Isolation of Endophytic Bacteria from Grasses Root and Assessing Phosphate Solubilization, Potassium Releasing and Auxin Production Abilities of Isolated Bacteria

Introduction

The rhizosphere is the narrow zone of soil which is influenced by the root system. It is a nutrient-rich habitat for microorganisms due to the accumulation of plant exudates, such as amino acids and sugars, providing a rich source of energy and nutrients for bacteria (1). Plant growth-promoting rhizobacteria (PGPR) are a group of bacteria that exist in the rhizosphere, at root surfaces and in association with roots, and are able to promote plant growth directly and/or indirectly. In recent decades some bacterial genus including Pseudomonas, Azospirillum, Azotobacter, Klebsiella, Enterobacter, Alcaligenes, Arthrobacter, Burkholderia, Bacillus and Serratia have been reported as PGPR (2). The direct growth-promoting activities are as follows; facilitating nutrient uptake or increase nutrient availability by nitrogen fixation, solubilizing mineral nutrients, mineralizing organic compounds and production of phytohormones (3). The indirect promotion of plant growth occurs when PGPR minimizes or prevents the deleterious effects of phytopathogens by producing antagonistic substances and/or by inducing resistance to pathogens (2).

Phosphate solubilization activity of microorganisms is considered as one of the most important characteristics of PGPRs associated with phosphorus nutrition (4). Plant growth-promoting rhizobacteria have many mechanisms for the dissolution of unavailable forms of phosphorus and help in making phosphorus available for plants. The main phosphate solubilization mechanisms include (a) release of complexing compounds e.g. organic ligands (b), proton, hydroxyl ions, CO₂, (c) liberation of extracellular enzymes and  the release of phosphate during substrate degradation (biological phosphate mineralization) (4,5). Different bacterial genera such as Arthrobacter, Bacillus, Beijerinckia, Burkholderia, Enterobacter, Erwinia, Flavobacterium, Microbacterium, Pseudomonas, Rhizobium, Rhodococcus, and Serratia have been noticed to improve plant growth and yield (6).

Indole-3-acetic acid affects plant growth through cell division, extension and differentiation; stimulates seed and tuber germination, root development, controls vegetative growth and the formation of lateral roots, photosynthesis rate, pigment formation, biosynthesis of various metabolites and resistance to stressful conditions (7). About 80% of rhizobacteria are able to synthesize IAA through different biosynthetic pathways. These microorganisms have the powertoaffect the endogenous levels of this regulator and therefore have remarkable effects on plant growth (8). The production of IAA by PGPR involves formation via indole-3-pyruvic acid and indole-3-acetic aldehyde, which is the most common mechanism in bacteria like Pseudomonas, Rhizobium, Bradyrhizobium, Agrobacterium, Enterobacter and Klebsiella (9).

Some soil microorganisms are able to dissolve K-bearing minerals such as mica, illite, and orthoclase which lead to releasing their potassium (10,11). Some PGPRs such as Pseudomonas spp., Acidithiobacillus ferrooxidans, Bacillus mucilaginosus, B. edaphicus and B. megaterium have been reported for release of potassium from K-bearing minerals (12). Siderophores can also improve plant growth through both direct and indirect pathways. Direct beneficial effects of bacterial siderophores on plant growth have been documented by using radiolabeled ferric siderophores as the only source of iron. A large number of PGPRs such as Aeromonas, Azadirachta, Azotobacter, Bacillus, Burkholderia, Pseudomonas, Rhizobium, Serratia,and Streptomyces sp. are capable of producing siderophores (13).

The main objectives of this study were isolation and identification of endophytic bacteria from some grasses root and determination of their growth-promoting properties including phosphate solubilization, IAA and siderophore production and potassium releasing from K-bearing minerals.

