نوع مقاله : پژوهشی- فارسی

نویسندگان

1 دانشیار گروه گیاه‌پزشکی، دانشکدۀ کشاورزی، دانشگاه لرستان، خرم‌آباد، ایران

2 استادیار گروه گیاه‌پزشکی، دانشکدۀ کشاوزی، دانشگاه شهید چمران اهواز، اهواز، ایران

3 گروه گیاه‌پزشکی، دانشکدۀ کشاورزی، دانشگاه لرستان، خرم‌آباد، ایران

10.22108/bjm.2020.122745.1296

چکیده

مقدمه: یکی از روش‌های نوین برای کاهش آلودگی‌های ناشی از کاربرد علف‌کش‌ها و سایر سموم شیمیایی کشاورزی، استفاده از جدایه‌های باکتریایی متحمل و تجزیه‌کنندۀ این علف‌کش‌هاست. پژوهش حاضر به‌منظور جداسازی و شناسایی جدایه‌های باکتریایی مقاوم یا متحمل در برابر علف‌کش‌های اُتللو، آتلانتیس و پوماسوپر از خاک مزارع گندم انجام‌ شد.
مواد و روش‏‏ها: نمونه‌برداری از خاک مزارع گندم تیمار‌شده با سه علف‌کش اُتللو، آتلانتیس و پوماسوپر انجام شد. جدایه‌های باکتریایی با استفاده از محیط‌کشت سوکسینات استاندارد حاوی 10 درصد از علف‌کش‌های آزمایش‌شده جداسازی شدند. جدایه‌های نماینده بر اساس آزمون‌های بیوشیمیایی و تکثیر ژن 16S rRNA شناسایی شدند. کمترین غلظت مهارکنندگی و کمترین غلظت کشندگی برای هر سه علف‌کش آزمایش‌شده محاسبه شد.
نتایج: درمجموع، تعداد 17 جدایه توانایی رشد روی محیط‌های رشد حاوی 10 درصد از علف‌کش‌های آزمایش‌شده را داشتند. بر اساس کلیدهای باکتری‌شناسی معتبر و نتایج آزمون‌های مولکولی روی جدایه‌های نماینده، استنوتروفوموناس مالتوفیلیا، انسیفر ادهائرنس، زانتوموناس، سودوزانتوموناس و اسینتوباکتر شناسایی شدند. کمترین غلظت مهارکنندگی و کمترین غلظت کشندگی در علف‌کش‌های اُتللو (به‌ترتیب 28/0 و 4/0) و آتلانتیس (به‌ترتیب 35/0 و 5/0) برای اسینتوباکتر و در علف‌کش پوماسوپر برای جنس زانتوموناس (به‌ترتیب 45/0 و 67/0) محاسبه شد.
بحث و نتیجه‏گیری: باتوجه‌به نتایج پژوهش حاضر، شناسایی جدایه‌های متحمل و تعیین میزان تحمل آنها به علف‌کش‌های یادشده، گامی مهم در پژوهش‌های زیست‌فناوری آینده به‌منظور پالایش آلاینده‌ها از محیط‌های آلوده است و می‌تواند مشکلات زیست‌محیطی ناشی از این علف‌کش‌ها در اکوسیستم را کاهش دهد؛ ازاین‌رو، پژوهش‌های بیشتر برای تعیین توانایی جدایه‌های باکتریایی مقاوم در تجزیه‌کنندگی علف‌کش‌های یادشده پیشنهاد می‌شود.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Isolation and Identification of Othello, Atlantis, and Puma Super Herbicide-resistant Bacteria Isolated from the Soil of Wheat Farms

نویسندگان [English]

  • Abdolreza Ahmadi 1
  • Hossein Mirzaei najafgholi 1
  • Milad Aeini 2
  • Kazem Kakolvand 3

1 Department of Plant Protection, Faculty of Agriculture, Lorestan University, Khorramabad, Iran

2 Department of Plant Protection, Faulty of Agriculture, Shahid Chamran University of Ahvaz, Ahvaz, Iran

3 Department of Plant Protection, Faculty of Agriculture, Lorestan University, Khorramabad, Iran

چکیده [English]

Introduction: One of the new methods in reducing the pollution caused by the use of herbicides and other agricultural chemical pesticides is the use of resistant and degrading bacterial isolates of these herbicides. This study was conducted to isolate and identify resistant bacterial strains from the soil of wheat fields using the three herbicides of Othello, Atlantis, and Puma Super.
Materials and methods: To isolate and characterize resistant bacteria, samples were collected from wheat fields treated with Othello, Atlantis, and Puma Super herbicides. Isolates were selected based on the growth on the Standard Succinate Medium containing 10 percent of the mentioned herbicides. The representative isolates were identified based on biochemical tests and amplification of the 16S rRNA gene. Also, the Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) of the representatives were measured.
Results: A total of 17 isolates could grow on a growth medium containing 10% of the tested herbicides. Based on the valid biochemical and molecular test results, the representative strains were identified as Stenotrophomonas maltophilia, Ensifer adhaerens, Xanthomonas sp., Pseudoxanthomonas sp., and Acinetobacter sp. The Minimum inhibitory concentration (MIC) and Minimum Bactericidal Concentration (MBC) were attributed to Othello (0.28 and 0.4) and Atlantis herbicides (0.35 and 0.5) belonging to Acinetobacter and Xanthomonas (0.45 and 0.67) for Puma Super herbicides.
Discussion and conclusion: According to the results of this study, herbicide-resistant bacteria identified in this study can be useful in plant biotechnology applications in polluted areas and can reduce environmental pollution regarding using these herbicides. However, further studies are needed in order to identify the degrading potential of the resistant strains.

