2 Department of Biology, Faculty of Basic Sciences, Islamic Azad University, Mashhad Branch, Mashhad, Iran

3 Department of Biology, Faculty of Basic Sciences, Islamic Azad University, Mashhad Branch, Mashhad, Iran

چکیده [English]

Introduction: So far, studies have shown that an important reason for Escherichia coli resistance to beta-lactam antibiotics is the presence of broad-spectrum beta-lactamases (ESBLs) which are the product of SHV and TEM gene expression. Some studies also show that the use of nanoparticles can be effective in eliminating bacterial resistance. Therefore, the present study aimed to investigate the effects of silver nanoparticles on the expression of the blaTEM beta-lactamase resistance gene and determin the pattern of antibiotic resistance in existing Escherichia coli samples.
Materials and Methods: In this cross-sectional descriptive study, 64 Escherichia coli were collected from 11 medical diagnostic laboratories. These samples were identified using standard laboratory methods and specific cultures. The PCR method was used to evaluate the frequency of the blaTEM gene. To evaluate the antibiotic susceptibility pattern of the strains, the disk diffusion method was performed based on the CLSI protocol. Silver nanoparticles were synthesized from the ginger extract and real-time PCR was used to investigate the effect of silver nanoparticles on blaTEMgene expression.
Results: From 64 Escherichia coli resistant samples, 61 samples were beta-lactamase resistant. Phenotypic evaluation of the antibiotic resistance pattern of beta-lactamase-resistant Escherichia coli strains showed that 90% was resistant to penicillin, 66% to carbonicillin, 87% to isolates to erythromycin, 85% to cefotaxime 84% to ceftriaxone, 49% to gentamicin, 37% to spirofloxacin, 22% to imipenem, and 12% to linezolid. The highest antibiotic resistance belonged to penicillin (90%) and erythromycin (87%) and the lowest to imipetmo (22%) and linezolid (12%), respectively. Molecular analysis showed the presence of the blaTEMgene in all samples. The results of the real-time method showed that the effect of silver nanoparticles on blaTEMgene expression was significant.
Discussion and Conclusion: The presence of 61 resistant samples out of 64 samples in the present study indicates an increase in the resistance of Escherichia coli to various antibiotics, which could be a serious concern for the treatment of infections caused by Escherichia coli. The effectiveness of silver nanoparticles on blaTEMgene expression suggests that it could be a good alternative to existing antibiotics.

کلیدواژه‌ها [English]

  • E. coli
  • Antibiotic resistance
  • Beta-lactamase
  • blaTEM
  • Silver Nanoparticles

مقدمه

اشرشیا کلی[1] یک باسیل گرم منفی از خانوادة انتروباکتریاسه است که به‌طور عمده در رودة جانوران خونگرم زندگی می‌کند (1). بیشتر گونه‌های این جنس بی‌خطر و هم‌زیست‌اند؛ اما گاهی گونه‌هایی از آنها وجود دارند که باعث مسمومیت می‌شوند (2). گونة اشرشیا کلی به‌دلیل اینکه عامل شایع ایجاد عفونت مجاری ادراری[2] است، از لحاظ پزشکی مهم‌ترین گونة این جنس است. یکی از روش‌های رایج باکتری‌ها برای مقابله با آنتی‌بیوتیک‌ها تولید آنزیم‌های بتالاکتاماز است. آنزیم‌های بتالاکتاماز که با ژن‌های پلاسمیدی، ترانسپوزونی و کروموزوم‌های باکتریایی کد می‌شوند یکی از مکانیسم‌های عمومی مقاومت باکتری‌ها به آنتی‌بیوتیک‌های بتالاکتام‌اند و این مسئله موجب مقاومت این میکروارگانیسم‌ها در برابر آنتی‌بیوتیک‌های بتالاکتام می‌شود (3). وقوع عفونت مجاری ادراری ناشی از سویه‌های اشرشیا کلی دارای بتالاکتام، درحال افزایش است. با توجه به افزایش روزافزون انواع مختلف بتالاکتامازهای وسیع‌الطیف ESBL، به‌ویژه blaTEM و تأثیر متفاوت آنها بر آنتی‌بیوتیک‌های مختلف، تعیین دقیق تیپ‌های مختلف آنزیم‌های ESBL با روش‌های مولکولی مانند PCR ازنظر شناخت مقاومت‌های منطقه‌ای بسیار مهم است (4). ژن کدکنندة این آنزیم‌ها ازطریق مکانیسم‌های ترانسفورمیشن و ترانسپوزیشن به باکتری‌های دیگر منتقل می‌شوند و میکروارگانیسم‌هایی که حامل این ژن‌اند افزایش چشمگیری در میزان مقاومت به آنتی‌بیوتیک‌ها را کسب می‌کنند (5). بین انواع باکتری‌ها، باکتری‌هایی مانند اشرشیا کلی و سودوموناس آئروژینوزوا پتانسیل ذاتی برای تخریب حلقة بتالاکتام داروها دارند (6). درواقع ژن بتالاکتامTEM  یکی از مهم‌ترین ژن‌های بتالاکتام پلاسمیدی در باکتری‌های خانوادة انتروباکتریاسه است که عامل بیش از 90 درصد مقاومت سویه‌های اشرشیا کلی به داروهای بتالاکتام است و از عوامل مهم ایجاد مقاومت‌های چندگانة دارویی در عفونت‌های بیمارستانی است. براساس برخی تحقیقات، مقاومت باکتریایی در برابر بعضی آنتی‌بیوتیک‌ها مانند سفالوسپورین‌ها و کوتریموکسازول‌ها درحال افزایش است (6)؛ بنابراین، معرفی و به‌کارگیری روش‌های جدید و روش‌های جایگزین با آنتی‌بیوتیک‌ها در درمان عفونت‌های باکتریایی لازم و ضروری است.

وقتی اندازة ذرات در مواد مختلف در محدودة نانو باشد، آنگاه خواصی که این مواد از خود نشان می‌دهند با خواص آنها در حالت توده‌ای یکسان نیست و خواص بسیار جالب، مطلوب و مفیدتری برای کاربردهای مختلف نشان می‌دهند. محققین مختلف، خاصیت ضدباکتریایی نانوذرات فلزی را بیان کرده‌اند. نانوذرات می‌توانند بدون اثرات آنتی‌بیوتیکی به باکتری‌های مقاوم نفوذ کنند و با تأثیر بر پروتئین‌ها یا اسیدهای نوکلئیک مقاومت آنها را درهم بشکنند. این نتیجه بارها در مطالعات مختلف در خصوص کنترل مقاومت باکتری‌ها نشان ‌داده شده است (7،8،9،10)؛ بنابراین، مطالعة حاضر با هدف بررسی تأثیر نانوذرة نقره برای کنترل عفونت ناشی از باکتری مقاوم‌شدة اشرشیا کلی صورت گرفته است.