Material and Methods

Isolation and Purification of Endophytic Bacteria: The rhizosphere soil samples were collected from three provinces including East Azerbaijan, Ardabil, and Gilan. Roots were separated, washed and disinfected by 1% sodium hypochlorite and 70% ethanol (14), then were crashed in sterilized water and diluted up to 10^-4. Then, 100 µL of the dilution was added to the tubes containing semi-solid Nitrogen Free Bromothymol blue (NFB) medium and incubated at 28 °C for 48-72 hours. After incubating and observing the rising pellicle formation, a part of this pellicle was transferred to the solid NFB medium by performing streak culture. NFB medium containing per liter of distilled water: 5 g L-Malic acid, 0.5 g K₂HPO₄, 0.2 g MgSO₄.7H₂O, 0.02 g NaCl, 4 g KOH, 2 mL micronutrients solution (0.2 g Na₂MoO₄.2H₂O, 0.235 g MnSO₄.H₂O, 0.28 g H₃BO₃, 0.008 g CuSO₄.5H₂O, 0.24 g ZnSO₄.7H₂O and 1000 mL distilled water), 2 mL bromothymol blue, 4 mL Fe-EDTA (1.64%), 1 mL vitamin solution (0.01 g biotin, 0.02 g pyridoxine and 1000 mL distilled water) and 1.75 g agar. The pH of the medium was adjusted to 6.8 (15). Once more, white and fine colonies were transferred to semi-solid NFB medium to check the pellicle formation. For final purification, pellicles were transferred to the congo red medium containing per liter of distilled water: 5 g L-Malic acid, 0.5 g K₂HPO₄, 0.2 g MgSO₄.7H₂O, 0.02 g NaCl, 1 mL vitamin solution, 4.8 g KOH, 0.02 g CaCl₂.2H₂O, 15 mL congo red (1:400), 0.5 g NH₄Cl, 0.5 g yeast extract, 15-20 g agar and pH 7. Light-pink and colorless colonies were observed after 48 h. After 72 h, the light-pink colonies became scarlet. Pink and often wrinkled colonies were picked out. Purified isolates were frozen and kept at -20 °C in the presence of 15% (v/v) glycerol (16).

It should be mentioned that in this experiment two isolates namely AC46-I and C162-O belonging to Azospirillum sp. and Pseudomonas sp. were used as control bacteria to perform in-vitro PGP assessments (these bacteria were prepared from Soil Biology Laboratory of Department of Soil Science, University of Tabriz).

Phosphate Solubilization Activity: In order to evaluate the phosphate solubilization of bacterial isolates in the presence of tri-calcium phosphate (TCP) and rock phosphate (RP), a factorial experiment based on the completely randomized design with three replications was conducted. Phosphate solubilization ability of 24 bacterial isolates was determined using Pikovskaya medium (17) containing TCP and RP as sole sources of phosphorus (containing per liter of distilled water: 10 g glucose, 5 g TCP, 0.5 g yeast extract, 0.5 g (NH₄)₂SO₄, 0.2 g KCl, 0.0001 g MnSO₄·H₂O, 0.0001 g Fe₂(SO₄)₃ and 0.1 g MgSO₄.7H₂O). Overnight culture of the isolates was prepared in the nutrient broth (NB) and 0.5 mL was added to 100 mL Erlenmeyer flasks containing 30 mL Pikovskaya medium. In control treatment, only 0.5 mL of sterile NB was added. The flasks were incubated for 7 days at 26 °C on shaker incubator with 150 rpm. The contents of Erlenmeyer flasks were centrifuged at 5000 rpm for 5 min. The concentration of P was determined by vanadate–molybdate method using spectrophotometer (Hach DR/2000) (18).

K Releasing Ability: The assessment of potassium solubilization was examined based on the bacterial abilities to release K from biotite and muscovite as insoluble sources of potassium. This experiment was conducted as a completely randomized factorial design with three replications. The factors included isolates of bacteria and sources of potassium (biotite and muscovite). Acid washed pretreated minerals (19) as a source of potassium and 0.5 mL of bacterial inoculum were added to 30 mL of Aleksandrov medium containing per liter of distilled water: 5 g glucose, 2 g TCP, 2 g mica (biotite or muscovite), 0.5 g MgSO₄.7H₂O, 0.005 g FeCl₃ and 0.1 g CaCl₂ (19,20). After incubation for one week at 26 °C and shaking at 120 rpm, released K in the supernatant was measured by using a flame photometer (Corning Model 410).

