جداسازی و شناسایی یک گونه باسیلوس قلیادوست مقاوم به حرارت تولیدکنندۀ پروتئاز از دریاچۀ آب گرم دهلران: بهینه‌سازی تولید و بررسی فعالیت و پایداری دمایی

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 استادیار، گروه زیست‌شناسی، دانشکده علوم پایه، دانشگاه رازی، کرمانشاه، ایران

2 کارشناس ارشد گروه زیست‌شناسی، دانشکده علوم پایه، دانشگاه رازی، کرمانشاه، ایران

چکیده

مقدمه: پروتئازهای ﮔﺮﻣﺎدوﺳﺖ در صنایع مختلف ازجمله شوینده، دارویی، غذایی و ... استفاده می‌شوند و ریزموجودات ﮔﺮﻣﺎدوﺳﺖ ازﺟﻤﻠﻪ ﺑﺎﮐﺘﺮیﻫﺎ آﻧﺰﯾﻢﻫﺎی یادشده را ﺗﻮﻟﯿﺪ ﻣﯽکنند.
مواد و روش‏‏ها: نمونه‌گیری از چشمۀ آب گرم دهلران واقع در استان‌ ایلام در غرب ایران به‌منظور یافتن باکتری‌های جدید تولید‌کنندۀ پروتئاز انجام شد. اثر اسیدیته، دما و درنهایت زمان گرماگذاری بر تولید آنزیم پروتئاز بررسی و سنجیده شد. واکنش زنجیره‌ای پلیمراز (PCR) برای شناسایی مولکولی سویۀ مدنظر انجام شد. آنزیم پروتئاز با کروماتوگرافی تعویض آنیونی DEAE-Sephrose خالص‌سازی شد و وزن مولکولی آن به روش SDS-PAGE تخمین زده شد. فعالیت و پایداری آنزیم در گستره‌های دما و اسیدیته بررسی شد.
نتایج: از میان سویه‌های جداسازی‌شده، باکتری باسیلوس DEM07 (ثبت‌شده در بانک جهانی ژن با شماره دسترسیKY392988) با بیشترین قطر هالۀ پروتئازی برای تولید آلکالین‌پروتئاز گرمادوست انتخاب شد. حداکثر تولید آنزیم آلکالین‌پروتئاز در دمای 50 درجۀ سانتی‌گراد، اسیدیتۀ 7 و پس‌از 48 ساعت کشت مشاهده شد. آنزیم پروتئاز با استفاده از کروماتوگرافی تعویض آنیونی خالص‌سازی شد و وزن مولکولی آن پس‌از خالص‌سازی حدود 5/27 کیلودالتون تخمین زده شد. آنزیم در محدودۀ دمایی 30 تا 55 درجۀ سانتی‌گراد فعال و پایدار بود و دمای بهینۀ فعالیت آن در 50 درجۀ سانتی‌گراد مشاهده شد. گسترۀ اسیدیته برای فعالیت و پایداری آنزیم 4 تا 11 بود و فعالیت بهینۀ آنزیم در اسیدیتۀ 10 مشاهده شد.
بحث و نتیجه‏گیری: آنزیم پروتئاز خالص‌شده از باسیلوس DEM07 در مطالعۀ حاضر پروتئاز قلیادوست مقاوم به حرارت است. ایجاد شرایط بهینه برای دستیابی به تولید زیاد آلکالین‌پروتئاز مقاوم به حرارت پیشنهاد می‌کند این آﻧﺰﯾﻢ قابلیت زﯾﺎدی ﺑﺮای اﺳﺘﻔﺎده در صنایع مختلف دارد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Isolation and Identification of an Alkaliplilic Thermo-tolerant Protease producing Bacillus sp. from Dehloran Hot Spring: Production Optimization and Investigation of the Activity and Stability of the Enzyme

نویسندگان [English]

  • Maryam Mehrabi 1
  • Lale Nazari 2
  • Zhila Rostami 2
1 Assistant professor, Department of Biology, Faculty of sciences, Razi university, Kermanshah, Iran
2 M.Sc., Department of Biology, Faculty of sciences, Razi university, Kermanshah, Iran
چکیده [English]

Introduction:Thermophilic proteases can be used in various industries, including detergents, pharmaceuticals, food, etc. These enzymes are produced by thermophilic microorganisms, includingbacteria.
Materials and methods: Sampling was carried out from Dehloran hot springs in Ilam province in the west of Iran to find new protease producing bacteria. Then, the effect of pH, temperature and finally the effect of different heating time on the production of protease enzyme were evaluated. Then, Polymerase Chain Reaction (PCR) was performed to detect the strain. Protease was purified through anion exchange using DEAE-sepharose column and its molecular weight was estimated using SDS-PAGE technique. Then, activity and stability of the enzyme were investigated in temperature and pH range.
Results: Among isolated strains, bacteria Bacillus sp. DEM07 (registered in the World Gene Bank with access number KY392988) with the highest diameter of the protease clear zone, was selected to produce thermo tolerant alkaline protease. The maximum production of the alkaline protease enzyme was observed at 50 ° C, pH 7 and 48 hours after culture. The protease enzyme was purified by anionic chromatography and its molecular weight was estimated to be about 27.5 kDa after purification. The enzyme was active and stable at the temperature range of 30 to 55 ° C and the optimum temperature of the enzyme activity was observed at 50 ° C. The pH range for activity and its stability was from 4 to 11, and the optimum activity of the enzyme was observed at pH 10.
Discussion and conclusion: In this study, the protease enzyme purified from Bacillus sp. DEM07 is a thermo tolerant alkalophilic protease. On the other hand, by creating the optimal conditions for achieving high production of thermo-tolerant alkalophilic protease, this enzyme has a high potential for use in various industries.