مواد و روش‌ها

این مطالعه به‌صورت توصیفی - مقطعی[3] و در یک بازة زمانی 9 ماهه (آبان ماه 1398 تا مرداد ماه 1399) انجام شد و تعداد 64 سویة اشرشیا کلی از 11 آزمایشگاه تشخیص طبی سطح شهر مشهد جمع‌آوری شدند. پس از انتقال سویه‌ها به آزمایشگاه تحقیقات گروه زیست‌شناسی واحد مشهد، برای تأیید شناسایی سویه‌هایی که قبلاً توسط آزمایشگاه‌های تشخیص طبی بررسی شده بودند، از روش‌های استاندارد باکتری‌شناسی مربوط به خانوادة انتروباکتریاسه همانند رنگ‌آمیزی گرم، آزمایش اکسیداز، کشت روی محیط‌های آزمایشگاهی تریپل شوگر آیرون آگار (TSI)، سیمون سیترات آگار،MR/VP  براث (محیط حاوی گلوکز و فسفات استفاده شد و با توجه به نوع باکتری یکی از دو واکنش تخمیر اسیدی مخلوط و تخمیر بوتیلن گلیکول در آن صورت می‌گیرد) و ائوزین متیلن بلو آگار (یک محیط افتراقی برای باکتری‌های گرم منفی و به‌خصوص اشرشیا کلی) استفاده شد. همچنین، محیط کشت SIM آگار به‌منظور بررسی حرکت باکتری، تولید ایندول و تولید سولفید هیدروژن استفاده ‌شد (11). محیط مولر هینتون براث و محیط مولر هینتون آگار برای تست آنتی‌بیوگرام استفاده ‌شدند. از محیط پایة تریپتون سویا براث[4] برای فریزکردن استفاده شد.

تعیین حساسیت آنتی‌بیوتیکی: به‌منظور بررسی مقاومت به بتالاکتام و الگوی حساسیت آنتی‌بیوتیکی از محیط مولر هینتون آگار و روش انتشار دیسک در آگار استفاده شد (12). دیسک‌های آنتی‌بیوتیک استفاده‌شده در این مطالعه شامل کربنی‌سیلین µg 100، پنی‌سیلینµg 25، آمپی‌سیلین µg 10، افلوکساسین µg 5، استرپتومایسین µg 10، تتراسایکلین µg 30، کلرامفنیکل µg 30، نیتروفورانتوئین µg 300، نورفلوکسازین µg 10 و سیپروفلوکساسین µg 5 بود. این مرحله براساس دستورالعمل استاندارد آزمایشگاه (13) انجام شد. سویه‌های استاندارد این باکتری (اشرشیا کلی PTCC 1399) به‌صورت لیوفیلیزه تهیه شدند. برای این منظور، از باکتری‌های رشدکردة سوسپانسیونی معادل 5/0 مک فارلند تهیه و روی محیط مولر هینتون آگار به‌صورت کشت سفره‌ای کشت داده شد. پلیت‌ها به مدت 10 تا 15 دقیقه در دمای اتاق قرار گرفتند. پس از آن دیسک‌های آنتی‌بیوتیک با پنس استریل در سطح محیط قرار گرفتند؛ به‌طوری‌که فاصلة دیسک‌ها از لبة پلیت 5/1 سانتیمتر و نسبت به هم 5/2 سانتی‌متر بود. سپس پلیت 18 تا 24 ساعت در انکوباتور با دمای 37 درجة سانتی‌گراد قرار گرفت. بعد از این مدت اطراف دیسک‌ها از لحاظ هالة عدم رشد بررسی شدند و قطر ناحیة اطراف دیسک با خط‌کش مخصوص[5] اندازه‌گیری و با مراجعه به جداول کمیتة ملی معیارهای آزمایشگاهی بالینی[6] حساسیت یا مقاومت باکتری به آنتی‌بیوتیک‌ها تعیین شد؛ درنهایت، پس از 24 ساعت انکوبه‌کردن در دمای 37 درجة سانتی‌گراد، حداقل غلظت بازدارندگی رشد[7] باکتری تعیین شد.

به‌منظور بررسی سنجش حساسیت باکتری‌ها در برابر نانوذرة نقره از سه روش انتشار چاهک در آگار، انتشار دیسک در آگار و روش ماکرودایلوشن (روش سری رقت در لوله) استفاده شد. برای تهیة سری رقت از نانوذرات از روش رقت‌سازی سریال از نانوذرة نقره، سری رقت‌های 30، 60، 120، 240،480 و 960 ppm تهیه شد.

ساخت نانوذرة نقره: 5 گرم پودر زنجبیل در 50 سی سی آب مقطر، حل (در این روش برای هر گرم پودر گیاه 10 سی سی آب مقطر استریل اضافه می‌شود) و به مدت 15 دقیقه جوشانده شد. سپس محلول به‌دست‌آمده به ویال 50 میلی‌لیتری منتقل و 12 دقیقه با دور 4000 سانتریفیوژ شد. محلول فوقانی به‌دست‌آمده از سانتریفیوژ به یک پلیت، منتقل و در مجاورت شعله فیلتر شد. 10 میلی‌لیتر از عصارة فیلترشدة زنجبیل به ویال 50 میلی‌لیتری، منتقل و با 10 میکرولیتر از محلول نیترات نقره 1 میلی‌مولار مخلوط شد. بعد از تغییر رنگ، محلول در میکروتیوپ‌های 2 میلی‌لیتری با دور 14000 به مدت 10 دقیقه سانتریفیوژ شدند. پس از سانتریفیوژ، محلول رویی دور ریخته شد و 2 میلی‌لیتر آب دیونیزه یا آب مقطر به رسوب به‌دست‌آمده اضافه و مجدد سانتریفیوژ شد. بعد 3 بار تکرار این مرحله، رسوب انتهایی در پلیت‌های جداگانه ریخته شد و در محل تاریک قرار گرفت تا خشک و پودر نانوذره آماده شود. برای بررسی خصوصیت فیزیکی نانوذره به‌دست‌آمده از روش‌های عکسبرداری میکروسکوپ الکترونی عبوری (دانشگاه فردوسی مشهد)، FTIR (دانشگاه آزاد واحد مشهد) و دستگاه طیف‌سنج پراش پرتو ایکس XRD (دانشگاه فردوسی مشهد) استفاده شد.

استخراج RNA: استخراج RNA بعد از تیماردهی سوسپانسیون باکتری دارای ژن blaTEM با نانوذرات نقره با رقت ppm 240 (حداقل غلظت بازدارندگی رشد) انجام شد. استخراج RNA با استفاده از کیت مخصوص (5292) شرکت پارس طوس زیست‌فناور، انجام و پس از آن غلظت و جذب نوری تمامی RNAهای استخراج‌شده با کمک نانودراپ (Nanodrop Bio Tek Epoch, USA) اندازه‌گیری شد.

