ارزیابی بیان ژن‌های اکسیدکنندۀ آهن و گوگرد در باکتری سولفوباسیلوس ترموسولفیدواکسیدانس تحت‌تأثیر شاخص‌های مؤثر در فرایند آبشویۀ میکروبی

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 گروه میکروبیولوژی، دانشکده علوم، واحد کرمان، دانشگاه آزاد اسلامی، کرمان ایران

2 استادیار گروه میکروبیولوژی، دانشکدۀ علوم، واحد کرمان، دانشگاه آزاد اسلامی ، کرمان، ایران

3 کارشناس ارشد امور تحقیق و توسعه، شرکت ملی صنایع مس، سرچشمه، ایران

4 کارشناس ارشد گروه ژنتیک، دانشکدۀ علوم زیستی، دانشگاه تربیت مدرس، تهران، ایران

10.22108/bjm.2020.120297.1246

چکیده

مقدمه: تأثیر آنزیم سولفات‌آدنیلیل‌ترانسفراز بر آدنوزین‌مونوفسفات سبب تولید ترکیبات سولفات و ATP می‌شود که مرحلۀ نهایی اکسیداسیون سولفیت برای کسب انرژی است. در سیستم آبشویۀ میکروبی، آنزیم 4Fe-4S فردوکسین (عضو زنجیرۀ انتقال الکترون) نقش مهمی را در اکسیداسیون آهن فرو ایفا می‌کند. تلاش به‌منظور بهینه‌کردن شرایط رشد باکتری، افزایش بیان ژن‌ها را در پی خواهد داشت که با افزایش بازده سیستم آبشویۀ میکروبی همراه می‌شود؛ بنابراین هدف پژوهش حاضر، بررسی بیان ژن‌های مربوط به این پروتئین‌ها در باکتری سولفوباسیلوس ترموسولفیدواکسیدانس همراه با اعمال تغییر در عوامل تأثیرگذار در محیط‌کشت استفاده‌شده در نظر گرفته شد.
مواد و روش‏‏ها: کشت باکتری‌ها در محیط پایۀ 9K با غلظت‌های متفاوتی از کنسانترۀ کالکوپیریتی‌، یون آهن فرو و عصارۀ مخمر انجام شد. پس‌از رشد باکتری‌ها و تخلیص آنها، استخراج RNA باکتری و ساخت cDNA انجام شد. به‌منظور بررسی میزان بیان ژن‌های یادشده، واکنش Real Time PCR انجام و تجزیه‌وتحلیل نتایج به روش ∆∆CT-2 انجام شد. نتایج با آزمون‌های توکی و دانکن و با نرم‌افزار SPSS (نسخۀ 21) در سطح p ˂0.05 بررسی شدند.
نتایج: باتوجه‌به نتایج PCR، ژن‌های مدنظر شناسایی و آغازگرها تأیید شدند. بین چهار محیط آزمایش‌شده، بیشترین درصد استخراج مس به محیط شمارۀ 2 با میزان 75/48 درصد مربوط بود که در آن، ژن 4Fe-4S فردوکسین بیشترین بیان را نسبت به دیگر محیط‌های آزمایش داشت. بیشترین بیان ژن سولفات‌آدنیلیل‌‌ترانسفراز به محیط شمارۀ 4 مربوط بود که درصد استخراج مس در آن 16/39 درصد بود.
بحث و نتیجه‏گیری: ترکیبات محیط‌کشت باکتری بیان ژن‌ها و درصد استخراج مس را تغییر دادند و مناسب‌ترین حالت محیط آزمایش برای استخراج مس در اندازه ذرات 10 میکرون، حضور 5/1 گرم‌بر‌لیتر یون آهن فرو و حضورنداشتن عصارۀ مخمر به دست آمد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Evaluating the Expression of Iron and Sulfur Oxidation Genes related to Sulfobacillus Thermosulfidooxidans Strains under the Influence of Effective Parameters in the Bioleaching Process

نویسندگان [English]

  • Koorosh Poormahmoodian 1
  • Farokh Rokhbakhsh-Zamin 2
  • Ahmad Moghooeinejad 3
  • Mohammad Hashemabadi 4
1 Department of Microbiology, Faculty of Science, Kerman Branch, Islamic Azad University, Kerman, Iran
2 Head of the Department - Department of Microbiology Faculty of Science, Kerman Branch, Islamic Azad University, Kerman, Iran
3 Research and Development Unit, Copper Complex, Sarcheshmeh, Iran
4 Department of Genetic, Faculty of Sciences, Tarbiat modares University, Tehran, Iran
چکیده [English]