کلیدواژه‌ها [English]

  • Protease
  • Hot spring
  • Optimization
  • Bacillus

مقدمه.

ریزموجودات ﮔﺮﻣﺎدوﺳﺖ ﻣﻮﺟﻮداﺗﯽ ﻫﺴﺘﻨﺪ ﮐﻪ ﺑﺎ رﺷﺪ ﺑﻬﯿﻨﻪ در دﻣﺎﻫﺎی زیاد ﺳﺎزﮔﺎر هستند و از ﻣﮑﺎنﻫﺎی درﯾﺎﯾﯽ و ﺧﺎﮐﯽ دارای درجهﺣﺮارت زیاد ﺟﺪا می‌شوند؛ ﭼﺸﻤﻪﻫﺎی آب ﮔﺮم و ﺑﯿﺎﺑﺎنﻫﺎ راﯾﺞﺗﺮﯾﻦ اﯾﻦ ﻣﮑﺎنﻫﺎ هستند (1). چشمه‌های آب گرم (یکی از زیستگاه‌های ریزموجودات گرمادوست) منبعی برای جداسازی مستقیم آنزیم مقاوم به حرارت در نظر می‌شوند (2). آﻧﺰﯾﻢﻫﺎی مقاوم به حرارت ازنظر کاربردی دارای مزیت‌هایی مانند ﭘﺎﯾﺪاری زﯾﺎد در برابر حلال‌های آلی، اسیدیتهﻫﺎی بهﺷﺪت ﻗﻠﯿﺎﯾﯽ و اﺳﯿﺪی و ﻣﻮاد شوینده هستند (3). امروزه آنزیم‌های میکروبی کاربردهای فراوانی در صنایع مختلف دارند. پروتئازها از تجاری‌ترین گروه‌های آنزیم‌های میکروبی خارج سلولی هستند که کاربردهای گسترده‌ای در صنایع مواد شوینده، غذا، داروسازی، شیمیایی و چرم دارند. پروتئازها در میان آنزیم‌های صنعتی 60 درصد کل فروش آنزیم‌ها در سراسر جهان و آلکالین‌پروتئازها 89 درصد کل فروش پروتئازها را شامل می‌شوند (4). طیف وسیعی از موجودات زنده شامل باکتری‌ها، قارچ‌ها، مخمرها و پستانداران آلکالین‌پروتئازها را تولید می‌کنند. گونه‌های باسیلوس توانایی ترشح مقدار زیادی آلکالین‌پروتئاز را ازنظر صنعتی دارند (5). آلکالین‌پروتئازهای باکتریایی با فعالیت زیاد خود در اسیدیته‌های قلیایی (برای نمونه اسیدیتۀ 10) و ویژگی‌های پیش‌ماده‌ای گسترده شناخته می‌شوند. دمای بهینۀ فعالیت این آنزیم‌ها حدود 60 درجۀ سانتی‌گراد است؛ این ویژگی آلکالین‌پروتئازهای باکتریایی را برای استفاده در صنعت شوینده‌ها مناسب می‌کند (6)؛ ازاین‌رو، اگرچه پروتئازها در طبیعت بسیار گسترده هستند میکروب‌ها به‌علت رشد سریع، فضای محدود لازم برای کشت و دستکاری ژنتیکی آسان برای تولید آنزیم‌های جدید به‌عنوان منبع ترجیحی برای تولید آنزیم‌ها مطرح و برای کاربردهای مختلف مطلوب هستند (7). تنوع گستردۀ پروتئازها به همراه ویژگی‌های این آنزیم‌ها سبب شده است این آنزیم‌ها در زمینۀ زیست‌فناوری و فیزیولوژیک درخور توجه بسیار در سراسر جهان باشند (8). در ﺳﺎلﻫﺎی اﺧﯿﺮ با‌توجه‌به اهمیت صنعتی پروتئازها، ﺟﺪاﺳﺎزی ﺳﻮﯾﻪﻫﺎی ﺑﺎﮐﺘﺮﯾﺎﯾﯽ ﺟﺪﯾﺪ ﺑﺎ وﯾﮋﮔﯽﻫﺎی ﻣﻄﻠﻮب اهمیت بسیاری یافته اﺳﺖ. در ﻣﻘﺎﯾﺴﻪ ﺑﺎ ریزموجودات ﻣﺰوﻓﯿﻞ و ﺣﺘﯽ ﺳﺮﻣﺎدوﺳﺖ، مطالعه‌های ﮐﻤﺘﺮی در زمینۀ ﺟﺪاﺳﺎزی و ﻏﺮﺑﺎل‌گری ﺳﻮﯾﻪﻫﺎی ﮔﺮﻣﺎدوﺳﺖ، ﻣﺤﯿﻂ رﺷﺪ آنها و ﺑﻬﯿﻨﻪﺳﺎزی ﺗﻮﻟﯿﺪ آﻧﺰﯾﻢ آنها انجام شده اﺳﺖ (9). در بررسی حاضر سویۀ ﺑﺎﮐﺘﺮﯾﺎﯾﯽ ﮔﺮﻣﺎدوﺳﺖ از چشمۀ آب ﮔﺮم اﺳﺘﺎن ایلام جدا شد و ﭘﺲ‌از ﺗﻌﻴﻴﻦ ﻫﻮﻳﺖ، ﺑﻬﻴﻨﻪ‌ﺳﺎزی ﺷﺮاﻳﻂ ﺗﻮﻟﻴﺪ آن و تخلیص پروتئاز ﺑﺮرﺳﻲ شد.

 

مواد و روش‌ها.