ساخت cDNA: پس از تعیین مقدار و غلظت RNA ساخته‌شده، برای ساخت cDNA از RNA استخراج‌شده از کیت مخصوص (A101161) شرکت پارس طوس زیست‌فناور استفاده شد.

PCR ژن blaTEM: پس از طراحی پرایمرها، واکنش PCRبه حجم نهایی 25 میکرولیتر شامل 5/5 میکرولیتر PCR master mix 5X (ایران، سیناکلون) دارای U/µl 05/0 Taq DNA polymerase،  mM MgCl23، mM 4 /0 از dNTPs، 1 میکرولیتر از هر پرایمر با غلظت 8/0 میکروموالر، 1 میکرولیتر از DNA الگو (10 نانوگرم) و 5/10 میکرولیتر آب دوبار تقطیر استریل با استفاده از گرادیانت ترموسایکلر (اپندورف، آلمان) و با برنامة دمایی، دناتوراسیون اولیه 94 درجة سانتی‌گراد به مدت 15 دقیقه برای 34 سیکل در شرایط واسرشته‌شدن[8] 94 درجة سانتی‌گراد 30 ثانیه، اتصال پرایمر[9] 58 درجة سانتی‌گراد برای 30 ثانیه، طویل‌شدن[10] 72 درجة سانتی‌گراد برای 30 ثانیه و یک بسط نهایی 72 درجة سانتی‌گراد برای 10 دقیقه انجام شد (12). میزان تغییر بیان ژن با استفاده از نرم‌افزار SPSS16 و آزمون One way ANOVA تجزیه و تحلیل شد؛ در تمام موارد سطح معنی‌داری 05/0p< در نظر گرفته شد.

 

جدول 1- توالی الیگونوکلئوتیدی پرایمرهای طراحی و استفاده شده در تکثیر ژن blaTEM در اشرشیا کلی

Tm (درجة سانتی‌گراد)

توالی نوکلئوتیدی پرایمرهای استفاده‌شده

ژن

61

Forward:5' ACCAGATTCTCCGCCTCTGA 3

Reverse:5' GGTGGAGCTGACTTCATCCG 3

blaTEM

59

F:CCCAACCCTTTTCCTTACTTGC

R:CATCAACTTCACCTTCACGC

16S RNA

 

 

سنجش بیان ژن با تکنیک :Real-Time PCR واکنش زنجیره‌ای پلیمراز در حجم 20 میکرولیتر با استفاده از کیت (Genet bio CAT. NO: Q9210) کره جنوبی[11] به‌صورت زیر انجام شد؛ 10 میکرولیتر از Prime Qmaster mix (2x) with syber green، 5 میکرولیتر از Depc water، 1 میکرولیتر از هر پرایمر، 1 میکرولیتر از Rox dye و 2 میکرولیتر از cDNA استفاده شد. تکثیر قطعه‌ای مدنظر در دستگاه Applied Biosystems StepOnePlus با برنامة واسرشت اولیه 94 درجة سانتی‌گراد برای 15 دقیقه، تکثیر شامل واسرشت در 94 درجة سانتی‌گراد برای 30 ثانیه، اتصال در 58 درجة سانتی‌گراد برای مدت 30 ثانیه و گسترش در 72 درجة سانتی‌گراد برای 30 ثانیه در 35 چرخه انجام شد. برای محاسبة میزان بیان نسبی ژن، آنالیز داده‌ها و رسم نمودارهای مربوطه از LightCycler Relative Quantification Software استفاده شد. داده‌های مربوط به تعییر بیان ژن blaTEM با روش 2ΔΔCT با فرض کارآیی 100 درصد و با استفاده از آزمون آماری T مستقل در دو گروه آنالیز شد (14).

آشکارسازی محصولاتPCRبا روش الکتروفورز ژل آگارز

روش انجام الکتروفورز روی ژل آگارز:برای بررسی نتیجة آزمایشات مختلف، ازجمله استخراج DNA و PCR از الکتروفورز روی ژل آگارز 1 درصد استفاده شد. به این منظور، محصول روی ژل آگارز 1 درصد و در بافر TBE به مدت 60 دقیقه در ولتاژ 100 الکتروفورز شد (14). نتایج توسط دستگاه Geldocument با نور UV مشاهده شد.

نتایج

بررسی مورفولوژی کلنی در محیط ائوزین متیلن بلو آگار:تمامی سویه‌هایی که در آزمایشگاه‌های تشخیص طبی، به‌عنوان اشرشیا کلی شناسایی شده بودند به آزمایشگاه تحقیقاتی میکروب‌شناسی انتقال داده شدند و با روش‌های رایج آزمایشگاهی شناسایی سویه‌ها تأیید شد.

نتایج تست حساسیت آنتی‌بیوتیکی:ارزیابی فنوتیپی الگوی مقاومت آنتی‌بیوتیکی سویه‌های اشرشیا کلی مقاوم به بتالاکتام نشان داد 90 درصد به پنی‌سیلین، 66 درصد به کربنی‌سیلین، 87 درصد سویه‌ها به اریترومایسین، 85 درصد به سفوتاکسیم، 84 درصد به سفتریاکسون، 49 درصد به جنتامایسین، 37 درصد به سپیروفلوکساسین، 22 درصد به ایمی‌پنم و 12 درصد به لینزولید مقاومت داشتند؛ یعنی بیشترین میزان مقاومت آنتی‌بیوتیکی به‌ترتیب متعلق به پنی‌سیلین 90 درصد، اریترومایسین 87 درصد و کمترین نسبت به ایمی‌پنم 22 درصد و لینزولید 12 درصد بود. همچنین، 90 درصد سویه‌ها به بیش از یک آنتی‌بیوتیک مقاومت نشان دادند که این نشان‌دهندة مقاومت چنددارویی در این سویه‌ها است.

در این مطالعه، تمامی سویه‌های مقاوم دارای ژن blaTEM بودند. شکل 1 نتیجة محصول PCR ژن blaTEM بعد از انجام الکتروفورز است. وجود باند 800 جفت‌بازی نشان‌دهندة مثبت‌بودن ازنظر وجود ژن blaTEM است.

بررسی خواص ضدباکتریایی نانوذرات نقره: فعالیت ضدمیکروبی نانوذرة نقرة تولیدشده از عصارة زنجبیل با مشاهده و اندازه‌گیری هالة عدم رشد باکتری در اطراف دیسک‌های حاوی محلول نانوذرات نقره برای تمامی سویه‌های آزمایش مشاهده شد (اندازة هاله 4±9 میلی‌متر بود)؛ بنابراین، محلول حاوی نانوذرات نقره، فعالیت ضدمیکروبی علیه باکتری‌های آزمایش داشت و هالة قابل تشخیص که حاصل جلوگیری از رشد میکروب توسط نانوذرات نقره است، در تمام تیمارهای اصلی در مقایسه با نمونه‌های شاهد (عصاره، آب مقطر و نیترات نقره) مشاهده شد. 