Introduction: Sulfate adenylyltransferase catalyzes adenosine phosphosulfate (APS) to generate ATP and sulfate, which is the final stage of the sulfite oxidation to obtain energy, and 4Fe_4S ferredoxin as an enzyme member of the electron transfer chain plays an important role in the oxidation of ferrous iron in the bioleaching system. Efforts to optimize bacterial growth conditions will also increase the gene expression, which will be accompanied by an increase in the efficiency of the microbial leaching system. Accordingly, the present study aimed to investigate the gene expression related to the proteins in Sulfobacillus thermosulfidooxidans along with the application of changing factors in the culture medium.
Materials and methods: For culture, different concentrations of chalcopyrite, yeast extract, and ferrous iron ion were added to a 9K medium. Bacteria were purified and bacterial RNA extraction and cDNA synthesis were performed. To investigate the expression level of the genes under study, the Real-time PCR reaction was performed and the results were analyzed by the 2-∆∆CT method. The results were also analyzed by Tukey and Duncan tests using SPSS version 21 with the P-value of ˂0.05.
Results: Using the results of the PCR, the genes in question were identified and primers were confirmed. The highest percentage of copper extraction in the four test environments was in the No. 2 environment with 48.75% in which the 4Fe_4Sferredoxin gene had the highest expression than the other test environments. The highest expression of the Sulfate adenylyltransferase gene was related to the medium No. 4 in which the percentage of copper extraction was 39.16%.
Discussion and conclusion: The composition of the bacterial culture medium can change the expression of genes and the percentage of copper extraction. The most suitable test medium was obtained for the extraction of copper in a 10-micron size, the presence of 1.5 g/L ferrous ion, and the absence of yeast extract.

کلیدواژه‌ها [English]

  • Sulfate adenylyltransferas
  • 4Fe_4S ferredoxin
  • Sulfobacillus thermosulfidooxidans
  • Bioleaching

مقدمه

توسعۀ زیست‌فناوری به‌شکل فناوری سازگار با محیط‌زیست، پژوهش‌ها در صنایع معدنی را به‌سوی استحصال فلزات از منابع معدنی سوق داده است (1 و 2). آبشویۀ میکروبی، فناوری‌ ساده‌ای با کارایی مؤثر برای استخراج فلزات از کان‌سنگ‌های کم‌عیار و کنسانتره‌های معدنی محسوب می‌شود (3). ریزموجودات به‌کاررفته در فرایند آبشویۀ میکروبی بر حسب مقاومت حرارتی به سه دستۀ مزوفیل، ترموفیل معتدل و ترموفیل مطلق تقسیم‌بندی می‌شوند که دامنۀ دمای کاربردی باکتری‌های مزوفیل 20 تا 45 درجۀ سانتی‌گراد، باکتری‌های ترموفیل معتدل 40 تا 55 درجۀ سانتی‌گراد و ترموفیل مطلق 60 تا 85 درجۀ سانتی‌گراد است (4-6). کالکوپیریت مهم‌ترین کانی سولفیدی مس موجود در جهان است؛ باوجوداین، مشکل عمدۀ فرایند آبشویۀ میکروبی کنسانترۀ کالکوپیریتی مس با کاربرد باکتری‌های مزوفیل، سرعت کم واکنش انحلال و بازیابی کم مس است (7 و 8). استفاده از باکتری‌های ترموفیل دارای تحمل دمای بیشتر، ظرفیت تحمل‌پذیری بیشتر به فلز و دارای ویژگی‌های متابولیکی مناسب‌تر، دستیابی به نتایج قابل‌قبول را محتمل می‌کند (9 و 10). سولفوباسیلوس ترموسولفیدواکسیدانس[1]، باکتری ترموفیل معتدل گرم مثبت، هوازی و اسپوردار است که اسیدیتۀ مناسب برای رشد آن 6/1 تا 4/2 است و در دمای 45 تا 55 درجۀ سانتی‌گراد فعال است (11 و 12). تاکنون اقدامات وسیعی در سراسر جهان در زمینۀ تغییرات ژنومی و مهندسی ژنتیک باکتری‌های مختلف انجام شده‌اند و نتایج مثبتی را به همراه داشته‌اند. در پژوهش‌های اخیر نیز توجه ویژه‌ای به باکتری‌های اسیددوست شده است و شرایط بهینۀ فعالیت و ویژگی‌های ژنتیکی و بیوشیمیایی آنها در حد مطلوبی تعیین شده‌اند (13 و 14)؛ بر این اساس، مشخص شده است ژن‌های کلیدی مختلفی مانند ژن سولفات‌آدنیلیل‌ترانسفراز[2] و ژن 4Fe-4Sفردوکسین[3] در باکتری سولفوباسیلوس ‌ترموسولفیدواکسیدانس با اکسیداسیون گوگرد و آهن طی سیستم آبشویۀ میکروبی فعال مرتبط هستند (15). آنزیم سولفات‌آدنیلیل‌ترانسفراز، آدنوزین‌فسفوسولفات (APS) را برای تولید ATP و سولفات کاتالیز می‌کند که مرحلۀ نهایی اکسیداسیون سولفیت برای به‌دست‌آوردن انرژی است (16-18). فردوکسین‌ها، پروتئین‌های کوچک، اسیدی و انتقال‌دهندۀ الکترون هستند که در سیستم‌های احیای زیستی حضور دارند (19). پروتئین 4Fe-4S فردوکسین عضو زنجیرۀ انتقال الکترون است و نقش مهمی در اکسیداسیون آهن فرو در سیستم آبشویۀ میکروبی بازی می‌کند (15). عوامل متعددی بر فرایند آبشویۀ میکروبی فلزات تأثیر می‌گذارند که عبارتند از: اسیدیته، دما، دور همزن، فلزات سنگین، یون آهن، چگالی پالپ، مواد معدنی و ترکیبات آلی، نوع کان‌سنگ، محیط‌کشت، سویۀ باکتری، دی‌اکسید‌کربن، اکسیژن، اندازۀ ذرات، پتانسیل اکسیداسیون و احیا (20). عصارۀ مخمر یکی از منابع اصلی رشد باکتری سولفوباسیلوس ترموسولفیدواکسیدانس است و افزودن عصارۀ مخمر، افزایش میزان اکسیداسیون گوگرد و اکسیداسیون یون آهن فرو را در پی دارد (11 و 21). آهن در سطح زمین فراوان است و ازاین‌رو، اهمیت زیادی در چرخۀ طبیعی دارد و نقشی کلیدی در فرایندهای آبشویۀ میکروبی و اکسیداسیون زیستی[4] ایفا می‌کند و روی رشد باکتری، بازدهی اکسایش و تشکیل رسوب تأثیر‌ می‌گذارد (22). در مطالعۀ حاضر، تأثیر عوامل مختلف ازجمله حضور یون آهن فرو و عصارۀ مخمر در محیط‌کشت روی بیان ژن‌های اکسیدکنندۀ آهن و گوگرد در باکتری سولفوباسیلوس ترموسولفیدواکسیدانس بررسی شد تا با افزایش‌دادن بیان ژن‌های یادشده همراه با فعالیت بیشتر باکتری‌ها، هدف افزایش بازده آبشویۀ میکروبی تأمین شود.