نمونه‌برداری: ریزموجودات استفاده‌شده در پژوهش حاضر از چشمۀ آب گرم دهلران واقع در استان ایلام (مختصات جغرافیایی 32°42'33.8"N 47°18'22.6"E) که در سه کیلومتری شهرستان دهلران، در دامنۀ کوه سیاه‌کوه و نزدیک به غار خفاش قرار دارد و از شش محل متفاوت جمع‌آوری شدند. نمونه‌ها در فلاسک‌های حاوی یخ به آزمایشگاه منتقل و در نسبت‌های 10/1، 100/1 و 1000/1 با آب مقطر استریل رقیق شدند؛ سپس در ارلن‌های حاوی محیط‌کشت نوترینت‌براث و درون انکوباتور با دمای 45 درجۀ سانتی‌گراد و در rpm100 غنی‌سازی شدند. 100 میکرولیتر از کشت‌ها روی پلیت‌های حاوی محیط‌کشت اسکیم‌میلک‌آگار[1] کشت شد و پلیت‌ها به‌مدت 48 ساعت در انکوباتور با دمای 45 درجۀ سانتی‌گراد گرماگذاری[2] شدند. درنهایت، ریزموجودی که بزرگ‌ترین هاله را در اطراف خود ایجاد کرده بود برای مطالعه‌های بیشتر انتخاب و استوک‌هایی از آن در دمای منفی 20 درجۀ سانتی‌گراد نگهداری شد.

ﺟﺪاﺳﺎزی و ﻏﺮﺑﺎلﮔﺮی ﺳﻮﯾﻪﻫﺎی ﺑﺎﮐﺘﺮﯾﺎﯾﯽ ﻣﻮﻟﺪ پروتئاز: ﺑﻪﻣﻨﻈﻮر ﺟﺪاﺳﺎزی ﺳﻮﯾﻪﻫﺎی ﺑﺎﮐﺘﺮﯾﺎﯾﯽ دارای ﺗﻮاﻧﺎﯾﯽ تولید پروتئاز، 1 ﻣﯿﻠﯽﻟﯿﺘﺮ از ﻧﻤﻮﻧﻪﻫﺎی ﺟﻤﻊآوری‌ﺷﺪه ﭘﺲاز رﻗﯿﻖﺳﺎزی ﻣﺘﻮاﻟﯽ ﺑﻪ ﻣﺤﯿﻂﻫﺎی اسکیم‌میلک‌آگار حاوی آگار-آگار[3] (20 گرم‌درلیتر)، تریپتون[4] (8 گرم‌درلیتر) و عصارۀ مخمر[5] (10 گرم‌درلیتر) ﺗﻠﻘﯿﺢ شد و ﻣﺤﯿﻂﻫﺎ 24 تا 48 ﺳﺎﻋﺖ در اﻧﮑﻮﺑﺎﺗﻮر ﺑﺎ دﻣﺎی 45 درجۀ ﺳﺎﻧﺘﯽﮔﺮاد ﻗﺮار داده ﺷﺪﻧﺪ. پس‌از اﯾﻦ ﻣﺪت، ﺗﻌﺪادی از ﮐﻠﻨﯽﻫﺎی رﺷﺪﯾﺎﻓﺘﻪ روی اﯾﻦ ﻣﺤﯿﻂﻫﺎ اﻧﺘﺨﺎب و دوباره روی ﻣﺤﯿﻂ اسکیم‌میلک‌آﮔﺎر ﮐﺸﺖ ﺷﺪﻧﺪ و 48 ﺳﺎﻋﺖ در دمای 45 درجۀ ﺳﺎﻧﺘﯽﮔﺮاد اﻧﮑﻮﺑﻪ ﺷﺪﻧﺪ؛ درنهایت، ﮐﻠﻨﯽﻫﺎی دارای هالۀ ﺷﻔﺎف به‌منزلۀ سویۀ مولد پروتئاز شناخته شدند. ﺳﻮیۀDEM07 از ﺑﯿﻦ کلنی‌های ﺟﺪاﺷﺪه ﺑﺮ اﺳﺎس ﻗﻄﺮ ﻫﺎلۀ ﻧﺎﺷﯽ از ﻫﯿﺪروﻟﯿﺰ اسکیم‌میلک ﺳﻮیۀ ﺑﺮﺗﺮ اﻧﺘﺨﺎب و برای مطالعه‌های آﻧﺰﯾﻤﯽ اﺳﺘﻔﺎده ﺷﺪ.

ﺷﻨﺎﺳﺎﯾﯽ ﺳﻮیۀ ﺑﺎﮐﺘﺮﯾﺎﯾﯽ ﺟﺪاﺷﺪه: ﺑﻪﻣﻨﻈﻮر ﺷﻨﺎﺳﺎﯾﯽ ﻧﺴﺒﯽ ﺳﻮﯾﻪﻫﺎی ﺟﺪاﺷﺪه، ﺗﻌﺪادی از آزﻣﻮنﻫﺎی ﺑﯿﻮﺷﯿﻤﯿﺎﯾﯽ- ﻣﯿﮑﺮوﺑﯽ ازﺟﻤﻠﻪ رﻧﮓآﻣﯿﺰی ﮔﺮم[6]، آزﻣﻮن ﮐﺎﺗﺎﻻز، آزﻣﻮن حساسیت به پنی‌سیلین[7] و سدیم‌آزید بر اساس کتاب ﺳﯿﺴﺘﻤﺎﺗﯿﮏ ﺑﺎﮐﺘﺮیﺷﻨﺎﺳﯽ ﺑﺮﮔﯽ[8] اﻧﺠﺎم شدند (10). ﺷﻨﺎﺳﺎﯾﯽ ﻣﻮﻟﮑﻮﻟﯽ ﺑﺎﮐﺘﺮی ﺑﺎ ﺗﮑﺜﯿﺮ ﻗﺴﻤﺘﯽ از ژن 16S rRNA توسط آغازگرهای[9] (5′AGAGTTTGATCCTGGCTCAG­3′) و (5′AAGGAGGTGGATCCAGCCGCA 3′) انجام شد. واکنش زنجیره‌ای پلیمراز[10] (PCR) در حجم نهایی 150 میکرولیتر مطابق جدول 1 با برنامۀ زیر انجام شد:

1. دمای اولیۀ 94 درجۀ سانتی‌گراد به‌مدت 5 دقیقه برای تک‌رشته‌ای‌شدن کلی و اولیه؛

2. دمای 94 درجۀ سانتی‌گراد به‌مدت 45 ثانیه برای تک‌رشته‌ای‌شدن کلی؛

3. دمای 58 درجۀ سانتی‌گراد به‌مدت 30 ثانیه برای اتصال آغازگر؛

4. دمای 72 درجۀ سانتی‌گراد به‌مدت 45 ثانیه برای سنتز DNA؛

5. تکرار از مرحلۀ شمارۀ 2 برای 35 دوره؛

6. دمای 72 درجۀ سانتی‌گراد به‌مدت 5 دقیقه برای تکمیل سنتز DNA.

محصول PCR پس‌از اﻟﮑﺘﺮوﻓﻮرز روی ژل آﮔﺎرز 1 درﺻﺪ ﺑﺎ اﺳﺘﻔﺎده از ﮐﯿﺖ اﺳﺘﺨﺮاج DNA خالص‌سازی شد (11). سپس توالی DNA با استفاده از توالی‌یاب DNA شرکت Bioneer واﻗﻊ در ﮐﺮۀ ﺟﻨﻮﺑﯽ ﺗﻌﯿﯿﻦ شد. ﺷﺒﺎﻫﺖ ﺗﻮاﻟﯽ ﻧﻮﮐﻠﺌﻮﺗﯿﺪﻫﺎی ژن 16S rRNA ﺳﻮیۀ هیدرولیز‌کننده به کمک نرم‌افزار BLAST ﺑﺎ ﺗﻮاﻟﯽﻫﺎی ﺛﺒﺖﺷﺪه در ﭘﺎﯾﮕﺎه اﻃﻼﻋﺎﺗﯽ ژﻧﻮم Gene Bank مقایسه شد؛ به‌این‌ترتیب ﻧﺰدﯾﮏﺗﺮﯾﻦ ﺳﻮﯾﻪﻫﺎ به ﺗﺮادف 16S rRNA سویۀ هیدرولیز‌کننده تعیین شدند. ﺗﻮاﻟﯽ ﺑﻪدﺳﺖآﻣﺪه در ﭘﮋوﻫﺶ حاضر در ﺑﺎﻧﮏ ژﻧﯽ NCBI ﺛﺒﺖ و ﺷﻤﺎرۀ دﺳﺘﯿﺎﺑﯽ ژﻧﯽ آن (KY392988) دریافت شد. درﺧﺖ ﻓﯿﻠﻮژﻧﯽ ﺑﺎ مقایسۀ ﺗﻮاﻟﯽ 16S rRNA سویه با توالی سایر سویه‌های باسیلوس ﺣﺎﺻﻞ از ﺟﺴﺖوﺟﻮ در ﭘﺎﯾﮕﺎه اﻃﻼﻋﺎﺗﯽ Gene Bank به کمک نرم‌افزار Mega6 به روش neighbor joining ترسیم شد (12).

جدول 1- غلظت و حجم‌های بهینه‌شدۀ واکنشگرهای PCR ژن 16S rRNAدرحجم نهایی 150 میکرولیتر.

حجم (میکرولیتر)

غلظت

ماده

غلظت نهایی

8/94

-

ddH2O

-

15

X10

PCR buffer

X1

2/4

(mM)50

MgCl2

mM4/1

3

(mM)10

dNTP

mM2/0

6

(pmol/µl)10

forward primer

μM 4/0

6

(pmol/µl)10

Reverse primer

μM 4/0

3

(ng)20

DNA template

-

3

(U/µl)5

Taq polymerase

U/μl1/0

150

-

Total

-

 

بهینه‌سازی محیط تولید.

اثر دما، اسیدیته و زمان: اثر دما بر رشد باکتری و تولید آلکالین‌پروتئاز سویۀ منتخب در دماهای مختلف رشد (30 تا 60 درجۀ سانتی‌گراد) در حالتی بررسی شد که دیگر شاخص‌ها ثابت بودند. بهمنظور بررسی اثر اسیدیتۀ اولیه بر رشد و تولید پروتئاز سویۀ منتخب، محیط تولید با اسیدیته‌های بین 3 تا 9 تهیه شد و رشد در دمای بهینه انجام و فعالیت آنزیمی سنجیده شد؛ به‌علاوه اثر زمان طی تخمیر بر رشد و تولید پروتئاز با گرماگذاری محیط‌کشت در شیکر ‌انکوباتور و در زمان‌های مختلف (6 تا 96 ساعت پس‌از کشت) مطالعه شد.