شکل 1- نتایج الکتروفورز حاصل تکثیر ژن blaTEM (از راست به چپ: مارکر 100 جفت‌بازی، 3 سویة حاوی ژن blaTEM، کنترل مثبت و کنترل منفی. طول قطعة مدنظر 800 جفت‌باز است)

 

براساس روش ماکرودایلوشن و بررسی اثر نانوذرة نقره بر باکتری، میزان MIC ppm 240 و MBC ppm 480 تعیین شد.

بررسی ریخت‌شناسی نانوذرة نقره سنتزشده: بررسی نانوذرة نقره با میکروسکوپ الکترونی عبوری نشان داد نانوذرات تولیدی اکثراً شکل مکعبی با اندازة 39/22 تا 35/93 نانومتر و تعداد بسیار کمی به‌صورت مثلثی و میله‌ای‌اند (شکل 2).

مطالعة XRD: براساس شکل 3 الگوی پراش اشعة ایکس (xrd)، اندیس‌های میلر در سطوح 111، 200، 202 و 311 بوده و به‌ترتیب مربوط به زاویه‌های °5/37، °3/44، °9/64 و °8/78 بوده است که وجود نانوکریستال‌های نقره را ثابت می‌کند. همچنین نتایج نشان داد بیشتر نانوذرات شکل مکعبی داشتند و 4 پیک جذبی در زاویة بین پرتو تابش و بازتابش، 38، 44، 65 و 77 درجه در آنها تشخیص داده شد (شکل 3).

 

 

شکل 2- تصویر میکروسکوپ الکترونی گذاره از نانوذرات نقرة ساخته‌شده (پیکان‌ها اشاره به نانوذراتی می‌کنند که جدا قرار گرفته‌اند و با نانوذرات دیگر همپوشانی ندارند)

 

بیان ژن blaTEM بعد از تیمار با مهارکنندة نانوذرة نقره: برای مقایسة اثر نانوذرة نقره بر بیان ژن blaTEM، بعد از استخراج RNA و سنتز cDNA بیان ژن به‌صورت کمی با استفاده از روش Real Time PCR بررسی شد. نتایج این روش نشان داد سویه‌های مختلف تحت‌تأثیر نانوذرات نقره تغییر بیان متفاوتی را داشتند و ازنظر آماری کاهش معناداری در مقایسه با بیان ژن در نمونة کنترل را نشان دادند (05/0P<) (شکل 1).

 

شکل 3- الگوی پراش اشعة ایکس بر نانوذرة نقره ساخته‌شده در پژوهش. محور افقی نشان‌دهندة زاویة بین پرتو تابش و بازتابش و محور عمودی نشان‌دهندة شدت پرتوی ایکس بازتابیده است.

  

شکل 4- مقایسة میزان بیان ژن blaTEM در 6 سویة تیمارشده با نانوذرات نقره در مقایسه با نمونه کنترل (سوسپانسیون فاقد نانوذرات). *** نشان‌دهندة سطح معنی‌داری است (05/0P<)

 

بحث و نتیجه‌گیری

عفونت‌های مجاری ادراری (Urinary tract infections) دومین عفونت شایع انسانی است که توسط خانوادة انتروباکتریاسه و به‌خصوص اشریشیا کلی به وجود می‌‌آید. افزایش مقاومت‌های آنتی‌بیوتیکی سویه‌‌های اشرشیا کلی و بررسی تغییرات الگوی مقاومت آنتی‌بیوتیکی سویه‌‌های اشرشیا کلی جداشده از عفونت‌های ادراری بیماران در طی سال‌های گذشته درخور توجه خاص بوده است (14).

گزارش مقاومت آنتی‌بیوتیکی اشرشیا کلی و مطالعة تغییرات الگوهای این مقاومت در ایران نیز درخور توجه بوده است. معینی و امینی در سال 1395 نشان دادند وجود مقاومت آنتی‌بیوتیکی نسبت به اشریشیا کلی در کودکان مبتلا به اسهال بسیار بالا است و جامعه شاهد سویه‌های مقاوم این باکتری‌ها است (15). همچنین در سال 1390 مهاجری و همکاران مقاومت 77 درصدی باکتری اشرشیا کلی را برای آمپی‌سیلین گزارش کردند (16) و میرصالحیان و همکاران مقاومت 5/98 درصدی را بین این نمونه‌ها مشاهده کرده بودند (17). این گزارشات مشابه گزارشاتی‌اند که در این خصوص در کشورهای دیگر نیز ارائه شده است (18)؛ برای مثال، سال 2011 در پژوهش لی و همکاران، مقاومت 60 درصدی نسبت به آمپی‌سیلین مشاهده شد (19) یا مطالعه‌ای در همین سال مربوط به کشور یونان نشان‌دهندة مقاومت 50 درصدی نسبت به آمپی‌سیلین است (20). این روند افزایشی مقاومت در سایر آنتی‌بیوتیک‌ها نیز مشاهده شده است. در مطالعة مانتاداکیس در سال 2005 مقاومت اشرشیا کلی نسبت به سفوتاکسیم 7/3 درصد بود (21). در مطالعة سال 2011 کیفر و همکاران در برزیل، نرخ سویه‌های مقاوم اشرشیا کلی به سفوتاکسیم 6/14 درصد گزارش شده است (22). در این مطالعه فراوانی مقاومت سویه‌های اشرشیا کلی نسبت به سفوتاکسیم 84 درصد بود که نسبت به نتایج سال 2011 مهاجری و همکارانش که 27 درصد را مشاهده کرده بودند (16)، افزایش چشمگیر نشان می‌دهد و این تفاوت گویای افزایش مقاومت به سفالوسپورین‌های وسیع‌الطیف طی سال‌های اخیر است و می‌تواند به‌عنوان یک هشدار در درمان عفونت‌های ناشی از این باکتری باشد (23). مقاومت به سیپروفلوکساسین در این مطالعه در 22 درصد سویه‌ها مشاهده شد. همچنین در این پژوهش، مقاومت به آنتی‌بیوتیک ایمی‌پنم نسبت به سایر آنتی‌بیوتیک‌ها بسیار کم بوده است. حساسیت نسبت به ایمی‌پنم در سایر مطالعات انجام‌شده در ایران و سایر نقاط جهان نیز گزارش شده است (21). لازم به توضیح است اختلافات مشاهده‌شده در نتایج تحقیقات مختلف می‌تواند مربوط به تفاوت در الگوی مصرف آنتی‌بیوتیک، منطقة جغرافیایی، تفاوت در الگوی مقاومت در مناطق مختلف، روش‌های مختلف آنتی‌بیوگرام و مصرف بی‌رویة آنتی‌بیوتیک در کشور‌ها است (24).