کلیدواژه‌ها [English]

  • inoculation
  • Bioremediation
  • Weed

مقدمه

رشد روزافزون جمعیت انسانی در جهان، مسئلۀ نیاز غذایی و تأمین امنیت غذایی بشر را به‌ چالشی بحث‌برانگیز تبدیل کرده است. باوجود تلاش برای افزایش تولید، به‌طور معمول عوامل خسارت‌زای زنده و غیرزنده مانند علف‌های هرز بر محصولات کشاورزی تأثیر می‌گذارند. سطح زیرکشت گندم در کشورهای درحال ‌توسعه برابر 125 میلیون هکتار و در کشورهای توسعه‌یافته برابر 95 میلیون هکتار است که درمجموع، 220 میلیون هکتار (معادل 75 درصد) از سطح کشت دنیا را به خود اختصاص می‌دهد. در ایالات ‌متحدۀ آمریکا، علف‌های هرز به‌تنهایی سبب کاهش 12 درصد از عملکرد گندم می‌شوند؛ میانگین کاهش عملکرد ناشی از رقابت این گیاهان در مزارع گندم ایران حدود 23 درصد گزارش‌ شده است (1).

امروزه، علف‌کش‌ها به یکی از مهم‌ترین و ضروری‌ترین نهاده‌ها در سیستم‌های کشت تبدیل ‌شده‌اند و بخش درخور ‌توجهی از عملکرد محصولات زراعی ازجمله گندم مرهون استفاده از علف‌کش‌هاست (2 و 3). از دیدگاه مدیریت شیمیایی علف‌های هرز، علف‌کش‌ها در یک ‌فصل زراعی بسیار مفید هستند، اما فعالیت زیادی دارند و می‌توانند پایداری خود را در خاک حفظ کنند و سبب آسیب به گیاهان زراعی حساس در تناوب‌های زراعی و همچنین آلودگی‌های محیط‌زیست شوند (4). در سال‌های اخیر، روش‌های نوینی برای مقابله با خطر باقیماندۀ علف‌کش‌ها به کار گرفته شده‌اند (5) و یکی از سازوکار‌هایی که به‌تازگی توجه دنیا را جلب کرده است، به‌کارگیری باکتری‌های تجزیه‌کنندۀ علف‌کش‌هاست. باکتری‌ها، قارچ‌ها، اکتینومیست‌ها و جلبک‌ها، ریزموجودات اصلی تشکیل‌دهندۀ خاک هستند که در بین آنها، باکتری‌ها پتانسیل لازم برای تجزیۀ زیستی و متابولیسم میکروبی سموم را دارند (4). زیست‌پالایی[1] یا حذف زیستی آلاینده‌ها یکی از روش‌های کارآمد و مطمئن نسبت به سایر فناوری‌های پاک‌سازی است (6). پژوهش‌های دانشمندان نشان داده‌‌اند در تجزیۀ سریع علف‏کش‏های تیوکاربامات در خاک‌های آلوده به علف‌کش، تراکم ریزموجودات تجزیه‌کننده پس‌از تجزیۀ علف‌کش نیز همچنان زیاد است (7). در مطالعه‌ای که رضایی[2] و همکاران در سال 2011 انجام دادند، شیوۀ عمل دو باکتری سودوموناس فلورسنس[3] و سودوموناس آرژینوزا[4] در تجزیۀ آترازین در شرایط آزمایشگاهی بررسی شد. بررسی دقیق‌تر نشان داد دو گونۀ سودوموناس فلورسنس و سودوموناس آرژینوزا نتایج متفاوتی از تجزیۀ علف‌کش را در سه سطح غلظتی 100، 200 و 300 میلی‌گرم‌بر‌میلی‌لیتر و سه نوع محیط‌کشت نمک‌های معدنی کامل، بدون کربن و بدون نیتروژن نشان می‌دهند. نتایج بررسی یادشده نشان دادند هر دو باکتری توان تجزیۀ علف‌کش آترازین را در هر سه غلظت استفاده‌شده طی بازۀ زمانی دو روز دارند. بررسی بیشتر نشان داد با افزایش غلظت تا 300 میلی‌گرم‌بر‌میلی‌لیتر، دو باکتری سودوموناس فلورسنس و سودوموناس آرژینوزا می‌توانند علف‌کش آترازین بیشتری را تجزیه کنند که رابطۀ مستقیم بین آنها را نشان‌ می‌دهد (8). بهکی[5] و خان[6] در سال 1986 گزارش کردند برخی از گونه‌های جنس باکتریایی سودوموناس[7] توانایی رشد در محیط‌کشت حاوی علف‌کش آترازین را از طریق فرایند اُکسایش زنجیره‌های آلکیل طی مدت 30 روز دارند (9). مندلبیوم[8] و همکاران در سال 1995 نشان دادند گونه‌های خاصی از باکتری سودوموناس که با عنوان نژاد ADP شناخته می‌شوند، توانایی تجزیۀ علف‌کش آترازین را دارند (10). علف‌کش‌های اُتللو، آتلانتیس و پوماسوپر ازجمله علف‌کش‌های سیستمیک هستند که برای کنترل علف‌های هرز پهن‌برگ و باریک‌برگ در مزارع گندم استفاده می‌شوند (11). ازآنجا‌که تاکنون پژوهشی در زمینۀ باکتری‌های متحمل یا مقاوم به علف‌کش‌های یادشده انجام ‌نشده است، در پژوهش حاضر به جداسازی و شناسایی جدایه‌های باکتریایی مقاوم و تعیین میزان تحمل آنها به سه علف‌کش اُتللو، آتلانتیس و پوماسوپر در خاک مزارع گندم پرداخته می‌شود.