سنجش فعالیت پروتئازی نمونه: فعالیت آلکالین‌پروتئاز با استفاده از روش‌های گزارش‌شدۀ قبلی با مقداری تغییر اندازه‌گیری شد (13). برای سنجش فعالیت پروتئازی نمونه‌ها، 500 میکرولیتر محلول کازئین[11] 75/0 درصد (پیش‌ماده) به 200 میکرولیتر محلول آنزیمی افزوده و به‌مدت 10 دقیقه در دمای 37 درجۀ سانتی‌گراد و شرایط قلیایی (اسیدیتۀ 8) گرماگذاری شد. به‌منظور توقف واکنش آنزیمی، 500 میکرولیتر محلول تری‌کلرو‌استیک‌اسید 10 درصد به ظرف واکنش افزوده شد و به‌مدت 30 دقیقه در دمای 50 درجۀ سانتی‌گراد گرماگذاری شد. نمونه به‌مدت 5 دقیقه در rpm[12] 10000 سانتریفوژ شد و سپس 200 میکرولیتر از محلول رویی آن برداشته و 500 میکرولیتر سدیم‌کربنات 500 میلی‌مولارو 100 میکرولیتر محلول رنگی فولین‌سیوکالتو[13] به آن اضافه شد و به‌مدت 30 دقیقه در دمای 37 درجۀ سانتی‌گراد گرماگذاری شد. جذب نمونه‌ها در طول موج 660 نانومتر خوانده شد. طبق تعریف، یک واحد[14]آنزیم مقدار آنزیمی است که قادر به هیدرولیز کازئین و تولید رنگی معادل 1 میکرومول تیروزین آزادشده به ازای 1 دقیقه در اسیدیتۀ 8 و دمای 37 درجۀ سانتی‌گراد است.

ﻣﺤﯿﻂ ﺗﻮﻟﯿﺪ و تخلیص نسبی آنزیم پروتئاز: ابتدا یک لوپ از سویۀ بهینه‌شده که روی محیط نوترینت‌آگار رشد کرده بود برداشته و به محیط مایع پیش‌کشت[15] منتقل شد؛ سپس به‌مدت 24 ساعت در انکوباتور شیکردار با چرخش دورانی و دمای 45 درجۀ سانتی‌گراد و دور rpm120 قرار داده شد. پس‌از تکثیر باکتری در محیط پیش‌کشت، 5 تا 10 درصد حجم محیط تولید[16] در شرایط استریل از محیط پیش‌‌کشت به محیط تولید منتقل شد. به‌منظور تولید آنزیم پروتئاز محیط‌های تولید به‌مدت 48 ساعت در انکوباتور شیکردار با شیک دورانی و دمای 45 درجۀ سانتی‌گراد و دور rpm120 قرار داده شدند.

ﺑﺮای ﺟﺪاﺳﺎزی پروتئین‌ها از ﺳﻮپ روﻳﻲ ﺗﻐﻠﻴﻆ با نمک آمونیوم‌سولفات[17] 85 درصد انجام شد و سپس نمونه ﺑﻪ‌ﻣﺪت ﻳﻚ ﺷﺐ در دﻣﺎی 4 درجۀ سانتی‌گراد ﻗﺮار داده شد ﺗﺎ ﭘﺮوتئین‌ها ﻛﺎﻣﻼً رسوب ﻛﻨﻨﺪ. پس‌‌از سانتریفیوژ در دﻣﺎی 4 درجۀ سانتی‌گراد، رﺳﻮب ﺟﺪا و در ﺑﺎﻓﺮ ﺣﻞ ﺷﺪ. برای ﺟﺪاﺳﺎزی ﻧﻤﻚ آﻣﻮﻧﻴﻮم‌ﺳﻮﻟﻔﺎت از پروتئین‌ها دﻳﺎﻟﻴﺰ[18] در ﺑﺎﻓﺮ ﺗﺮﻳﺲ (اسیدیتۀ 8) انجام شد. ﻣﺤﻠﻮل دﻳﺎﻟﻴﺰﺷﺪه از ﺳﺘﻮن کروماتوگرافی تعویض آنیونی DEAE- سفارز عبور داده شد. ﻓﺮکشن‌های ﻛﺮوﻣﺎﺗﻮﮔﺮاﻓﻲ ﺟﻤﻊ‌آوری شدند ‌و ﻓﻌﺎﻟﻴﺖ آﻧﺰﻳﻤﻲ آﻧﻬﺎ ﺑﺮرﺳﻲ ﺷﺪ. فرکشن حاوی ﺑﻴﺸﺘﺮﻳﻦ ﻣﻴﺰان آﻧﺰﻳﻢ در مطالعه‌های بعدی بررسی شد.

زاﻳﻤﻮﮔﺮاﻓﻲ: زاﻳﻤﻮﮔﺮاﻓﻲ روشی ﻣﺒﺘﻨﻲ ﺑﺮ اﻟﻜﺘﺮوﻓﻮرز ﺑﺮای آنزیم‌های ﻫﻴﺪروﻟﻴﺰ‌کننده اﺳﺖ. ﻣﻴﺰان ﺧﻠﻮص ﭘﺮوﺗﺌﺎز به روش SDS-[19]PAGE اﻧﺪازه‌ﮔﻴﺮی شد. پس‌از اتمام الکتروفورز ژل به‌طور متوالی با محلول‌های زیر شستشو شد:

1. به‌منظور خارج‌سازی SDS، ژل به‌مدت 1 ساعت در دمای 4 درجۀ سانتی‌گراد درون محلول 5/2 درصد تریتون X-100 (V/V) در آب مقطر قرار داده شد و طی این زمان 3 بار محلول تریتون تعویض شد؛

2. ژل با آب مقطر شسته شد و برای حذف تریتون X-100 به‌مدت 30 دقیقه در دمای 4 درجه سانتی‌گراد درون بافر تریس 100 میلی‌مولار (اسیدیتۀ 6/7) قرار داده شد و طی این مدت 3 بار بافر تعویض شد؛

3. ژل با آب مقطر شسته و درون بافر شامل پیش‌مادۀ کازئین 2 درصد، تریس 100 میلی‌مولار و کلرید‌کلسیم 4 میلی‌مولار (اسیدیتۀ 6/7) به‌مدت 24 ساعت در دمای 37 درجۀ سانتی‌گراد گرماگذاری شد. آنزیم در این بافر فعال می‌شود؛

4. پس‌از گرماگذاری، ژل به‌مدت 1 ساعت در محلول رنگ کوماسی برلیان آبی R-250 رنگ‌آمیزی شد و در مرحلۀ آخر به‌منظور ظهور باندهای شفاف حاصل از فعالیت آنزیم از محلول رنگ‌بر استفاده شد.