IAA Production: Measurement of IAA was performed by colorimetric method as described by Gordon and Weber (21). For this purpose, NF medium (NFB without bromothymol blue) containing 100 mg/lL-Tryptophan was used. This experiment was performed in a completely randomized factorial design with three replications. The factors included two levels of L-Tryptophan (0 and 100 mg/l) and bacterial isolates. Estimation of IAA was carried out in 100 mL Erlenmeyer flasks containing 30 mL NF medium. Each flask was inoculated with 0.5 mL of bacterial inoculums (overnight cultures of bacteria in nutrient broth) and the flasks were incubated for 72 h at 26 °C on shaker incubator with 120 rpm. The contents of flasks were centrifuged at 5000 rpm for 5 min. Then, 2 mL supernatant of each particular isolates was mixed with 4 mL of Salkowski reagent (H₂SO₄ (12M) + FeCl₃ (0.5M)) and kept for 30 minutes (21) and development of pink color indicated IAA production. Absorbance was recorded at 530 nm by spectrophotometer and the concentration of IAA was determined by using a standard graph (22).

Siderophore Production: Bacterial isolates were assayed for siderophore production by the method of Schwyn and Neilands (23) using chrome azurol S (CAS) agar. Siderophore was detected by the formation of orange halos surrounding bacterial colonies on CAS agar plates. Spot inoculation of the bacterial isolates was performed on the CAS agars plates and incubated at 26°C for 48–72 h. The appearance of yellow-orange halo around the colony was considered positive for siderophore production.

Identification of Bacterial Isolates

Molecular Identification: After assessing the growth-promoting properties of the isolates, molecular identification was performed based on the amplification of 16S rDNA gene. Molecular identification of the bacteria was done without genomic DNA extraction through the application of colony-PCR method. A part of a bacterial single colony was used as a source of DNAg in PCR reaction. Bacterial 16S rDNA was amplified by using the universal bacterial 16S rDNA primers, 24F (5’ AGAGTTTGATCCTGGCTCAG 3’) and 1525R (5’ AAGGAGGTGATCCAGCCGCA 3’). PCR was performed with a 20 µL reaction mixture containing bacterial colony as a template of DNA, 0.1 pmol of each primer, 2 mM MgCl₂ and dNTPs at a concentration of 0.2 mM, as well as 0.2 U of Taq-DNA polymerase and buffer was used as recommended by the manufacturer (Fermentas, Hanover, Germany). The instruction for amplification by PCR was: 94 °C for 5 min (first DNA denaturation), 94 °C for 1 min (denaturation), 53 °C for 1 min (annealing), and 72 °C for 1 min (extension). The three stages of PCR adjusted at 35 cycles and final extension was 72 °C for 10 min. PCR was carried out in a Flexigenethermocycler. PCR products were analyzed by 1% (w/v) agarose gel electrophoresis in 1X TBE buffer. A DNA fragment (approximately 1.5 kb) was eluted by using Qiagen Gel Extraction Kit. PCR products were sequenced and sequences were matched with previously published bacterial 16S rDNA sequences in the NCBI databases using BLASTn (24).

Biochemical tests such as oxidase, catalase, nitrate reductase, citratase, urease, amylase, gelatinase, tryptophanase, and indole and hydrogen sulfide production (25) were carried out.

Statistical Analysis: The statistical analysis was performed using MSTATC software. The statistical variation in IAA production, potassium release and phosphate solubilization by isolates were analyzed using an analysis of variance (ANOVA). Means were compared using Duncan’s multiple range test at p < 0.01.

Results.

Isolation and Screening of the Endophytic Bacteria: Bacteria were isolated and identified from rhizospheric soil samples as described in Bergey’s Manual of Determinative Bacteriology. For the isolation of endophytic bacteria, NFB semi-solid medium was used. After 24-48 h incubation, white-colored pellicles were appeared in the NFB semi-solid medium. Subsurface pellicles formed 3-20 mm below the surface of the medium (Figure 1). In this study, the appearance of pellicle formation in the NFB semi-solid medium indicated successful isolation of endophytic bacteria. A total number of 24 isolates were isolated from the root samples. The pellicles were transferred into NFB plates via streak culture preparation by a sterile loop. After 48-72 h the colonies with white and merged appearance were observed on the medium. Typical white or pink, often wrinkled colonies were picked out and transferred into CR medium for purification. Light-pink and colorless colonies were observed after 48 h in the RC medium. Colonies were picked from these plates and maintained as pure cultures in respective media with periodic transfer to fresh media and stocked for further use..

Fig. 1- Pellicle formation due to growth of bacterial isolates in the NFB medium. Some bacteria produced pellicles close to the surface and the others were deeper.