 

مواد و روش‌ها

بررسی کنسانترۀ کالکوپیریتی: کنسانترۀ کالکوپیریتی لازم از آزمایشگاه بیوهیدرومتالوژی مجتمع مس سرچشمه دریافت و پس‌از خردکردن، اندازۀ 80 درصد نمونه‌های عبوری برابر 10 میکرون شد. بررسی شیمیایی کنسانترۀ کالکوپیریتی با تجزیه‌وتحلیل XRF و کانی‌شناسی آن به کمک میکروسکوپ با نور پلاریزه تعیین شد.

کشت باکتری:به‌منظور کشت باکتری سولفوباسیلوس ترموسولفیدواکسیدانس که از معدن مجتمع مس سرچشمه جدا شد، از محیط پایۀ 9k شامل 3 گرم‌بر‌لیتر سولفات‌آمونیوم، 5/0 گرم‌بر‌لیتر سولفات‌منیزیم، 63/0 گرم‌بر‌لیتر فسفات‌دی‌پتاسیم، 1/0 گرم‌بر‌لیتر کلرید‌پتاسیم و 014/0 گرم‌بر‌لیتر نیترات‌کلسیم استفاده شد (23).

به‌منظور کشت اولیۀ باکتری، 50 گرم‌بر‌لیتر سولفات‌آهن و 5 گرم‌بر‌لیتر سولفور استریل به محیط پایۀ 9k اضافه شد؛ به‌طوری‌که 200 میلی‌لیتر محیط‌کشت ساخته‌شده به‌علاوۀ باکتری یادشده در هر ارلن 500 میلی‌لیتری وجود داشت. ارلن حاوی محیط‌کشت و باکتری به انکوباتور با دمای 50 درجۀ سانتی‌گراد و دور 135 دوردردقیقه انتقال یافت تا رشد انجام شود. پس‌از رشد باکتری، سازگارکردن انجام شد؛ به‌این‌ترتیب که 30 میلی‌لیتر از کشت اولیۀ باکتری یادشده (درصد تلقیح 15 درصد) به 170 میلی‌لیتر محیط پایۀ 9k به‌علاوۀ کنسانترۀ کالکوپیریتی افزوده شد. پس‌از رشد باکتری در چگالی پالپ کمتر، انتقال به محیط جدید با چگالی پالپ بیشتر انجام شد تا درنهایت، باکتری با چگالی پالپ 5 درصد سازگار شد. در همۀ مراحل سازگارکردن از انکوباتور با دمای 50 درجۀ سانتی‌گراد و دور 135 دوردردقیقه استفاده شد.

طراحی و تهیۀ چهار محیط رشد و کشت نهایی باکتری: به‌منظور انجام پژوهش، چهار محیط آزمایش طبق شاخص‌های جدول 1 طراحی شدند که محیط اول برای شاهد انتخاب شد؛ به‌این‌ترتیب که عصارۀ مخمر و یون آهن فرو را نداشت. باکتری‌های تکثیرشده در چگالی پالپ 5 درصد با درصد تلقیح 15 درصد به ارلن‌های 500 میلی‌لیتری منتقل شدند؛ به‌طوری‌که درنهایت، 200 میلی‌لیتر از ترکیب محیط‌کشت و باکتری در هر ارلن وجود داشت. ارلن‌ها به انکوباتور با دمای 50 درجۀ سانتی‌گراد و دور 135 دوردردقیقه منتقل شدند تا رشد انجام شود.

 

 

جدول 1- چهار آزمایش طراحی‌شده با مقدار متفاوتی از ترکیبات استفاده‌شده

غلظت یون آهن فرو (گرم‌برلیتر)

عصارۀ مخمر (درصد)

اندازۀ ذرات (میکرون)

چگالی پالپ (درصد)

شمارۀ آزمایش

0

0

10

5

1

5/1

0

10

5

2

0

04/0

10

5

3

5/1

04/0

10

5

4


ارزیابی و بررسی شرایط بهینۀ محیط‌های کشت: Eh و اسیدیته به‌ترتیب با Ehمتر و pHمتر اندازه‌گیری شدند و شمارش باکتری‌ها با میکروسکوپ نوری انجام شد (24).

استخراج RNA باکتری: به‌منظور استخراج RNA باکتری، ابتدا کنسانتره با کاغذ واتمن درجۀ C از محلول جداسازی شد؛ سپس رسوب‌گیری باکتری‌ها در هریک از چهار محیط انجام و درنهایت، RNA با استفاده از کیت اختصاصی آن BioBasic) کانادا) استخراج شد (13).