بررسی اثر اسیدیته و دما بر فعالیت و پایداری آنزیم: یکی از مهم‌ترین ویژگی‌های آنزیم‌ها به‌ویژه آنزیم‌های صنعتی فعالیت و پایداری آنها در محدودۀ گسترده‌ای از اسیدیته به‌ویژه اسیدیته‌های قلیایی است (14). اثر اسیدیته بر فعالیت و پایداری آنزیم در اسیدیته‌های مختلف 4 تا 11 اندازه‌گیری شد. بافرهای استفاده‌شده برای اسیدیته‌های مختلف شامل ﮔﻼﻳﺴﻴﻦ (اسیدیته‌های 9 تا 11)، تریس (اسیدیته‌های 8 و 9)، سدیم‌فسفات (اسیدیته‌های 6 و 7)، ﺳﺪﻳﻢ‌اﺳﺘﺎت (اسیدیته‌های 4 تا 6) بودند. اثر دما ﺑﺮ فعالیت آﻧﺰﻳﻢ ﭘﺮوﺗﺌﺎز با اﻧﺪازه‌ﮔﻴﺮی ﻓﻌﺎﻟﻴﺖ و ﭘﺎﻳﺪاری آﻧﺰﻳﻢ در بافری با اسیدیتۀ بهینۀ فعالیت آنزیم و در ﻣﺤﺪودۀ دﻣﺎﻳﻲ 20 تا 90 درجۀ سانتی‌گراد بررسی شد.

 

نتایج.

ﻏﺮﺑﺎلﮔﺮی و ﺷﻨﺎﺳﺎﯾﯽ ﺳﻮﯾﻪﻫﺎی ﺑﺎﮐﺘﺮﯾﺎﯾﯽ ﻣﻮﻟﺪ پروتئاز:به‌منظور ﻏﺮﺑﺎل‌گری ﺑﺎﮐﺘﺮی ﻣﻮﻟﺪ پروتئاز ﮔﺮﻣﺎدوﺳﺖ، کلنی‌ها روی ﻣﺤﯿﻂ اسکیم‌میلک‌آگار کشت شدند و هالۀ شفاف (نشان‌دهندۀ ﻓﻌﺎﻟﻴﺖ ﭘﺮوﺗﺌﻮﻟﻴﺘﻴﻚ) اﻃﺮاف برخی ﮐﻠﻨﯽ‌های ﺑﺎﮐﺘﺮیایی تشکیل شد (ﺷﮑﻞ 1). بزرگ‌ترین هالۀ روشن در بین جدایه‌های آزمایش‌شده اطراف جدایۀ شمارۀ 7 مشاهده شد که نشان‌دهندۀ ﺗﻮاﻧﺎﯾﯽ ﺗﻮﻟﯿﺪ بیشینۀ آﻧﺰﯾﻢ پروتئاز است. ﺑﺮﺧﯽ آزﻣﻮنﻫﺎی ﺑﯿﻮﺷﯿﻤﯿﺎﯾﯽ ﺑﻪﻣﻨﻈﻮر ﺷﻨﺎﺳﺎﯾﯽ اﺑﺘﺪاﯾﯽ ﺳﻮﯾﻪﻫﺎی ﺑﺎﮐﺘﺮﯾﺎﯾﯽ ﻣﻮﻟﺪ پروتئاز اﻧﺠﺎم شدند و ﻣﺸﺎﻫﺪه ﺷﺪ سویۀ ﺑﺎﮐﺘﺮﯾﺎﯾﯽ ﺟﺪاﺷﺪه ﮔﺮم ﻣﺜﺒﺖ، دارای شکل ﺑﺎﺳﯿﻞ، کاتالاز مثبت و حساس به آنتی‌بیوتیک پنی‌سیلین و سدیم‌آزید است ﺗﻮاﻟﯽ ژن 16S rRNA اﯾﻦ ﺳﻮﯾﮥ ﺑﺎﮐﺘﺮﯾﺎﯾﯽ ﺑﺎ ﮔﻮﻧﻪﻫﺎی ﻧﺰدﯾﮏ موجود در NCBI مقایسه شد. نتایج ﺗﻄﺒﯿﻖ ﺗﻮاﻟﯽ و درﺧﺖ ﻓﯿﻠﻮژنی ﻧﺸﺎن دادند ﮔﻮنۀ یادشده ﺑﻪ Bacillus licheniformisنزدیک است (شکل 2). توالی ﻧﻮﮐﻠﺌﻮﺗﯿﺪی اراﺋﻪ‌ﺷﺪه در ﺑﺎﻧﮏ ژنی NCBI با شماره دسترسی KY392988 ثبت شد.

 

 

شکل 1- تأیید فعالیت پروتئازی سویۀ باسیلوس DEM07. هالۀ روشن اطراف جدایه روی محیط اسکیم‌میلک‌آگار نشان‌دهندۀ تولید پروتئاز خارج سلولی در این سویه است.

 

 

شکل 2- درخت فیلوژنی سویۀ باسیلوسDEM07 جداشده از چشمۀآب گرم دهلران. درخت بر اساس روش neighbor-joining رسم شده است و مقیاس‌ها بر اساس درصدی از 1000 تکرار بیان شده‌اند.