مکانیسم‌های عامل مقاومت باکتریایی در برابر آنتی‌بیوتیک‌ها متفاوت بوده و یکی از مهم‌ترین آنها تولید آنزیم‌های بتالاکتاماز توسط باکتری‌هاست که عامل مقاومت در برابر آنتی‌بیوتیک‌های بتالاکتام است. این آنزیم‌ها ازطریق هیدرولیز هستة مرکزی آنتی‌بیوتیک‌های بتالاکتام باعث از بین رفتن اثرات آنها و غیرفعال‌شدن آنها می‌شوند. متالوبتالاکتامازها، ازجمله آنزیم‌های بتالاکتامازی‌اند که توسط برخی باکتری‌های مقاوم، ترشح و باعث مقاومت به بیشتر آنتی‌بیوتیک‌های بتالاکتام می‌شوند. این آنزیم‌ها به‌طور وسیعی در میان باکتری‌ها توزیع شده‌اند و نقش اصلی را در مقاومت ذاتی و اکتسابی باکتری‌ها ایفا می‌کنند. متالوبتالاکتامازها طیف سوبسترایی وسیعی دارند و قادر به هیدرولیز تمام بتالاکتام‌ها به‌جز منوباکتام‌ها هستند. این آنزیم‌ها داخل اینتگرون قرار گرفته‌اند و می‌توانند در پلاسمید یا کروموزوم ادغام شوند؛ بنابراین، قابلیت انتقال در انتروباکتریاسه‌ها را دارند (25). حدادی و فلاح در سال 1396 بیان کردند بتالاکتامازهای وسیع‌الطیف، گروهی از آنزیم‌ها با توانایی هیدرولیز سفالوسپورین‌ها و آزترونام‌اند و انواع مختلفی از بتالاکتامازهای وسیع‌الطیف (ESBLs) از قبیل blaTEM و  blaSHVبه‌طور گسترده در سویه‌های اشریشیا کلی حضور دارند. آنها میزان بالای مقاومت سویه‌های واجد ژن‌های blaTEM و blaSHV به سفالوسپورین‌های نسل سوم را گزارش کردند که تولیدکنندة بتالاکتامازهای وسیع‌الطیف‌اند (26). شعبانی لکرانی و همکاران در سال 1393 میزان فراوانی ژن‌هایblaTEM، blaSHV و blaCTX-M مولد بتالاکتامازهای وسیع‌الطیف در ایزوله‌های اشرشیا کلی جمع‌آوری‌شده از آب‌های زیرزمینی استان آذربایجان شرقی را بررسی کردند. نتایج فنوتیپی حاصل از این مطالعه نشان داد تنها 2 (9 درصد) ایزوله دارای مقاومت از نوع ESBL بودند؛ درحالی‌که در بررسی ژنوتیپی تعداد 9 ایزوله (39 درصد) دارای ژن blaTEM، 10 ایزوله (43 درصد) حاوی ژن blaSHV و 14 ایزوله (61 درصد) حاوی ژن blaCTX-M در ژنوم خود بودند. نتایج حاصل از این مطالعه درصد بالای مقاومت بتالاکتامازی را بین سویه‌های اشرشیاکلی جداشده از منابع آبی زیرزمینی نشان می‌دهد (27). حدادی و یکه فلاح در سال 1396 فراوانی ژن‌های blaSHV و blaTEM در سویه‌های اشریشیاکلی مولد بتالاکتامازهای وسیع‌الطیف جمع‌آوری‌شده از شهر کرج را بررسی کردند. نتایج آنها نشان داد 8/42 درصد ایزوله‌ها مولد بتالاکتامازهای وسیع‌الطیف بودند که از این تعداد 78/60 درصد و 21/39 درصد به‌ترتیب دارای ژن‌های blaTEM وblaSHV و 32/9 درصد دارای هر دو ژن بودند و گفتند میزان بالای مقاومت سویه‌های واجد ژن‌های blaTEM وblaSHV اشریشیاکلی‌های تولیدکنندة بتالاکتامازهای وسیع‌الطیف باید محدود شود (26). نتایج این تحقیق نشان می‌دهد تقریباً تمام باکتری‌های مورد مطالعه، ژن blaTEM و مقاومت به چند آنتی‌بیوتیک را دارند؛ این نتیجه باعث نگرانی دربارة کنترل عفونت ناشی از این باکتری می‌شود که قبلاً نیز گزارش شده بود (28). در مطالعة حاضر، 90 درصد سویه‌ها به بیش از دو آنتی‌بیوتیک مقاومت نشان دادند. آمار شیوع اشرشیا کلی مولدESBL در ایران متفاوت بوده و بیشترین آمار (68 درصد) از کرمان گزارش شده است (29). نتیجة مطالعات جمیل و همکارانش نشان‌دهندة شیوع 33 درصدی ESBL در باکتری‌های اشرشیا کلی در افراد مبتلا به عفونت مجاری ادراری است (30). مشابه این نتایج در کشورهای دیگر نیز گزارش شده است. در مطالعة ملزر و همکاران 8/60 درصد باکتریمی‌های منجر به مرگ، ناشی از اشرشیا کلی تولیدکنندة ESBL بوده است (31). در تحقیقات متعددی، فراوانی‌‌هایی مانند 6/60، 21 و 3/44 درصد شیوع ESBL نیز گزارش شده است (32). بالی و همکاران در ترکیه فراوانی ESBL در ایزوله‌های اشرشیا کلی را 14/69 درصد گزارش کردند (33). فراوانی ESBL در جوامع مختلف متفاوت است. در برخی از آنها میزان آن کمتر از نتایج این مطالعه است (34). نتایج برخی تحقیقات نشان داده است سویه‌های دارای ESBL درحال افزایش‌اند (35). در مطالعة حسینی مزینانی و همکاران  و استانگ و همکارانش به‌ترتیب 60 درصد و 67 درصد سویه‌های اشرشیا کلی حاوی ژن blaTEM بودند (36) و ژن blaCTX-M در 55 درصد سویه‌ها وجود داشته است (37) که با نتایج کالبو و همکارانش در اسپانیا مطابقت دارد (38). در مطالعة بالی و همکاران میزان رونویسی این ژن در میان سویه‌های اشرشیا کلی کمی بیشتر بوده است (72 درصد) (39). در مطالعة حاضر تمام سویه‌ها دارای ژن blaTEM بودند؛ بنابراین با توجه به نتایج، مقاومت به سفالوسپورین‌های وسیع‌الطیف و دیگر آنتی‌بیوتیک‌های مورد مطالعه بالاست. علاوه بر این، میزان شیوع ESBL و ژن TEM نیز آمار بالایی دارد. پیامد این مسئله، طولانی‌شدن دورة بیماری و مدت بستری، افزایش هزینه‌های درمانی و تجویز آنتی‌بیوتیک‌های وسیع‌الطیف است؛ بنابراین، تجویز سفالوسپورین‌ها و فلوروکینولون‌ها باید با احتیاط بیشتری صورت گیرد. با توجه به حساسیت بیشتر سویه‌های مورد مطالعه به ایمی‌پنم و ارزشمندبودن این دارو، نتیجه می‌گیریم در درمان عفونت باکتریال، با کمک متخصصین آزمایشگاه و به دنبال تعیین الگوی حساسیت دقیق، از یک بتالاکتام در ترکیب با یک بازدارندة بتالاکتاماز استفاده شود. با این روش از گسترش بتالاکتامازهای وسیع‌الطیف بین سویه‌های مختلف باکتریایی، کاسته و از گسترش عفونت‌های مقاوم و نیز روزافزون‌شدن مرگ‌ومیر در مراکز درمانی پیشگیری می‌شود. تولید ESBL تهدیدی بزرگ برای مصرف سفالوسپورین با طیف وسیع به شمار می‌رود؛ بنابراین، برای درمان عفونت‌هایی که مشکوک به ارگانیسم‌های تولیدکنندة ESBL هستند، باید آنتی‌بیوتیکی مناسب و با دقت زیاد انتخاب شود. سویه‌هایی که حساسیت آنها در برابر سفتازیدیم، سفوتاکسیم و سفتریاکسون کاهش یافته است باید ازنظر دارابودن ژن‌های ESBL بررسی شوند.