تجزیه‌وتحلیل کیفی و کمّی RNA استخراج‌‌شده: ژل الکتروفورز با آگارز 1 درصد برای بررسی کیفیت و تأیید RNAهای استخراج‌شده استفاده شد و به‌منظور یکسان‌بودن غلظت RNA مصرفی در ساخت cDNA، غلظت RNA موجود در نمونه‌های تیمارشده با DNase (سیناژن) با دستگاه نانودراپ خوانده و برای ساخت cDNA هریک از نمونه‌ها، مقدار 1 میکروگرم از RNA استفاده شد (15).

ساخت cDNA: به‌منظور تبدیل RNAهای استخراج‌شده از سلول به DNA و ساخت الگو برای انجام واکنش Real Time PCR، مقدار 1 میکروگرم از هر RNA طبق دستورکار کیت (پارس توس) به cDNA تبدیل شد (13).

واکنش زنجیره‌ای پلیمراز: واکنش PCR برای کنترل کیفیت cDNA و تأیید اتصال آغازگرها انجام شد؛ به‌این‌ترتیب که 1 میکرولیتر از هریک از cDNAهای سنتزشده همراه با آب و آغازگرهای مخصوص هر ژن که با استفاده از سایت www.ncbi.nlm.nih.gov/tools/primer-blast طراحی شدند و شرکت متابیون آلمان آنها را سنتز کرد (جدول 2)، طبق دستور کار مسترمیکس 2x PCRBIO Taq Mix Red (PCRBIOSYSTEMS انگلیس) آماده و سپس واکنش PCR با دستگاه ترموسایکلر (Bio Rad، آمریکا) و طبق برنامۀ دمایی جدول 3 انجام شد. تجزیه‌وتحلیل محصول PCR به کمک ژل الکتروفورز با آگارز 2 درصد انجام شد. ژل آگارز با استفاده از تصویرساز ژل داک (Uvidoc، انگلیس) مشاهده شد.

 

 

جدول 2- توالی آغازگرهای استفاده شده

توالی (5-3)

نام ژن

CCAAATTGCCACAGGAGCTT

AGATGCAAATGACGAGCGAC

Sulfate adenylyltransferas (F)

Sulfate adenylyltransferas (R)

GCCAAGACACCAAAGACCAG

AAGCGGCGTTAATCTCGATG

4Fe-4S ferredoxin (F)

4Fe-4S ferredoxin (R)

CCTACGGGAGGCAGCAGCGG

TGCTTCTTCTTGGATTCACG

16S rRNA (F)

16S rRNA (R)

 

جدول 3- برنامۀ زمانی واکنش PCR

توضیحات

دما (درجۀ سانتی‌گراد)

زمان

چرخه

دناتوره‌شدن (جدا‌شدن دو رشته)

95

7 دقیقه

1

دناتوره‌شدن

95

10 ثانیه

42

اتصال (چسبیدن آغازگرها)

56

30 ثانیه

42

طویل‌شدن

72

20 ثانیه

42

طویل‌شدن

72

5 دقیقه

1


انجام Real Time PCR: واکنش Real Time PCRطبق دستورکار مسترمیکس 2x qPCRBIO SyGreen Mix (PCRBIOSYSTEMS، انگلیس) که حاوی رنگ سایبرگرین بود، انجام شد. هر واکنش Real Time PCR با حجم نهایی 20 میکرولیتر حاوی 10 میکرولیتر مسترمیکس 2X، 8/0 میکرولیتر از هریک از آغازگرهای مستقیم و معکوس، 1 میکرولیتر cDNA و 4/7 میکرولیتر آب و عاری از نوکلئاز بود. این فرایند برای سنجش بیان هر دو ژن در هر سه نمونۀ آزمایش‌شده و نمونۀ شاهد انجام شد؛ علاوه‌بر‌این در همۀ نمونه‌ها، ژن 16S rRNA باکتری که توالی آغازگر آن از مقاله (13) الگوبرداری شد و شرکت متابیون آلمان آن را سنتز کرد (جدول 2)، شاهد داخلی در نظر گرفته شد. به‌منظور اطمینان از درستی واکنش، دو تکرار برای هر آزمایش در نظر گرفته شد و برای اطمینان از نبود آلودگی و خطاهای حاصل از آن، سه شاهد منفی برای هر ژن منظور شد که در آنها، میزان الگوی مدنظر (cDNA) با آب مقطر جایگزین شد. درنهایت به‌منظور تکثیر ژن‌ها باتوجه‌به دمای اتصال آغازگر بهینه‌شده، برنامۀ دمایی جدول 3 به دستگاه Real Time PCR (Roche مدل LightSycler96، آلمان) داده شد (13). روش ∆∆CT-2 برای محاسبۀ میزان تغییرات بیان ژن مدنظر استفاده شد. داده‌ها با آنالیز واریانس یک‌طرفه ANOVA و آزمون‌های Tukey و Duncan و با نرم‌افزار SPSS (نسخۀ 21) بررسی شدند و P˂0.05 تفاوت معنادار در نظر گرفته شد (13).

بررسی میزان بازیابی مس: بر اساس نتایج تجزیه‌وتحلیل شیمیایی، میزان مس اولیه در کنسانترۀ کالکوپیریتی بررسی‌شده به دست آمد و باتوجه‌به مقدار نهایی مس، میزان بازیابی محاسبه شد.