 


بهینه‌سازی تولید آلکالین‌پروتئاز: تولید اندک آنزیم‌ها و متابولیت‌ها در اکسترموفیل‌ها یکی از مشکلات اصلی تولید صنعتی آنهاست (15). مشخص شده است ﺗﻮﻟﯿﺪ آنزیم و رشد ﻣﯿﮑﺮوﺑﯽ ﺑﻪ ﻣﯿﺰان زﯾﺎدی ﺗﺤﺖ‌ﺗﺄﺛﯿﺮ ﺗﺮﮐﯿﺒﺎت محیط‌کشت از‌جمله منابع کربن، نیتروژن و حضور قندها، یون‌ها و مواد معدنی و همچنین عوامل فیزیکی مانند میزان هوادهی، دمای گرماگذاری، اسیدیته و زمان گرماگذاری قرار دارد (9)؛ باوجوداین، بهینه‌سازی شرایط محیط‌کشت برای تولید مقادیر زیاد آنزیم اقدام ارزشمندی است که بازدهی تولید آنزیم را به‌مراتب افزایش می‌دهد.

 

.ﺑﺮرﺳﯽ ﺗﻮﻟﯿﺪ بهینۀ آﻧﺰﯾﻢ پروتئاز در ﺣﻀﻮر ﻣﺘﻐﯿﺮﻫﺎی ﻣﺨﺘﻠﻒ

اثر دمای گرماگذاری، اسیدیتۀ محیط و زمان هوادهی: دمای رشد، اسیدیتۀ محیط و هوادهی شاخص‌هایی حیاتی هستند که بر رشد باکتری و تولید آنزیم مؤثرند (16 و 17). دﻣﺎ ازﺟﻤﻠﻪ ﻣﻬﻢﺗﺮﯾﻦ ﻋﻮاﻣﻞ اﺛﺮﮔﺬار ﺑﺮ ﺳﺎﺧﺘﺎر ذاﺗﯽ آﻧﺰﯾﻢ اﺳﺖ. ازآنجاﮐﻪ بیشتر ﻓﺮاﯾﻨﺪﻫﺎی ﺻﻨﻌﺘﯽ در دﻣﺎﻫﺎی زیاد اﻧﺠﺎم می‌شوند ﯾﺎﻓﺘﻦ آﻧﺰﯾﻢﻫﺎﯾﯽ ﮐﻪ در دﻣﺎﻫﺎی زیاد ﺳﺎﺧﺘﺎر ﺧﻮد را ﺣﻔﻆ ﮐﻨﻨﺪ و ﻓﻌﺎل بماﻧﻨﺪ اﻫﻤﯿﺖ بسیاری دارد؛ ازاین‌رو، رشد سلولی و تولید آلکالین‌پروتئاز توسط سویۀ DEM07 در دماهای رشد مختلف (30 تا 60 درجۀ سانتی‌گراد) بررسی شد. دمای بهینه برای تولید آلکالین‌پروتئاز و همچنین رشد باکتری 50 درجۀ سانتی‌گراد تعیین شد (شکل 3) و در دماهای بیشتر کاهش شدیدی در تولید آنزیم مشاهده شد. تولید آنزیم در دمای 55 درجۀ سانتی‌گراد ادامه داشت اما تولید آن در دمای 60 درجۀ سانتی‌گراد به صفر رسید که نشان می‌دهد سویۀ آزمایش‌شده موجودی گرمادوست است. باکتری در دماهای 55 و 60 درجۀ سانتی‌گراد رشد اندکی داشت و با تعداد اندک باکتری در محیط‌کشت، تولید آنزیم بسیار کم شد. تأثیر دما بر تولید آنزیم به رشد موجود بستگی دارد.

 

شکل3- اثر دمای محیط بر تولید پروتئاز و رشد باکتری

در میان شاخص‌های فیزیکی مؤثر بر تولید آنزیم، اسیدیته با القای تغییرات ریخت‌شناختی در موجود و تأثیر بر ترشح آنزیم نقش عمده‌ای را ایفا می‌کند. تغییر اسیدیته طی رشد موجود بر پایداری محصولات تولیدشده تأثیر می‌گذارد (18). در باکتری آزمایش‌شده (باسیلوس DEM07) بیشترین تولید پروتئاز در اسیدیتۀ 7 اتفاق افتاد و میزان تولید آنزیم در اسیدیته‌های بیشتر و کمتر کاهش یافت (شکل 4). این اسیدیته نزدیک به اسیدیتۀ چشمه‌ای بود که باکتری از آن جدا شده بود. احتمالاً در این اسیدیته، پروتئاز تولیدشده پایداری زیادی دارد و یا رشد باکتری مناسب‌تر است.

 

 

شکل 4- اثر اسیدیتۀ محیط بر تولید پروتئاز و رشد باکتری

 

هنگام کشت باکتری‌ها، تعداد باکتری‌ها با گذشت زمان افزایش می‌یابد و ازآنجاکه تولید پروتئاز با تعداد باکتری‌های تولید‌کننده متناسب است تولید پروتئاز هم افزایش می‌یابد. در بسیاری از باکتری‌ها تولید آنزیم در مرحلۀ نمایی رشد باکتری آغاز می‌شود و در مرحلۀ پایا[20] به بیشینۀ خود می‌رسد. پس‌از این مرحله سطح آنزیم کاهش می‌یابد که به‌علت پاره‌شدن باکتری‌ها و یا تغییرات شدید اسیدیتۀ محیط است (19 و 20)؛ باوجوداین تولید آنزیم در برخی از باکتری‌ها تا مرحلۀ مرگ ادامه دارد (21).