 

مواد و روش‌ها

انتخاب علف‌کش‌های بررسی‌شده در پژوهش حاضر:به‌منظور بررسی باکتری‌های مقاوم یا متحمل به علف‌کش‌های محصول گندم، سه علف‌کش پرکاربرد مزارع گندم شامل آتلانتیس، اُتللو و پوماسوپر پس‌از بررسی منابع و مشاهده‌های میدانی انتخاب شدند.نمونه‌برداری از خاک‌ مزارع گندم تیمار‌شده با علف‌کش‌های اُتللو، آتلانتیس و پوماسوپر طی تابستان 97 از مزرعۀ دانشکدۀ کشاورزی دانشگاه لرستان انجام شد. نمونه‌برداری از لایۀ سطحی خاک (عمق صفر تا 20 سانتی‌متر) انجام شد. تعداد سه نمونه از هر کرت انتخاب و پس‌از مخلوط‌کردن آنها، یک نمونۀ اصلی انتخاب (در مجموع، 48 نمونۀ 100 گرمی) و پس‌از ثبت مشخصات به آزمایشگاه منتقل شد.

.تهیۀ سری رقت از محلول خاک و کشت در محیط آگار غذایی حاوی 10 درصد از علف‌کش‌های اُتللو، آتلانتیس و پوماسوپر: روش طاهری[9] و همکاران (2017) با اندکی تغییر برای جداسازی اولیۀ باکتری‌های خاک از محیط‌کشتی با غلظت 10 درصد از سه علف‌کش آزمایش‌شده استفاده شد (12). ابتدا محیط‌کشت آگار مغذی[10] تهیه و در دمای 121 درجۀ سانتی‌گراد استریل‌ شد. هنگامی‌که دمای محیط به 40 درجۀ سانتی‌گراد رسید و پیش از اینکه منعقد شود، غلظت 10 درصد از علف‌کش‌ها به هریک از پتری‌ها اضافه شد و پس‌از مخلوط‌کردن اولیۀ محیط‌کشت و علف‌کش، محیط‌کشت‌ها در دمای 4 درجۀ سانتی‌گراد نگهداری شدند. به‌منظور تهیۀ سری رقت، مقدار 1 گرم از خاک آزمایش‌شده به 9 میلی‌لیتر آب مقطر استریل اضافه شد؛ پس از مخلوط‌شدن، دوباره 1 میلی‌لیتر از لولۀ ‌آزمایش اول به لولۀ ‌آزمایش دوم حاوی 9 میلی‌لیتر آب مقطر اضافه و با آن مخلوط شد؛ این کار تا لولۀ ششم (6-10) ادامه یافت و در انتها، مقدار 100 میکرولیتر از سوسپانسیون تهیه‌شده روی محیط‌کشت آگار مغذی حاوی غلظت 10 درصد از هر علف‌کش قرار داده شد و با میلۀ شیشه‌ای اِل‌شکل روی سطح محیط آگار مغذی پخش شد. ظرف‌های پتری‌ به‌مدت 48 ساعت در دمای 28 درجۀ سانتی‌گراد نگهداری شدند.

آزمون جایگزینی منبع کربن با غلظت 10 درصد علف‌کش‌های اُتللو، آتلانتیس و پوماسوپر در محیط سوکسینات استاندارد[11]: به‌منظور انتخاب جدایه‌های باکتری‌های مقاوم یا متحمل به علف‌کش‌های اُتللو، آتلانتیس و پوماسوپر، محیط‌کشت سوکسینات استاندارد حاوی 10 درصد از علف‌کش‌های بررسی‌شده (تنها منبع کربن) بر اساس روش مجرد[12] و همکاران (2017) با اندکی تغییر استفاده شد. ابتدا کشت 24 ساعته از جدایه‌های‌ باکتری خالص‌شده تهیه و سپس سوسپانسیون جدایه‌های باکتریایی درون آب ‌مقطر استریل تهیه شد. میزان 50 میکرولیتر از سوسپانسیون جدایه‌های باکتریایی به‌طور جداگانه به 70/48 میلی‌لیتر محیط سوکسینیک‌اسید بدون منبع کربن و حاوی 10 درصد از علف‌کش‌های اُتللو، آتلانتیس و پوماسوپر اضافه شد و نمونه به‌مدت 24 ساعت روی شیکر با سرعت 160 دوردردقیقه هوادهی شد (اسیدیتۀ محیط با NaOH یک مولار به 7 رسید). در محیط‌کشت سوکسینات استاندارد اصلاح‌شده، میزان 100 میلی‌لیتر‌در‌لیتر از علف‌کش‌های اُتللو، آتلانتیس و پوماسوپر به‌جای سوکسینیک‌اسید اضافه شد (13).

تعیین کمترین غلظت بازدارندگی (MIC[13]) و کُشندگی (MBC[14]) علف‌کش‌های استفاده‌شده:کمترین غلظت بازدارندگی و کشندگی علف‌کش‌های استفاده‌شده در پژوهش حاضر به روش ریزلوله[15] تعیین شد؛ در این روش، از غلظت 30000 تا 14 میکروگرم‌بر‌میلی‌لیتر تیمارها درون میکروپلیت (پلیت‌های الایزا) استفاده شد؛ درون هر چاهک میکروپلیت، مقدار 150 میکرولیتر محیط‌کشت آگار غذایی مایع[16] استریل‌شده قرار داده شد. میزان 150 میکرولیتر از هر تیمار علف‌کش‌ با غلظت 30000 میکروگرم‌بر‌میلی‌لیتر به چاهک اول هر ردیف اضافه شد و عمل مخلوط‌کردن چندین بار با سمپلر انجام شد. طبق روش رقیق‌سازی، میزان 150 میکرولیتر از چاهک اول برداشته و درون چاهک دوم ریخته شد و این عمل تا چاهک آخر هر ردیف ادامه یافت و در انتها، مقدار 150 میکرولیتر از چاهک آخر خارج شد؛ در پایان، مقدار 10 میکرولیتر از سوسپانسیون باکتری با غلظت 108 واحد تشکیل‌دهندۀ کلنی بر میلی‌لیتر[17] به هر چاهک اضافه شد. میکروپلیت‌ها به‌مدت 24 ساعت درون شیکرانکوباتور با سرعت 80 دوردردقیقه و دمای 28 درجۀ سانتی‌گراد قرار داده شدند (2). پس‌از پایان گرماگذاری، وجودداشتن یا نداشتن کدورت در چاهک به‌طور چشمی مشاهده و جذب نوری با دستگاه خوانشگر میکروپلیت[18] در طول ‌موج 630 نانومتر بررسی شد. کمترین غلظت بازدارندگی، کمترین غلظتی در نظر گرفته شد که کدورتی در آن مشاهده نشد. کمترین رقتی که توانست 9/99 درصد باکتری‌ها را از بین ببرد، کمترین غلظت کشندگی در نظر گرفته شد. مراحل آزمایش سه بار تکرار و نتایج به‌طور میانگین ارائه شدند (14).