نتایج

نتایج تجزیه‌وتحلیل کنسانترۀ کالکوپیریتی:نتایج تجزیه‌وتحلیل شیمیایی و کانی‌شناسی کنسانترۀ کالکوپیریتی در جدول‌های 4 و 5 دیده می‌شوند.

نتایج اندازه‌گیری Eh و اسیدیتۀ مرحلۀ سازگارکردن باکتری‌ها با چگالی پالپ‌های مختلف: اطلاعات مربوط به اندازه‌گیری Eh نمونه‌ها در شکل 1 و نتایج اندازه‌گیری اسیدیتۀ آنها در شکل 2 دیده می‌شوند.

 

جدول 4- تجزیه‌وتحلیل شیمیایی کنسانترۀ کالکوپیریتی استفاده‌شده

نوع ماده

درصد وزنی

Cu

80/23

CuO

26/0

Fe

66/29

Al2O3

10/2

SiO2

12/6

CaO

35/0

S

55/33

 

جدول 5- تجزیه‌وتحلیل کانی‌شناسی کنسانتره کالکوپیریتی استفاده‌شده

درصد وزنی

ترکیب

نوع مینرال

195/1

Cu2S

کالکوسیت

072/2

CuS

کوولیت

800/56

CuFeS2

کالکوپیریت

0

Cu-N

مس طبیعی

440/2

Cu5FeS4

بورنیت

487/26

FeS2

پیریت

284/0

MoS2

مولیبدنیت

0

FeOOH

لیمونیت

582/0

ZnS

اسفالریت

0

Fe2O3

هماتیت

0

Fe3O4

مگنتیت

684/9

-

جمع کل مینرال‌های غیرفلزی

456/0

-

جمع کل مینرال‌های اکسیدی

 

شکل 1- میزان تغییرات Eh محیط‌کشت‌های دارای چگالی پالپ‌های مختلف کنسانترۀ کالکوپیریتی

 

 

شکل 2- میزان تغییرات اسیدیتۀ محیط‌کشت‌های دارای چگالی پالپ‌های مختلف کنسانترۀ کالکوپیریتی

 

نتایج اندازه‌گیری Eh و اسیدیتۀ هریک از محیط‌های آزمایش: پس‌از سازگارشدن باکتری‌ها با چگالی پالپ 5 درصد، کشت نهایی باکتری‌ها طبق ترکیبات جدول 3 در چهار محیط آزمایش انجام شد. اندازه‌گیری Eh و اسیدیتۀ محیط‌های آزمایش 1 و 2 نشان داد در این محیط‌ها، ابتدا اسیدیته افزایش می‌یابد و Eh تقریباً ثابت است؛ اما با رشد باکتری‌ها، اسیدیته کاهش و Eh افزایش می‌یابد تا به فاز سکون برسد (شکل‌های 3 و 4)؛ در محیط آزمایش 2، حضور یون آهن فرو سبب شد افزایش نمایی Eh بیشتر انجام شود.

اندازه‌گیری Eh و اسیدیتۀ محیط‌های آزمایش 3 و 4 نشان داد به‌علت حضور عصارۀ مخمر در این محیط‌ها، افزایش نمایی Eh از ابتدا انجام و زودتر به فاز سکون وارد می‌شود (شکل‌های 5 و 6)؛ البته حضور یون آهن فرو در محیط آزمایش 4 سبب شد افزایش نمایی Eh بیشتر انجام شود. در روزهای پایانی آزمایش، نوساناتی در Eh‌ها مشاهده شد.

 

 

شکل 3- نمودار میزان تغییرات Eh و اسیدیتۀ محیط آزمایش 1

 

 

شکل 4- نمودار میزان تغییرات Eh و اسیدیتۀ محیط آزمایش 2

 

 

شکل 5- نمودار میزان تغییرات Eh و اسیدیتۀ محیط آزمایش 3

 

شکل 6- نمودار میزان تغییرات Eh و اسیدیتۀ محیط آزمایش 4

 

نتایج شمارش باکتری‌ها: شمارش باکتری‌ها طی 26 روز انجام شد و نتایج چهار محیط آزمایش در شکل 7 دیده می‌شوند که تغییر تعداد باکتری‌ها طی گذر زمان را بیان‌ می‌کنند.

تعیین کیفیت RNAها با استفاده از ژل الکتروفورز: باندهای 23S، 16S و 5S RNAهای استخراج‌شده از باکتری‌ها در محیط‌کشت‌های متفاوت در شکل 8 دیده می‌شوند.

تجزیه‌وتحلیل کمّی RNAها: کمیت RNAهای حاصل و وجود آلودگی‌های الکلی و پروتئینی موجود در نمونه‌ها با نانودراپ تجزیه‌وتحلیل شد و نتایج در جدول‌های6 و 7 دیده می‌شوند.