یکی از راه‌های امیدوار‌کننده برای از بین بردن مقاومت‌های باکتریایی، استفاده از نانوذرات فلزی است (40). نانوذرات به‌دلیل اندازة کوچک و سطح تماس بالایی که با محیط و میکروارگانیسم‌ها دارند می‌توانند افزایش فعالیت بیولوژیک و شیمیایی آنها را باعث شوند. همین امر موجب می‌شود اثرات ضدمیکروبی نانوذرات فلزی در مقایسه با خود فلزات بسیار بالاتر باشد. آنها می‌توانند پس از ورود به سلول باکتریایی با تداخل در عملکرد پروتئین‌های حاوی سولفور و مولکول‌های دارای فسفر، نظیر DNA کارآیی آنها را از بین ببرند (41). در سال‌های اخیر، استفاده از نانوذرات فلزی به‌عنوان ترکیبات ضدباکتری روند روبه‌رشدی داشته است. از این میان نانوذرات نقره (42)، اکسیدهای تیتانیوم (43)، روی (44،45)، مس (46) و آهن (47،48) به‌دلیل خواص ضدباکتری مناسب، بیش از سایر نانوذرات استفاده شده‌اند. غلامی شعبانی در سال 1391 نشان داد اندازة نانوذرات نقره هر چقدر کوچک‌تر باشد، اثر ضدمیکروبی آن بیشتر می‌شود. این مطالعه نشان داد خواص آنتی‌باکتریال سطوح پوشیده با کلوئید نانوذرات نقرة سنتزشده به کمک قارچ فوزاریوم اگزیسپوروم به‌دلیل کوچک‌تربودن اندازة نانوذرات نسبت به کلوئید حاصل از باکتری اشریشیا کلی مطلوب‌تر است (49). سلمانی و همکاران در سال 1396 فعالیت ضدباکتریایی نانوذرات نقره علیه دو باکتری گرم مثبت استافیلوکوکوس اورئوس و سودوموناس آئروژینوزا و دو باکتری گرم منفی اشرشیا کلی و باسیلوس سرئوس را بررسی کردند. براساس نتایج حاصل از این مطالعه باکتری‌های اشرشیا کلی کمترین حساسیت و باکتری‌های استافیلوکوکوس اورئوس بیشترین حساسیت را نسبت به نانوذرات نقره نشان دادند (50). مطالعة رشید و همکارانش در سال 1399 نشان داد نانوذرات نقره نقش مهارکننده روی بیان ژن mecA در نمونه‌های مقاوم به متی‌سیلین باکتری استافیلوکوکوس اورئوس دارند (51). مطالعة حاضر نیز اثر ضدمیکروبی نانوذرة نقره روی سویه‌های اشرشیا کلی را تأیید می‌کند؛ بنابراین، می‌توان به این گزینه فکر کرد که ممکن است نانوذرات بتوانند به‌عنوان مواد ضدمیکروبی در محیط‌های درمانی استفاده شوند. اسدی و همکارانش در سال 1392 نشان دادند متغیرهایی نوع باکتری، زمان تماس و غلظت نانوذرات ‌نقره عوامل مؤثر بر بروز خاصیت ضدمیکروبی نانوذرات نقره است و باکتری اشرشیا کلی نسبت به استافیلوکوکوس اورئوس در مقابل نانوذرات نقرة سنتزشده به روش احیای الکتروشیمیایی مقاومت بیشتری نشان داد (52). 

سپاسگزاری

این مطالعه حاصل بخشی از پایان‌نامة شماره 162263896 ولید البدیری رشید برای اخذ درجة کارشناسی ارشد در رشتة زیست‌شناسی سلولی و مولکولی از دانشکدة علوم پایه دانشگاه آزاد اسلامی واحد مشهد بود. بدینوسیله از سرکار خانم بهاره سرگزی که در تمام مراحل اجرای پایان‌نامه مشاور طرح بوده‌اند و سرکار خانم فائزه غلامی بهار، آقای علی قرایی و تمام کارشناسان محترم آزمایشگاه گروه زیست‌شناسی به‌خاطر همکاری در تمام مراحل سپاسگزاری می‌شود.