شناسایی جدایه‌ها بر اساس آزمون‌های بیوشیمیایی و مولکولی:آزمون‌هایی نظیر گرم با استفاده از KOH 3 درصد، اکسیداز، کاتالاز، هوازی/بی‌هوازی، تولید گاز سولفید‌هیدروژن (H2S) از سیستئین، تولید لوان، هیدرولیز توئین، تولید رنگدانۀ زانتومونادین، رنگ فلورسنت در محیط King-B بر اساس روش‌های استاندارد باکتری‌شناسی انجام شدند (15)؛ همچنین به‌منظور تشخیص دقیق برخی جدایه‌ها، روش توالی‌یابی ناحیه‌ای از ژن 16S rRNA با استفاده از آغازگرهای 16sF (AGAGTTTGATCCTGGCTCAGTCG) و 16sR (AGAGTTTGATCCTGGCTCAG) با طول قطعۀ تکثیری 1500 جفت باز استفاده شد (16). یک لوپ از پرگنۀ باکتری روی محیط‌کشت آگار مغذی برداشته و در 100 میلی‌لیتر آب مقطر استریل حل شد. استخراج DNA نمونه‌ها به روش جوشاندن[19] انجام شد؛ به‌طوری‌که 10 دقیقه در ظرف حاوی آب جوش جوشانده و بی‌درنگ به‌مدت چند دقیقه روی یخ قرار داده شد؛ سپس نمونه‌ها به‌مدت 3 دقیقه در 12000 دوردردقیقه سانتریفیوژ شدند و از فاز رویی برای انجام واکنش زنجیره‌ای پلیمراز استفاده شد.. به‌منظور انجام آزمون یادشده، محلول پایۀ 25 میکرولیتر برای هر واکنش تهیه شد. تکثیر در دستگاه ترموسایکلر با برنامۀ حرارتی واسرشت‌سازی مقدماتی به‌مدت 5 دقیقه در 95 درجۀ سانتی‌گراد، 40 چرخه با واسرشت‌سازی به‌مدت 30 ثانیه در 94 درجۀ سانتی‌گراد، اتصال به‌مدت 30 ثانیه در 62 درجۀ سانتی‌گراد، سنتز به‌مدت 4 دقیقه در 72 درجۀ سانتی‌گراد و سنتز نهایی به‌مدت 10 دقیقه در 72 درجۀ سانتی‌گراد انجام شد. مواد لازم برای واکنش زنجیره‌ای پلیمراز شامل 5/2 میکرولیتر بافر واکنش PCRbuffer (10X)، 5/1 میکرولیتر MgCl2 (2.5mM)، 5/0 میکرولیتر dNTPs (10mM)، 25/0 میکرولیتر Taq DNA polymerase (10U/ µl)، 1 میکرولیتر آغازگر رفت (10µM)، 1 میکرولیتر آغازگر برگشت (10µM)، 3 میکرولیتر DNA و 25/15 میکرولیتر آب استریل بود. به‌منظور اطمینان‌یافتن از درستی اندازۀ قطعۀ تکثیرشده، الکتروفورز روی ژل آگارز 1 درصد انجام شد. به‌منظور تعیین توالی این بخش از ژنوم، محصول واکنش زنجیره‌ای پلیمراز حاصل از جفت آغازگرهای استفاده‌شده به شرکت ماکروژن کرۀ جنوبی ارسال شد. به‌منظور ترسیم درخت فیلوژنتیکی بر اساس توالی ژن 16S rRNA از روش اتصال مجاور[20] و نرم‌افزار MEGA (نسخۀ 7) استفاده شد.

 

نتایج

درمجموع، تعداد 210 جدایۀ مختلف روی محیط جدید رشد کردند که ازنظر ویژگی‌های فنوتیپی شامل شکل کلنی، رنگ و دیگر ویژگی‌های ظاهری متفاوت بودند. رنگ‌های کلنی سفید، شیری، کرم، زرد و قرمز مشاهده شدند و اندازۀ کلنی از 1 تا 5 میلی‌متر متغیر بود. در بین 210 جدایۀ مدنظر، انواع اشکال کلنی شامل محدب، تخت، با حاشیۀ منظم و با حاشیۀ غیرمنظم مشاهده شد. تولید لوان در برخی از کلنی‌ها مشهود بود. تعدادی از کلنی‌ها با تولید رنگدانه سبب تغییر رنگ محیط‌کشت شدند.