 

 

شکل 7- مقایسۀ رشد باکتری‌ها در چهار محیط آزمایش طراحی‌شده

 

شکل 8- باند‌های RNAهای استخراج‌شدۀ حاصل از الکتروفورز روی ژل آگارز 1 درصد

 

جدول 6- بررسی کمّی و غلظت RNA‌ها با نانودراپ

میکرولیتر/نانوگرم

شماره نمونۀ RNA

6/141

1

5/267

2

4/261

3

4/266

4

 

جدول 7- بررسی RNA‌ها برای وجود آلودگی‌های الکلی و پروتئینی

230/260

280/260

شماره نمونۀ RNA

86/1

95/1

1

80/1

86/1

2

81/1

89/1

3

90/1

91/1

4

 

ژل الکتروفورز محصولات PCR: تجزیه‌وتحلیل محصولات PCR روی ژل آگارز 2 درصد به‌منظور تعیین کیفیت آغازگرها و مشخص‌کردن نقطۀ اتصال آنها برای ژن 4Fe-4S فردوکسین و ژن سولفات‌آدنیلیل‌‌ترانسفراز به‌ترتیب در شکل‌های 9 و 10 دیده می‌شود. کیفیت مناسب cDNAهای استخراج‌شده برای انجام Real Time PCR در شکل 9 نمایان است.

 

شکل 9- باند حاصل از انجام PCR برای ژن4Fe-4S  فردوکسین روی ژل آگارز 2 درصد

 

 

شکل 10- باند حاصل از انجام PCR برای ژن سولفات‌آدنیلیل‌‌ترانسفراز روی ژل آگارز 2 درصد

انجام واکنش Real Time PCR و تجزیه‌وتحلیل بیان ژن‌ها:نتایج و منحنی تکثیر ژن‌های سولفات‌آدنیلیل‌‌ترانسفراز و 4Fe-4S فردوکسین با استفاده از Real Time PCRنشان دادند تکثیر به‌خوبی و با عملکرد مناسب انجام شده است (شکل‌های 11 و 12). تغییرات بیان ژن‌های سولفات‌آدنیلیل‌‌ترانسفراز و 4Fe-4S فردوکسین برای باکتری‌های هریک از سه محیط‌کشت نسبت به شاهد طی واکنش Real Time PCR بررسی و نتایج آن به روش∆∆CT-2 محاسبه شدند. نتایج تغییرات بیان ژن سولفات‌آدنیلیل‌ترانسفراز نشان دادند افزایش بیان این ژن در محیط 4 نسبت به سایر محیط‌های کشت بیشینه است (این محیط شامل 04/0 درصد عصارۀ مخمر و 5/1 گرم‌بر‌لیتر یون آهن فرو علاوه‌بر محیط پایۀ 9k به‌علاوۀ کنسانتره بود) (شکل 13). تغییرات یادشده برای ژن 4Fe-4S فردوکسین در محیط‌کشت 2 بیشینه بود (این محیط شامل 5/1 گرم‌برلیتر یون آهن فرو علاوه‌بر محیط پایۀ 9k به‌علاوۀ کنسانتره و بدون عصارۀ مخمر بود) (شکل 14).

 

 

 

شکل 11- منحنی تکثیر ژن سولفات‌آدنیلیل‌‌ترانسفراز؛ طی انجام واکنش، دستگاه Real Time PCR میزان تغییرات نور فلورسنت در هر چرخه را به‌شکل منحنی تکثیر نشان می‌دهد؛ به‌طوری‌که هرچه میزان محصول تولیدشده بیشتر شود، تعداد رنگ متصل بین دو رشتۀ DNA بیشتر و درنتیجه، میزان نور فلورسنت ساطع‌شده بیشتر می‌شود.

 

شکل 12- منحنی تکثیر ژن 4Fe-4S فردوکسین

 

 

 

شکل 13- میانگین تغییر بیان ژن سولفات‌آدنیلیل‌‌ترانسفراز با P

 

 

شکل 14- میانگین تغییر بیان ژن 4Fe-4S فردوکسین با P

 

میزان بازیابی مس: نتایج نشان دادند بیشترین میزان بازیابی مس به محیط 2 با 75/48 درصد مربوط است؛ این محیط شامل 5/1 گرم‌بر‌لیتر یون آهن فرو علاوه‌بر محیط پایۀ 9k و کنسانتره بود (شکل 15).

 

 

شکل 15- درصد استخراج مس در چهار محیط آزمایش طراحی‌شده (بیشترین بازیابی مس به محیط آزمایش 2 مربوط است)

 

بحث و نتیجه‌گیری

طبق پژوهش‌های ژو[v] و همکاران، دو ژن سولفات‌آدنیلیل‌‌ترانسفراز و 4Fe-4S فردوکسین با اکسیداسیون آهن و گوگرد طی سیستم آبشویۀ میکروبی مرتبط هستند (15). در این پروژه، شناسایی دو ژن با‌توجه‌به Blast آنها در ژنوم باکتری سولفوباسیلوس ترموسولفیدواکسیدانس و همچنین با‌توجه‌به تکثیر‌شدن دو ژن در PCR و بررسی محصول PCR با ژل الکتروفورز انجام و میزان بیان آنها تحت‌تأثیر عوامل مؤثر در فرایند آبشویۀ میکروبی ازجمله حضورداشتن و حضورنداشتتن آهن فرو و عصارۀ مخمر در محیط‌کشت باکتری یادشده تعیین شد. نتایج نشان دادند حضور هر دو عامل یادشده در چگالی پالپ 5 درصد و اندازه ذرات 10 میکرون برای افزایش بیان ژن‌های بررسی‌شده مؤثر است. درصد استخراج مس در محیط‌های آزمایش طراحی‌شده محاسبه شد. نتایج نشان دادند بیان دو ژن یادشده در چهار محیط آزمایش طراحی‌شده (باتوجه‌به اینکه ترکیبات محیط‌ها متفاوت بود)، تغییر می‌کند؛ به‌طوری‌که با افزایش یک یا هر دو ژن، درصد استخراج مس در همۀ محیط‌ها افزایش می‌یابد.