[1]- Escherichia coli

[2]- Urinary Tract Infections

[3]- sectional-Cross

[4]- TSB Tryptone Soy Broth

[5]- Antiobiotic Zone Scale ruler

[6]- Clinical and Laboratory Standards Institute (CLSI)

[7]- Minimum Inhibitory of Concentration: MIC

[8]- Denaturation

[9]- Annealing

[10]- Extension

[11]- Genet bio CAT. NO: Q9210

(1) Salyers AA, Whitt DD. Bacterial pathogenesis. A molecular approach. 2nd ed. Washington, DC: ASM Press; 2002.
(2) Welinder-Olssoni C, Kaijser B. Enterohemorrhagic Escherichia coli (EHEC). Scandinavian journal of infectious diseases. 2005; 37 (6-7): 405-16.
(3) Ganguly NK, Arora NK, Chandy SJ, Fairoze MN, Gill JP, Gupta U, et al. Rationalizing antibiotic use to limit antibiotic resistance in India. Indian J Med Res. 2011; 134 (3): 281-94.
(4) Grozdanov L, Raasch C, Schulze J, Sonnenborn U, Gottschalk G, Hacker J, et al. Analysis of the genome structure of the nonpathogenic probiotic Escherichia coli strain Nissle 1917. J. Bacteriol. 2004; 186 (16): 5432-41.
(5) Angulo P, Lindor K. Non-alcoholic fatty liver disease. J Gastroenterol Hepatol Clin. 2002; 17 (3): 186-190.
(6) Duran N, Marcato PD, Alves OL, Desouza GIH, Esposito E. Machanistic aspects of biosynthesis f silver nanoparticles by several Fusarium oxysporum strains. J Nanobiotechnol 2005; 3: 1-7. doi: 10.1186/1477-3155-3-8
(7) Ibanez J, Litter MI, Pizarro RA. Photocatalytic bactericidal of Tio 2 on Enterobacter cloacae comparative study with other gram negative bacteria. J Photochem Photobiol. 2003; 157 (2): 81-05.
(8) Lara HH, Ayalanunez NV, Ixtepanturrent C, Rodriguez C. Bactericidal effect of silver nanoparticles gainst multidrug resistant bacteria. World J Microbiol Biotechnol. 2010; 26 (1): 615-21.
(9) Andrade SS, Sader HS, Jones RN, Pereira AS, Pignatari ACC, Gales, AC. Increased resistance to first-line agents among bacterial pathogens isolated from urinary tract infections in Latin America: time for local guidelines ?. Memórias do Instituto Oswaldo Cruz. 2006; 101 (7): 741-748.
(10) Balasubramanian S, Kuppuswamy D, Padmanabhan S, Chandramohan V, Amperayani S. Extended-spectrum beta-lactamase-producing community-acquired urinary tract infections in children: Chart review of risk factors. Journal of Global Infectious Diseases. 2018; 10 (4): 222-225.
(11) Nimmo GR, Coombs GW, Pearson JC, O Brien FG, Christianser K, Turnidge JD, et al. Methicillin-resistant Staphylococcus aureus in the Australian community: an evolving epidemic. Medical journal of Australia. 2006; 184 (8): 384-399.
(12) Wayne PA. Clinical and laboratory standards institute. Performance standards for antimicrobial susceptibilitytesting. 2011.
(13) Clinical and Laboratory Standards Institute. Performance standards for antimicrobial disk susceptibility tests, 13th edition. Availableat: https://clsi.org/standards/products/microbiology/documents/m02/. 2014.
 