محیط‌کشت سوکسیسنات استاندارد حاوی غلظت 10 درصد از علف‌کش‌های آزمایش‌شده برای انتخاب جدایه‌های باکتریایی مقاوم یا متحمل به علف‌کش‌های اُتللو، آتلانتیس و پوماسوپر استفاده شد. نتایج نشان دادند از 210 جدایۀ به‌دست‌آمده در مرحلۀ رقیق‌سازی اولیه، تعداد 17 جدایه می‌توانند روی محیط‌کشت دارای غلظت 10 درصد علف‌کش (تنها منبع کربن و نیتروژن) رشد کنند. جدایه‌های یادشده عموماً کلنی‌های شیری، زرد و سفید داشتند و شکل کلنی آنها محدب تا تخت بود.

تعداد 17 جدایه‌ای که قادر به استفاده از علف‌کش‌های آزمایش‌شده بودند، با‌توجه‌به آزمون‌های گرم به روش KOH، تولید رنگ فلورسنت و رنگدانۀ زانتومونادین، اکسیداز، کاتالاز، تولید گاز سولفیدهیدروژن (H2S) از سیستئین، تولید لوان، هیدرولیز توئین 20، رشد هوازی و بی‌هوازی در پنج گروه قرار گرفتند (جدول 1)؛ در ادامه، یک جدایۀ نماینده از هر گروه انتخاب و با روش مولکولی مبتنی بر توالی‌یابی بخشی از ناحیۀ ژن 16S rRNA به‌طور دقیق شناسایی شد. به‌منظور تأیید شناسایی جدایه‌ها بر اساس آزمون‌های فنوتیپی، آغازگرهای رفت‌ و برگشت عمومی 16sF و 16sR که بخشی از ناحیۀ ژن 16S rRNA تمام باکتری‌ها را تکثیر می‌کنند، در آزمون واکنش زنجیره‌ای پلیمراز استفاده شدند. همۀ جدایه‌های آزمایش‌شده، یک قطعۀ 1500 جفت بازی[21] را تکثیر کردند که امکان مشاهدۀ آن روی ژل آگارز 1 درصد وجود داشت (شکل 1). هیچ‌گونه قطعه‌ای در شاهد منفی تکثیر نشد و این امر درستی آزمون واکنش زنجیره‌ای پلیمراز را تأیید کرد.

 

جدول 1- نتایج آزمون‌های بیوشیمیایی جدایه‌های نمایندۀ جداشده از خاک‌های مزارع گندم تیمار‌شده با علف‌کش

واکنش گرم

هوازی اجباری

بی‌هوازی اختیاری

اکسیداز

کاتالاز

تولید H2S از سیستئین

لوان

هیدرولیز توئین 20

تولید رنگ فلورسنت

تولید رنگدانۀ زانتامونادین

جدایه‌های باکتریایی

-

+

-

-

+

+

-

+

-

-

اسینتوباکتر

-

-

+

+

+

-

-

-

-

-

سودوزانتوموناس

-

-

-

-

+

-

+

+

-

-

انسیفر ادهائرنس

-

+

-

-

+

-

-

+

-

-

استنوتروفوموناس مالتوفیلیا

-

+

-

-

+

+

+

+

-

+

زانتوموناس

+، مثبت‌بودن و –، منفی‌بودن نتیجۀ آزمون را نشان می‌دهد. به‌منظور اطمینان‌یافتن، آزمون‌ها دو بار تکرار شدند.

 

 

 

شکل 1- تکثیر قطعۀ 1500 جفت بازی بخشی از ژن rRNA 16S در پنج جدایۀ منتخب به‌دست‌آمده از خاک مزارع گندم تیمارشده با علف‌کش

 

پنج جدایۀ نماینده که ازنظر ویژگی‌های فنوتیپی در گروه‌های جداگانه قرار داشتند، پس‌از تکثیر ژن 16S rRNA، توالی‌یابی شدند. بلاست[22] نتایج توالی‌یابی در بانک ژنی مرکز اطلاعات زیست‌فناوری (NCBI)[23] نشان داد جدایه‌های یادشده به چه گروه‌هایی تعلق دارند. علاوه‌بر جنس، گونۀ دو جدایه نیز شناسایی شد و شباهت بیش از 99 درصدی را با توالی‌های موجود در NCBI نشان داد؛ بنابراین، جنس و گونۀ دو جدایه به‌ترتیب استنوتروفوموناس مالتوفیلیا[24] و انسیفر ادهائرنس[25] تشخیص داده شد. سایر جدایه‌ها به‌ترتیب به جنس‌های باکتریایی زانتوموناس[26]، سودوزانتوموناس[27] و اسینتوباکتر[28] تعلق داشتند (شکل 2).

کمترین غلظت بازدارندگی (MIC) و کمترین غلظت کشندگی (MBC) برای هریک از سه علف‌کش آزمایش‌شده به دست آمد. در زمینۀ علف‌کش اُتللو، کمترین MIC در جنس زانتوموناس (25/0)و کمترین MBC در دو جنس اسینتوباکتر و زانتوموناس (4/0) به دست آمد (جدول 2). در زمینۀ علف‌کش آتلانتیس، کمترین MIC و کمترین MBC به‌ترتیب برابر 35/0 و 5/0 در جنس اسنیتوباکتر به دست آمد (جدول 3). در زمینۀ علف‌کش پوماسوپر، کمترین MIC به جنس‌های زانتوموناس (32/0) و سودوزانتوموناس (45/0)تعلق داشت و کمترین MBC برای جنس زانتوموناس (53/0) به دست آمد (جدول 4).

 

 

شکل 2- درخت فیلوژنی رسم‌شده بر اساس توالی ناحیه‌ای از ژن 16S rRNA جدایه‌های منتخب به‌دست‌آمده در پژوهش حاضر و سایر جدایه‌های ثبت‌شده در NCBI به روش اتصال همسایه‌ها با نرم‌افزار MEGA 7؛ اعداد ثبت‌شده در محل انشعاب‌ها، درصد تأیید خوشه‌بندی با 1000 تکرار (Bootstrap) را نشان می‌دهند. خط نشانه برابر با 2/0 تغییر نوکلئوتید در هر محل است.