ساکارومایسس سرویزیه، مخمری است که در طبیعت یافت می‌شود و به‌علت داشتن ژنتیک و فیزیولوژی منحصر‌به‌فرد، کاربردهای وسیعی دارد. عصارۀ مخمر یادشده محرک بسیار قوی برای رشد باکتری‌ها است و تا حدی ویتامین، نیتروژن، آمینواسیدها و کربن را برای باکتری در محیط فراهم می‌کند (25)؛ البته عصارۀ مخمر به‌شکل محلول رقیق سبب کم‌شدن اثر مسموم‌کنندگی املاح فلزی موجود در محیط پرورش باکتری می‌شود (26). در پژوهش حاضر، حضور عصارۀ مخمر سبب افزایش بیان دو ژن و درنتیجه، افزایش درصد استخراج مس شد، اما بهترین نتیجه به حضور یون آهن فرو بدون حضور عصارۀ مخمر مربوط بود. طبق پژوهش Azmayandeh و همکاران، یون‌های آهن فرو نقش منبع انرژی را برای سلول‌های باکتری ایفا می‌کنند. حضور یون‌های فرو بر پتانسیل محلول لیچینگ تأثیر‌ می‌گذارد؛ به‌طوری‌که سبب افزایش استخراج مس از کالکوپیریت می‌شود (27). در پژوهش حاضر، محیطی که به آن آهن فرو اضافه شد، بهترین بیان یکی از دو ژن سولفات‌آدنیلیل‌‌ترانسفراز و 4Fe-4S فردوکسین را داشت و درصد استخراج مس نسبت به دیگر محیط‌ها بیشتر بود. حضور هم‌زمان یون آهن فرو و عصارۀ مخمر در محیط سبب افزایش بیان دو ژن و درصد استخراج مس شد؛ به‌طوری‌که نتایج گویای تأثیر بیشتر این حالت نسبت به حضور عصارۀ مخمر به‌تنهایی در محیط بود، ولی بهترین بازیابی مس زمانی به دست آمد که یون آهن فرو به‌تنهایی در محیط حضور داشت. در محیط آزمایش 1 که بدون یون آهن فرو و عصارۀ مخمر بود، میزان بیان دو ژن بررسی‌شده کمتر از محیط‌های دیگر بود، ولی میزان بازیابی مس تفاوت اندکی با سایر محیط‌ها داشت و حتی میزان آن نسبت به محیط آزمایش 3 که حاوی عصارۀ مخمر بود، بیشتر بود که گویای وجود و تأثیر ژن‌های دیگری علاوه‌بر ژن‌های بررسی‌شده در فرایند بیولیچینگ از طریق سولفوباسیلوس ترموسولفیدواکسیدانس است؛ این ژن‌ها کمتر به وجود عصارۀ مخمر وابسته هستند، ولی یون آهن فرو روی آنها مؤثر است؛ زیرا نتایج نشان دادند بیان ژن‌ها و بازیابی مس در محیط‌هایی بیشتر است که یون آهن فرو دارند؛ در نتیجهبا افزایش یون آهن فرو و عصارۀ مخمر در چگالی پالپ 5 درصد و اندازه ذرات 10 میکرون به محیط‌کشت باکتری سولفوباسیلوس ترموسولفیدواکسیدانس، می‌توان بیان دو ژن سولفات آدنیلیل‌‌ترانسفراز و 4Fe-4S فردوکسین را افزایش داد که نتیجۀ آن، افزایش درصد استخراج مس در فرایند آبشویۀ میکروبی است. بیشترین درصد استخراج مس در پژوهش حاضر به محیط شمارۀ 2 با 75/48 درصد مربوط بود که در این محیط، 5/1 گرم‌بر‌لیتر یون آهن فرو حضور داشت و عصارۀ مخمر وجود نداشت. گفتنی است ضمن تأمین‌شدن تمام اهداف پژوهش، شناسایی و بررسی میزان بیان ژن‌های یادشده زمینه را برای انجام پژوهش‌های بعدی نظیر کلون‌کردن فراهم کرد تا باکتری دارای کارایی بیشتر برای فرایند آبشویۀ میکروبی تهیه شود.

 

سپاسگزاری

نویسندگان از سرکار خانم فاطمه حسین‌زاده پاریزی (کارشناس ارشد میکروبیولوژی مس سرچشمه) که در جداکردن باکتری استفاده‌شده در پژوهش حاضر ایفای نقش کردند، سپاسگزاری می‌کنند؛ در ضمن، از پرسنل محترم شرکت ملی صنایع مس سرچشمه و مسئولان محترم دانشگاه آزاد اسلامی، واحد کرمان تقدیر می‌شود.