(14) Nourbakhsh F, Nourbakhsh H. Detection of antibiotic resistance patterns in Staphylococcus aureus strains isolated from patients admitted to Isfahan hospitals during 2014-2015. KAUMS Journal (FEYZ). 2015; 19 (4): 356-63.
(15) Moeeni S, Amini K. Evaluation of ESBL genes of blaTEM, blaSHV, blaoxa and aminoglycoside gene of aadA in Escherichia coli strains isolated in Tehran and determination of antimicrobial resistance. MEDICAL SCIENCES. 2016; 26 (2): 76-81.
(16) Mohajeri P, Izadi B, Rezaei M, Fallahi B Khademi, H. Ebrahimi R. Investigation of broad-spectrum beta-lactamase production in Escherichia coli isolated from urinary tract infections and the pattern of antibiotic resistance in Kermanshah. Journal of Ardabil University of Medical Sciences. 2011; 1 (11): 86-94.
(17) Mirsalehian A, Akbari-Nakhjavani A, Peymani A, Kazemi B, JabalAmeli F, Mirafshar SM. Prevalence of extended spectrum B-lactamase-producing enterobacteriaceae by phenotypic and Genotypic Methods in Intensive Care Units in Tehran, Iran. Daru-Journal of Pharmaceutical Science. 2008; 16 (3): 169-173.
(18) Daza R, Gutierrez J, Piedrola G. Antibiotic susceptibility of bacterial strains isolated from patients with community-acquired urinary tract infections. International journal of antimicrobial agents. 2001; 18 (3): 211-215.
(19) Lee SJ, Lee DS, Choe HS, Shim BS, Kim CS, Kim ME, Cho YH. Antimicrobial resistance in community-acquired urinary tract infections: results from the Korean Antimicrobial Resistance Monitoring System. Journal of infection and chemotherapy. 2011; 17 (3): 440-446.
(20) Mantadakis E, Tsalkidis A, Panopoulou M, Pagkalis S, Tripsianis G, Falagas M, et al. Antimicrobial susceptibility of pediatric uropathogens in Thrace, Greece. International urology and nephrology. 2011; 43 (2): 549-55.
(21) Mantadakis E, Tsalkidis A, Panopoulou, M, Pagkalis, S, Tripsianis, G, Falagas, M. Chatzimichael, A. 2011. Antimicrobial susceptibility of pediatric uropathogens in Thrace, Greece. International urology and nephrology, 43(2): 549-55.
(22) Kiffer C, Hsiung A, Oplustil C, Sampaio J, Sakagami E, Turner P, et al. Antimicrobial susceptibility of Gram-negative bacteria in Brazilian hospitals: the MYSTIC Program Brazil 2003. Brazilian Journal of Infectious Diseases. 2005; 9 (3): 216-224.
(23) Mirsalehian A, Akbari-Nakhjavani A, Peymani A, Kazemi B, JabalAmeli F, Mirafshar SM. Prevalence of extended spectrum B-lactamase-producing enterobacteriaceae by phenotypic and Genotypic Methods in Intensive Care Units in Tehran, Iran. Daru-Journal of Pharmaceutical Science. 2008; 16 (3): 169-173.
(24) Guest JF, Morris, A. Community-acquired pneumonia: the annual cost to the National Health Service in the UK. European Respiratory Journal. 1997; 10 (7): 1530-1534.
(25) Van Gorkom HJ, Pulles MP, Wessels JS. Light-induced changes of absorbance and electron spin resonance in small Photosystem II particles. Biochimica et Biophysica Acta (BBA)-Bioenergetics. 1975; 408 (3): 331–339.
(26) HaddadiI A, Yekefallah F. Frequency determination of BLATEM & BLASHV in the extended-spectrum beta-lactamaz producing E. coli isolated from Karaj. Iranian journal of medical microbiology. 2017; 11 (2): 75-80.
(27) Shabani Lokarani N, Shayegh J, Sadeghi J. Frequency of BLATEM، BLASHV, and BLACTX-M genes extended-spectrum BETA-Lactamaz in E. coli isolated collected from groundwater in east Azarbaijan province in 2014. Medical journal of Tabriz university of medical science. 2018; 40 (2): 58-63.
(28) Lara HH, Ayalanunez NV, Ixtepanturrent C, Rodriguez C. Bactericidal effect of silver nanoparticles gainst multidrug resistant bacteria. World J Microbiol Biotechnol. 2010; 26 (4): 615-21.
(29) Kalantar D, Mansouri Sh. Emergence of multiple β-lactamases produced by Escherichia coli clinical isolates from hospitalized patient in Kerman, Iran. Jundishapur Journal of Microbiology. 2010; 3 (4): 137-145.
(30) Jamil J, Haroon M, Sultan A, Khan MA, Gul N. Prevalence, antibiotic sensitivity and phenotypic screening of esbl/mbl producer E. Coli strains isolated from urine; district swabi, kp, pakistan. Journal of the Pakistan medical association. 2018; 68 (11): 1704-07.
(31) Melzer M, Petersen I. Mortality following bacteraemic infection caused by extended spectrum beta-lactamase (ESBL) producing E. coli compared to non-ESBL producing E. coli. The Journal of infection. 2007; 55(3): 254-259.
(32) Mirzaee M, Owlia P, Mansouri S. Distribution of CTX-M β-lactamase Genes Among Escherichia coli Strains Isolated from Patients in Iran. Laboratory Medicine. 2009; 40 (12): 724-727.
(33) Bali EB, Acik L, Sultan N. Phenotypic and molecular characterization of SHV, TEM, CTX-M and extended-spectrum-lactamase produced by Escherichia coli, Acinobacter baumannii and Klebsiella isolates in a Turkish hospital. African Journal of Microbiology Research. 2010; 4 (8): 650-654.
(34) Saurina G, Quale JM, Manikal VM, Oydna E, Landman D. Antimicrobial resistance in Enterobacteriaceae in Brooklyn, NY: epidemiology and relation to antibiotic usage patterns. Journal of Antimicrobial Chemotherapy. 2000; 45 (6): 895-898.
(35) Qi C, Pilla V, Yu JH, Reed K. Changing prevalence of Escherichia coli with CTX-M–type extended-spectrum β-lactamases in outpatient urinary E. coli between 2003 and 2008. Diagnostic microbiology and infectious disease. 2010; 67 (1): 87-91.
(36) Stange C, Yin D, Xu T, Guo X, Schafer C, Tiehm A. Distribution of clinically relevant antibiotic resistance genes in Lake Tai, China. The Science of the total environment. 2019; 655 (10): 337-346.
(37) Kharrat M, Chebbi Y, Ben Tanfous F, Lakhal A, Ladeb S, Othmen TB, et al. Extended spectrum beta-lactamase-producing Enterobacteriaceae infections in hematopoietic stem cell transplant recipients: Epidemiology and molecular characterization. International Journal of Antimicrobial Agents. 2018; 52 (6): 886-892.
(38) Calbo E, Romani V, Xercavins M, Gomez L, Vidal CG, Quintana S, et al. Risk factors for community-onset urinary tract infections due to Escherichia coli harbouring extended-spectrum beta-lactamases. Journal of Antimicrobial Chemotherapy. 2006; 57 (4): 780-783.
(39) Bali EB, Acik L, Sultan N. Phenotypic and molecular characterization of SHV, TEM, CTX-M and extended-spectrum-lactamase produced by Escherichia coli, Acinobacter baumannii and Klebsiella isolates in a Turkish hospital. African Journal of Microbiology Research. 2010; 4 (8): 650-654.
(40) Kim J, Kuk E, Yu K, et al. Nanomedicine: Nanotechnology. Biology and Medicine. 2007; 3 (1): 95-101.
(41) Gordon O, Slenters TV, Brunetto PS, et al. Silver coordination polymers for prevention of implant infection: thiol interaction, impact on respiratory chain enzymes, and hydroxyl radical induction. Antimicrobial agents and chemotherapy. 2010; 54 (10): 4208-18.
(42) Besinis A, Peralta T, Handy RD. The antibacterial effects of silver, titanium dioxide and silica dioxide nanoparticles compared to the dental disinfectant chlorhexidine on Streptococcus mutans using a suite of bioassays. Nanotoxicology. 2014; 8 (1): 1-16.
(43) Stoyanova A, Hitkova H, Bachvarova-Nedelcheva A, et al. Freeze-drying synthesis and characterisation of Na composites of ZnO, TiO2 and ZnTiO3 semiconductor oxides. Journal of Chemical Technology and Metallurgy. 2013; 48 (1):  154-161.
(44) Akbar A, Anal AK. Prevalence and antibiogram study of Salmonella and Staphylococcus aureus in poultry meat. Asian Pac J Trop Biomed. 2014; 38 (2): 88-95.
(45) Xie Y, He Y, Irwin PL, Jin T, Shi, X. Antibacterial activity and mechanism of action of zinc oxide nanoparticles against Campylobacter jejuni. Applied and environmental microbiology. 2011; 77 (7): 2325-31.
(46) Sutradhar P, Saha M, Maiti D. Microwave synthesis of copper oxide nanoparticles using tea leaf and coffee powder extracts and its antibacterial activity. Journal of Nanostructure in Chemistry. 2014; 86 (4): 1-6.
(47) Gholami A, Mohkam M, Rasoul-amini S, Ghasemi, Y.  Industrial production of polyhydroxyal kanoates by bacteria: opportunities and challenges. Minerva Biotecnologica. 2016; 28 (1): 59-74.
(48) Ebrahiminezhad A, Davaran S, Rasoul-Amini S, Barar J, Moghadam M, Ghasemi Y. Synthesis, Characterization and Anti-Listeria monocytogenes Effect of Amino Acid Coated Magnetite Nanoparticles. Current Nanoscience. 2012; 8 (6): 868-874.
(49) Gholami-Shabani MH, Imani A, chamani M, Razzaghi-Abyaneh M, Riazi GH, Chian M, et al . Evaluation of the Antibacterial Properties of Silver Nanoparticles synthesized with Fusarium Oxysporum and Escherichia coli. NCMBJ. 2012; 2 (6): 27-33
(50) Salmani M. Survey of Silver Nanoparticles Antibacterial Activity Against Gram-Positive and Gram-negative Bacteria in Vitro. Tolooebehdasht. 2017; 16 (1): 74-84.
(51) Rashid A, Molavi F, Mahmoudzadeh H. The effect of silver nanoparticles on mecA gene expression in methicillin-resistant samples of Staphylococcus aureus. NCMBJ. 2020; 11 (41): 0.
(52) Asadi M, Khosravi-Darani K, Mortazavi A, Hajseyed Javadi N, Azadnia E, Kiani Harchegani A, et al. Antimicrobial effect of silver nanoparticles produced by chemical reduction on Staphylococcus aureus and Escheirchia coli. Iranian Journal of Nutrition Sciences & Food Technology. 2014; 8 (4): 83-92.