 

جدول 2- کمترین غلظت بازدارندگی و کشندگی علف‌کش اُتللو

جنس‌های باکتریایی

کمترین غلظت بازدارندگی (میلی‌لیتر علف‌کش در میلی‌لیتر محیط‌کشت)

کمترین غلظت کشندگی(میلی‌لیتر علف‌کش در میلی‌لیتر محیط‌کشت)

انسیفر ادهائرنس

4/0

65/0

استنوتروفوموناس مالتوفیلیا

35/0

55/0

زانتوموناس

25/0

4/0

سودوزانتوموناس

37/0

55/0

اسینتوباکتر

28/0

4/0

 

جدول 3- کمترین غلظت بازدارندگی و کشندگی علف‌کش آتلانتیس

جنس‌های باکتریایی

کمترین غلظت بازدارندگی (میلی‌لیتر علف‌کش در میلی‌لیتر محیط‌کشت)

کمترین غلظت کشندگی(میلی‌لیتر علف‌کش در میلی‌لیتر محیط‌کشت)

انسیفر ادهائرنس

6/0

7/0

استنوتروفوموناس مالتوفیلیا

6/0

75/0

زانتوموناس

45/0

6/0

سودوزانتوموناس

50/0

7/0

اسینتوباکتر

35/0

5/0

جدول 4- کمترین غلظت بازدارندگی و کشندگی علف‌کش پوماسوپر

جنس‌های باکتریایی

کمترین غلظت بازدارندگی (میلی‌لیتر علف‌کش در میلی‌لیتر محیط‌کشت)

کمترین غلظت کشندگی(میلی‌لیتر علف‌کش در میلی‌لیتر محیط‌کشت)

انسیفر ادهائرنس

63/0

8/0

استنوتروفوموناس مالتوفیلیا

55/0

75/0

زانتوموناس

32/0

53/0

سودوزانتوموناس

45/0

67/0

اسینتوباکتر

52/0

73/0

 


بحث

استفادۀ گسترده از علف‌کش‌ها در کشاورزی سبب ایجاد ریزموجودات مقاوم در برابر این مواد شیمیایی می‌شود. به‌طورکلی، حساسیت یا مقاومت به علف‌کش‌ها باتوجه‌به فعالیت‌های فیزیولوژیکی و ترکیب ژنتیکی ریزموجودات تعیین می‌شود (17) که می‌تواند در آزمون‌های کمترین غلظت بازدارندگی و کمترین غلظت کشندگی برای تعیین مقاومت و ماندگاری باکتری در غلظت‌های مختلف مواد شیمیایی و سموم کارایی داشته باشد (18). در زمینۀ باکتری‌های متحمل یا مقاوم به علف‌کش‌ها، پژوهشگران گزارش‌هایی در زمینۀ توانایی طیف وسیعی از باکتری‌ها مانند جنس‌های سودوموناس، رودوکوکوس[1]، اسنیتوباکتر، میکروباکتریوم[1]، باسیلوس[1]، میکروکوکوس[1]، دینوکوکوس[1] و دلفتیا اسیدوورانس[1] و همچنین برخی از باکتری‌های شناخته‌شده مانند اگروباکتریوم تومفسینس[1]، کائلوباکتر کرسنتوس[1]، سودوموناس پوتیدا[1]، گونه‌های رایزوبیوم[1] و ناکاردیا[1] در تجزیۀ علف‌کش‌ها ارائه کرده‌اند (19). در پژوهش‌های انجام‌شده، باکتری‌های سودوموناس به‌علت داشتن قابلیت‌ تجزیۀ آلاینده‌های آلی ازجمله مشتقات نفتی، هیدروکربن‌های حلقوی آروماتیک، علف‌کش‌ها و دیگر آلاینده‌ها، مدنظر پژوهشگران قرار گرفته‌اند. در پژوهش‌های انجام‌شده در زمینۀ خانوادۀ سودوموناس‌ها نشان داده شده است برخی از آنها می‌توانند علف‌کش‌های موجود را به‌شکل منابع غذایی برای تهیۀ نیتروژن و کربن استفاده کنند؛ ازاین‌رو، آنها علف‌کش‌ها را به ترکیبات کوچک‌تری تجزیه می‌کنند که بی‌خطر یا کم‌خطر‌تر هستند.