Phosphate Solubilization: Phosphate solubilization was significantly (p < 0.01) influenced by bacterial isolates, P sources and, bacteria × phosphorus sources. The results showed a considerable enhancement of phosphate solubilization in the inoculated treatments compared with the control. The soluble-P concentration ranged from 98.13 to 340.13 mg/l with variations among different isolates. All bacterial isolates had higher (9.1 times) P solubility activity in the presence of tri-calcium phosphate compared with rock phosphate (Table 1). The greatest P solubilization was obtained by Az-52 (340.13 mg/l) with TCP that was accompanied by a significant increase (5.5 times) (Figure 2). The lowest value was observed in Az-13 (98.13 mg/l) that showed a 61% increase compared to the control whereas it was in the same statistical group. Other isolates including Az-6, Az-19, Az-50, Az-59, Az-65 and, Az-71 indicated relatively higher abilities in phosphate solubilization with a range of 261-329.38 mg/l (Figure 2).

Fig. 2- Phosphate solubilization by bacterial isolates. Bars with a similar letter are not significantly different at p < 0.01 according to Duncan’s multiple range test.

IAA production: Analysis of variance showed that the effect of bacterial isolates, tryptophan (two levels; 0 and 100 mg/l), and their interaction were significant (P < 0.01) on IAA production. A total of 24 isolates were tested for the quantitative estimation of IAA in the presence and absence of tryptophan. The average production of auxin by bacteria is shown in Figure 3 and Table 1. Results showed that IAA-production by the isolates in the NF medium containing 0 and 100 mg/l of tryptophan varied from 0.75 to 2.28 mg/l. With the increasing of tryptophan from 0 to 100 mg/l, the production of IAA increased. The highest amount of IAA was obtained in C16-2O and Az-3 and the minimum amount of IAA was obtained by Az-48. Moreover, Az-3 caused an increase in IAA production (5 times) as compared to the control. When tryptophan was used as a precursor, the maximal amount of IAA was produced by isolates after 72 h and caused an average increment by 30% when compared with the absence of tryptophan. Statistical analysis showed a significant difference between treatments concerning the presence and absence of tryptophan. Some isolates including Az-12, Az-37, Az-50, Az-63, and Az-73 indicated the ability to produce auxin at a range of 1.52-2.01 mg/l (Figure 3).

Fig. 3- Auxin-production by bacterial isolates in the NF medium. Bars with a similar letter are not significantly different at p < 0.01 according to Duncan’s multiple range test.

K Release: The effect of 24 bacterial isolates on K release from micas was shown in Table 1. The results showed a considerable enhancement of K release by Az-21, Az-59, and Az-65 compared to the control, whereas most bacterial isolates did not show a significant increase in K release (Figure 4).

Fig. 4- K release from micas by bacterial isolates. Bars with a similar letter are not significantly different at p < 0.01 according to Duncan’s multiple range test.

Table 1. P Solubilization, Auxin Production, and K Releasing Ability of Bacterial Isolates

In the presence of biotite, the concentration of potassium in the inoculated treatments was approximately 4.7 times greater than that of muscovite. The total K contents ranged from 4.78 to 6.66 mg/l. The interaction effects of bacterial isolates and the source of potassium showed that all isolates were able to release greater potassium from biotite than muscovite (Table 1). The greatest potassium released was obtained by biotite inoculated with Az-65 (32% higher than control). The lowest increase was achieved by Az-3 which had no significant difference with control.

Siderophore Production: The results showed that none of the isolates were able to form an orange halo on the CAS agar medium indicating no siderophore production ability in all 24 bacterial isolates.

.Identification of Bacterial Isolates: Among the bacterial isolates, those showed great potential in phosphate solubilization (e.g. Az-19, Az-50), IAA production (e.g. Az-3) and K release (e.g. Az-63), were selected for molecular and biochemical identification. The results of Gram staining indicated that all isolates were Gram-negative. In the molecular identification of bacterial isolates, 700-900 nucleotides of the total length of 16SrDNA were used for sequencing. Sequence comparison of the 16S rDNA gene corresponding to the isolates with the sequences in GenBank showed that Az-8, Az-19, and Az-50 belonged to the Pseudomonas, Az-3 to the Acinetobacter, Az-18 to the Rhizobium, Az-48 to the Enterobacter and Az-63 to the Advenella. The result of molecular identification and biochemical tests are illustrated in Table 2.

Table 2. Results of Molecular Identification for the Selected Isolates

Table 3. Results of some Biochemical Tests for the Selected Isolates