(1) Dreisinger DB., Copper WC., Young SK. Silver-catalyzed bioleaching of low-grade copper ores. Part 1: Shake flasks tests. Hydrometallurgy 2007; 88: 3-18.
(2) Devasia P., Natarajan KA. Bacterial leaching: Biotechnology in the mining industry. Science Education 2004; 9(8): 27-34.
(3) Johnson DR. The microbiology of biomining development and optimization of mineral-oxidizing microbial consortia. Microbiology 2007; 153(2): 315-324.
(4) Ziegler S., Dolch K., Geiger K., Krause S., Asskamp M., Eusterhues K., et al. Oxygen-dependent niche formation of a pyrite-dependent acidophilic consortium built by archaea and bacteria. The ISME Journal 2013; 7(9): 1725-1737.
(5) Blazquez ML., Alvarez A., Ballester A., Gonzalez F., Munoz JA. Bioleaching Behaviour of Chalcopyrite in the Presence of Silver at 350 and 680C. Biohydrometallurgy and Environment, Part A. 1999; 9: 127-137.
(6) Pradhan N., Nathsarma KC., Srinivasa Rao K., Sukla LB., Mishra BK. Heap bioleaching of chalcopyrite: A review. Minerals Engineering 2008; 21: 355-365.
(7) Petersen J., Dixon DG. Thermophilic heap leaching of a chalcopyrite concentrate. Minerals Engineering 2002; 15: 777-785.
(8) Rawlings DE., Dew D., Du-Plessis C. Biomineralization of metal-containing ores and concentrates. TRENDS in Biotechnology 2003; 21(1): 38-44.
(9) Dixon DG., Petersen J. Thermophilic heap leaching of a chalcopyrite concentrate. Minerals Engineering 2002; 15: 777-785.
(10) Nemati M., Harrison STL. Effect of solid loading on thermophilic bioleaching of sulfide minerals. Journal of Chemical Technology and Biotechnology 2000; 75(7): 526-532.
(11) Tat'yana IB., Tsaplina IA., Kondrat'eva TF., Duda VI., Suzina NE., Melamud VS., et al. Sulfobacillus thermotolerans sp nov a thermotolerant chemolithotrophic bacterium. International Journal of Systematic and Evolutionary Microbiology 2006; 56(5): 1039-1042.
(12) Tabrizi Mosafa R. Identification and purification of moderate thermphilic bacteria isolated from Sarcheshmeh copper mine in broth media [Dissertation]. Kerman: Islamic Azad University; 2017.
(13) Fatemi F., Sheydaie M., Haji Hosseini R. Evaluation the effect of uranium ore concentrations on the cyc2 gene expression in the mutated Acidithiobacillus sp. FJ2. Biological Journal of Microorganism 2018; 26: 21-41.
 
(14) Xin B., Jiang W., Li X., Zhang K., Liu C., Wang R., Wang Y. Analysis of reasons for decline of bioleaching efficiency of spent Zn–MN batteries at high pulp densities and exploration measure for improving performance. Bioresource Technology 2012; 112: 186-192.
(15) Zhou D., Peng T., Zhou H., Liu X., Gu G., Chen M., et al. Expression of Critical Sulfur- and Iron-Oxidation Genes and the Community Dynamics During Bioleaching of Chalcopyrite Concentrate by Moderate Thermophiles. Springer 2015; 71: 62-69.
(16) Bick JA., Dennis JJ., Zylstra GJ., Nowack J. Identification of a new class of 50-adenysulfate (APS) reductase from sulfate-assimilating bacterial. Journal of Bacteriology 2000; 182: 135-142.
(17) Leustek T., Martin MN., Bick JA., Davies JP. Pathways and regulation of sulfur metabolism revealed through molecular and genetic studies. Annual Review of Plant Biology 2000; 51: 141-165.
(18) Saito K. Sulfur assimilatory metabolism. The long and smelling road. Plant Physiology 2004; 136: 2443-2450.
(19) Zeng J., Huang X., Liu Y., Liu J., Qiu G. Expression, purification, and characterization of a [Fe2S2] cluster containing ferredoxin from Acidithiobacillus ferrooxidans.Current Microbiology2007; 55: 518-523.
(20) Chen D., Lin J., Che Y., Liu X., Lin J. Construction of recombinant mercury resistant Acidithiobacillus caldus. Microbiological Research 2011; 166: 515-520.
(21) Roy S., Roy M. Bioleaching of Heavy Metals by Sulfur Oxidizing Bacteria: A Review. International Research Journal of Environment Sciences 2015; 4(9): 75-79.
(22) Ozkaya B., Sahinkaya E., Nurmi P., Kaksonen A., Puhakka J. Iron oxidation and precipitation in simulated heap leaching solution in a Leptospirillum ferriphilum dominated biofilm reactor. Hydrometallurgy 2007; 88: 67-74.
(23) Walting HR. The bioleaching of sulphide minerals with emphasis on copper sulphides- A review. Hydrometallurgy 2006; 84: 81-108.
(24) Jafarpoor R., Fatemi F., Mehrnejad F., Eidi A. Investigation the UV Effect on Uranium Bioleaching Process in Acidithiobacillus sp FJ2 and its Possible Consequences on the CoxB Gene Sequence. Biological Journal of Microorganism 2018; 27: 95-111.
(25) Peter G., Carlos R. Biodiversity and Ecophysiology of Yeasts in: The Yeast Handbook. Kurtzman CP. Fell JW. Yeast Systematics and Phylogeny-Implications of Molecular Identification Methods for Studies in Ecology. Springer 2005; 11-30.
(26) Vaghar R., Oliazadeh M., Vaghar MR. Biotechnology in metallurgy. Tehran: University of Industries and Mines; 2000.
(27) Azmayandeh M., Abdollahi H., Riahimadvar A. Investigation of the effect of chemical compounds on leaching and bioliching of copper sulfide minerals. International Conference on Science and Engineering, Dubai, United Arab Emirates; 2015.