بر اساس پژوهش‌های هاشمی[xxix] و همکاران در سال 2015، دو جدایه از جدایه‌های جمع‌آوری‌شده برای تجزیۀ علف‌کش پاراکوات با استفاده از روش شناسایی بر پایۀ ژن 16s rDNA به‌عنوان جنس‌های استرپتومایسسز[xxx] و آکروموباکتر زایلوسوکسیدانس[xxxi] شناسایی شدند. دو باکتری یادشده در نبود گلوکز، توان تجزیۀ زیستی علف‌کش پاراکوات (حدود 40 درصد) را داشتند و با افزودن گلوکز، این توانایی به‌طور چشمگیری افزایش (حدود 70 درصد) یافت (20). باتوجه‌به اینکه علف‌کش پاراکوات و علف‌کش‌های استفاده‌شده در پژوهش حاضر (اُتللو، آتلانتیس و پوماسوپر) از عناصر کربن و نیتروژن در ساختار شیمیایی خود بهره برده‌اند، باکتری‌ها با افزایش غلظت و پس‌از تطبیق با شرایط پیرامون گیاه، علف‌کش‌ها را به‌شکل منبع کربن و نیتروژن استفاده می‌کنند. در غلظت کم علف‌کش، باکتری‌های تجزیه‌کننده (عموماً جنس سودوموناس) رشد معمولی خود را دارند و از عناصر غذایی موجود در محیط‌کشت استفاده می‌کنند، اما در غلظت‌های زیاد علف‌کش که عناصر کربن و نیتروژن فراهم‌ هستند، برخی از ژن‌های تجزیه‌کنندۀ مواد شیمیایی مانند AtzAکه در پلاسمید باکتری حضور دارند، شروع به بیان‌شدن می‌کنند و درنتیجه، تجزیۀ‌ علف‌کش به ترکیبات سازندۀ آن تسریع می‌شود (8). در پژوهش حاضر، باکتری استنوتروفوموناس مالتوفیلیا مقاوم یا متحمل به علف‌کش‌ها شناسایی شد. این ریزموجود در اکوسیستم‌های متنوعی ردیابی و به‌علت پویایی ژنوم باکتری، مقاومت به آنتی‌بیوتیک‌ها در آن مشاهده‌ شده است (21). مطابق پژوهش‌های گذشته، تنوع زیست‌محیطی زیاد این ریزموجود سبب توسعۀ توانایی آن برای استفاده از منابع غذایی مختلف ازجمله ترکیبات خطرناک مانند علف‌کش‌ها شده است؛ همچنین توانایی این باکتری در تجزیۀ علف‌کش‌هایی مانند دیکامبا، آترازین و ددت[xxxii] گزارش‌ شده است (22). باکتری دیگری که در پژوهش حاضر به‌ دست‌ آمد، باکتری انسیفر ادهائرنس بود که از باکتری‌های ساکن خاک محسوب می‌شود. این باکتری دارای رابطۀ همزیستی با ریشۀ گیاهان است و به تثبیت نیتروژن می‌پردازد و از سوی دیگر، گیاه نیز عناصر غذایی و انرژی را برای باکتری فراهم می‌کند (23). به نظر می‌رسد این باکتری توانایی استفاده از نیتروژن و کربن در غلظت‌های زیاد علف‌کش را دارد؛ به‌طوری‌که نیتروژن زیادی را استفاده و تثبیت می‌کند. باکتری‌های جنس زانتوموناس که جنس مهمی از باکتری‌های گرم منفی است، تنوع بیشتری نسبت به باکتری‌های مشابه دارند و تخصص میزبانی در آنها شکل ‌گرفته است. اگرچه این باکتری کمتر از سایر باکتری‌های مطالعه‌شده طی پژوهش حاضر در خاک دیده می‌شود، این جنس توانایی نسبتاً مطلوبی در استفاده از ترکیبات سه علف‌کش بررسی‌شده به‌شکل منابع غذایی دارد. باکتری سودوزانتوموناس، ریزموجودی است که در بسیاری از محیط‌ها مانند فیلترهای زیستی و پساب‌های صنعتی، خاک‌های زراعی، خاک‌های آلوده به هیدروکربن‌های چندحلقه‌ای یا روغن‌ها، چشمه‌های آب گرم و بافت گیاهی یافت می‌شود و همانند دیگر باکتری‌های متنوع ازنظر زیست‌محیطی، ژنوم آن نیز برای استفاده از منابع گوناگون کربن و نیتروژن توسعه یافته است و این باکتری را قادر می‌کند تا به‌آسانی در محیط‌های دارای شرایط نامساعد محیطی به رشد خود ادامه دهد؛ ازاین‌رو، رشد باکتری یادشده در خاک‌های زارعی که غلظت‌های زیادی از علف‌کش در آنها استفاده‌ شده است، دور از انتظار نیست. آخرین جنس باکتریایی که در پژوهش حاضر شناسایی و بررسی شد، اسینتوباکتر بود. این باکتری قدرت تخمیر قندها را ندارد و گونه‌های مختلف آن از باکتری‌های مهم خاک و آب به شمار می‌آیند. پژوهش‌های گذشته در زمینۀ این باکتری نشان داده‌اند قادر به استفاده از منابع کربن به‌شکل ساده است و ازاین‌رو می‌تواند طیف وسیعی از منابع را استفاده کند (24).

 

نتیجه‌گیری

یکی از مباحثی که به‌تازگی در زمینۀ تحمل به علف‌کش‌ها مطرح‌ شده است، استفاده از ژن‌های مقاومت در باکتری‌ها و انتقال آنها به گیاه میزبان است؛ بنابراین شناسایی باکتری‌های مقاوم و متحمل در برابر علف‌کش‌ها، گامی ضروری به نظر می‌رسد. بر اساس نتایج پژوهش حاضر، باکتری‌های استنوتروفوموناس مالتوفیلیا، انسیفر ادهائرنس، سودوزانتوموناس، زانتوموناس و اسینتوباکتر، باکتری‌های مقاوم یا متحمل به علف‌کش‌های اُتللو، آتلانتیس و پوماسوپر در مزارع گندم هستند. ریزموجودات دارای توان تحمل یا مقاومت بیشتر در برابر علف‌کش‌ها، تجزیه‌کنندگان متداول این مواد محسوب می‌شوند؛ بنابراین، بررسی میزان تجزیه‌کنندگی این باکتری‌ها طی مطالعه‌های بعدی پیشنهاد می‌شود.



[1]- Bioremediation

[2]- Rezaei

[3]- Pseudomonas fluorescens

[4]- Pseudomonas aeruginosa

[5]- Behki

[6]- Khan

[7]- Pseudomonas

[8]- Mandelbaum

[9]- Taheri

[10]- Nutrient Agar

[11]- Standard Succinate Medium

[12]- Mojarad

[13]- Minimum Inhibitory Concentration

[14]- Minimum Bactericidal Concentration

[15]- Microdilution

[16] -Nutrient broth

[17]- CFU/mL

[18]- Microplate – Reader

[19]- Oiling

[20]- Neighbor joining

[21]- Base pair

[22]- Basic Local Alignment Search Tool

[23]- National Center for Biotechnology Information

[24]- Stenotrophomonas maltophilia

[25]- Ensifer adhaerens

[26]- Xanthomonas

[27]- Pseudoxanthomonas

[28]- Acinetobacter

[xxix]- Hashemi

[xxx]- Streptomyces sp

[xxxi]- Achromobacter xylosoxidans

[xxxii]- DTT

(1) Deghan Benadaki M. Weed management in wheat fields. 1st ed. Tehran: Institute for Applied Higher Education, Academic Jihad; 2018.

(2) Deihimfard R., Zand E., Damghani AM., Soufizadeh S. Herbicide risk assessment during the wheat self‐sufficiency project in Iran. Pest Management Science 2007; 63(10): 1036-1045.

(3) Kudsk P. Optimising herbicide dose: A straightforward approach to reduce the risk of side effects of herbicides. Environmentalist 2008; 28(1): 49-55.

(4) Izadi A. Evaluation of atrazine shelf life in greenhouse and field conditions and its effect on soil microbial activity and agroforestry [Dissertation]. Mshhad: Ferdowsi University of Mashhad; 2009.

(5) Zhang Q., Xu F., Lambert KN., Riechers DE. Safeness coordinately induce the expression of multiple proteins and MRP transcripts involved in herbicide metabolism and detoxification in Triticum tauschii seedling tissues. Proteomics 2007; 7(8): 1261-1278.

(6) Rousseaux S., Hartmann A., Lagacherie B., Piutti S., Andreux F., Soulas G. Inoculation of an atrazine-degrading strain, Chelatobacter heintzii Cit1, in four different soils: Effects of different inoculum densities. Chemosphere 2003; 51(7): 569-576.

(7) Nazarian A., Mousawi MA. Study of bacterial resistance to organophosphorus pesticides in Iran. Journal of Environmental Health Science and Engineering 2005; 2(3): 207-211.

(8) Rezaei D., Haghnia GH., Laksian A., Hassanzadeh Khayat M., Nasirli H. Study of atrazine biodegradation by Pseudomonas fluorescence and Pseudomonas aeruginosa (In Vitro). Journal ofSoil and Water Conservation 2011; 25(4): 799-806 (in Persian).

(9) Behki RM., Khan SU. Degradation of atrazine by Pseudomonas: N-dealkylation and dehalogenation of atrazine and its metabolites. Journal of Agricultural and Food Chemistry 1986; 34(4): 746-749.

(10)           Mandelbaum RT., Allan DL., Wackett LP. Isolation and characterization of a Pseudomonas sp. that mineralizes the s-triazine herbicide atrazine. Applied and Environmental Microbiology 1995; 61(4): 1451-1457.

(11)           Ebadati A., Gholamalipour Alamdari E., Avasaji Z., Rahemi Karizaki A. Effect of application time of dual purpose herbicides and mixing herbicides on weeds control and wheat yield. Journal of Plant Ecophysiology 2020; 11: 192-209.

(12)           Taheri Z., Ghasemian Roodsari F., Afshari MP. Isolation and characterization of herbicide-degrading bacteria metibosin in contaminated soils under cultivation in Zanjan province. Journal of AgricultureBiotechnology 2017; 16(1): 11-18 (in Persian).

(13)           Mojarad M., Alamzad A., Qureishi G., Javaheri M. Evaluation of growth and decomposition potential of kerosene by several bacteria isolated from soil and water contaminated with petroleum compounds. Environment and Natural Resources Journal 2017; 70(1): 161-172 (in Persian).

(14)           Burt S. Essential oils: Their antibacterial properties and potential applications in foods- A review. International Journal of Food Microbiology 2004; 94(3): 223-253.

 

(15)           Schaad NW., Jones JB., Chun W. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd edit. New York: American Phytopathology Society Press; 2001.

(16)           Weisburg WG., Barns SM., Pelletier DA., Lane DJ. 16S ribosomal DNA amplification for phylogenetic study. Bacteriology Research 1991; 173(2): 697-703.

(17)           Karishma B., Prasad SH. Isolation, characterization and growth studies of malathion insecticide degrading bacteria. International Journal of Environmental Science 2016; 6(5): 697-706.

(18)           Wesgate R., Grasha P., Maillard JY. Use of a predictive protocol to measure the antimicrobial resistance risks associated with biocidal product usage. American Journal of Infection Control 2016; 44: 458-464

(19)           Sene L., Converti A., Secchi GA., Simão RD. New aspects on atrazine biodegradation. Brazilian Archives of Biology and Technology 2010; 53(2): 487-496.

(20)           Hashemi SH., Ali Asgharzad N., Khvarvar R., Avestan SH. Isolation and characterization of Paraquat herbicides from Tabriz soil. Journal of Soil Biology 2015; 2(3): 117-128 (in Persian).

(21)           Aeini M., Khodakaramian G. Rhizosphere bacterial composition of the sugar beet using SDS-PAGE methodology. Brazilian Archives of Biology and Technology 2017; 60: e17160374.

(22)           Murray PR., Rosenthal KS., Pfaller MA. Medical Microbiology, with Student Consult Online Access, Medical Microbiology. 6th ed. Philadelphia: Mosby;2013.

(23)           Wendt T., Doohan F., Mullins E. Production of Phytophthora infestans-resistant potato (Solanum tuberosum) utilising Ensifer adhaerens OV14. Transgenic Research 2012; 21(3): 567-578.

Desouky A. Acinetobacter environmental and biotechnological application. African Journal of Biotechnology 2003; 2: 71-74.