همان‌طور که در شکل 5 دیده می‌شود تولید آلکالین‌پروتئاز توسط سویۀ DEM07 طی 96 ساعت کشت در شرایط بهینه بررسی شد. این یافته‌ها در زمینۀ تولید آنزیم طی فاز پایا نقش غالب پروتئازهای خارج سلولی در حفظ و نگهداری اکولوژیکی، متابولیسم و بقای این ریزوجود را به‌وضوح نشان می‌دهند (15 و 22). هماهنگ‌بودن ترشح پروتئاز با الگوی رشد نشان می‌دهد حداکثر تولید آنزیم در مرحلۀ پایا اتفاق می‌افتد.

 

 

شکل 5- تولید پروتئاز در طول رشد در محیط کشت

 

هر‌چه متغیر‌های بیشتری در تولید آنزیم بررسی و بهینه شوند بازدهی تولید آنزیم بیشتر می‌شود. سه متغیر زمان برداشت، اسیدیتۀ محیط‌کشت و دمای محیط بررسی شدند و مقادیر بهینه برای تولید آنزیم به دست آمد. تولید آنزیم با بهینه‌سازی شرایط محیط‌کشت افزایش محسوسی نسبت به شرایط پیش‌از بهینه‌سازی نشان داد؛ ازاین‌رو برای تولید پروتئاز در مقادیر زیاد، اسیدیتۀ محیط تولید به 7 رسانده ‌شد، مدت زمان کشت در محیط تولید 48 ساعت انتخاب شد و محیط در دمای 50 درجۀ سانتی‌گراد قرار داده شد.

خالص‌سازی آلکالین‌پروتئاز: خالص‌سازی پروتئین‌ها شامل مراحل متعددی است که در بخش مواد و روش‌ها توضیح داده شد.کروماتوگرافی تعویض یون برای خالص‌سازی پروتئین‌های ناشناخته یکی از روش‌هایی است که بیشتر استفاده می‌شود.پس‌از آنکه ستون با بافر تریس 20 میلی‌مولار به تعادل رسید محتویات کیسۀ دیالیز روی ستون DEAE بارگیری شد.ﺳﺘﻮن دارای ﺑﺎر ﻣﺜﺒﺖ بود ﭘﺲ اﺑﺘﺪا ﭘﺮوتئین‌های ﻣﺘﺼﻞ‌ﻧﺸﺪه جمع‌آوری ﺷﺪﻧﺪ. ﺑﺎ اﻋﻤﺎل ﺷﻴﺐ ﻏﻠﻈﺖ ﻧﻤﻜﻲ 1 مولار (صفر تا 100 درصد) ﭘﺮوتئین‌های ﻣﺘﺼﻞ‌ﺷﺪه ﻛﻪ بار ﻣﻨﻔﻲ داﺷﺘﻨﺪ ﺟﺪا ﺷﺪﻧﺪ؛هم‌زمان، جذب فرکشن‌‌ها در طول موج280 نانومتر با دستگاه اسپکتروفتومتر خوانده شد و فرکشن‌‌های ﺣﺎوی ﭘﺮوﺗﺌﻴﻦ ﻣﺸﺨﺺ شدند (شکل 6).

نتایج الکتروفورز این کروماتوگرافی نشان می‌دهند باند حدود 5/27 کیلودالتونی به قله مربوط است و درنتیجه پروتئاز به باکتری باسیلوس DEM07 دارای وزن مولکولی 5/27 کیلودالتون تعلق دارد. ﻓﻌﺎﻟﻴﺖ ﭘﺮوﺗﺌﻮﻟﻴﺘﻴﻜﻲ آﻧﺰﻳﻢ به روش زاﻳﻤﻮﮔﺮاﻓﻲ ﻧﻴﺰ ﺑﺮرﺳﻲ ﺷﺪ (شکل 7).

 

 

شکل 6- کروماتوگرام مربوط به کروماتوگرافی تعویض آنیونی DEAE- سفارز

 

 



1              2             3              4          5              6        

KDa

 

 

66

 

28

 

18

 

14

شکل 7- ارزیابی خلوص آنزیم پس‌از کروماتوگرافی DEAE- سفاروز با استفاده از SDS-PAGE. ستون 1. نشانگر وزن مولکولی، ستون 2. سوپرناتنت محیط‌کشت باکتری، ستون 3. سوپرناتنت باکتری پس‌از تغلیظ با نمک آمونیوم‌سولفات 85 درصد، ستون 4. فرکشن دارای فعالیت پروتئازی مرحلۀ اول ستون تعویض آنیونی DEAE- سفارز، ستون 5. فرکشن دارای فعالیت پروتئازی مرحلۀ دوم ستون تعویض آنیونی DEAE- سفارز، ستون 6. زیموگرافی پروتئاز، موقعیت باند پروتئاز با فلش روی شکل مشخص شده ‌است.

 

 

طی خالص‌سازی این آنزیم فعالیت ویژۀ آنزیم از U/mg 54/1 در محیط‌کشت به U/mg 22 در نمونۀ خالص افزایش یافت که نشان‌دهندۀ خالص‌سازی به میزان 28/14 برابر است. این خالص‌سازی با 20 درصد بازدهی همراه بود (جدول 2). برای محاسبۀ بازدهی، فعالیت کل در هر مرحله بر فعالیت کل اولیه (فعالیت کل محیط‌کشت) تقسیم و به‌شکل درصد در جدول آورده شد. روش‌های گوناگونی برای خالص‌سازی پروتئاز از باکتری‌های مختلف گزارش شده‌اند. در پژوهش حاضر آنزیم خالص تنها به روش کروماتوگرافی تعویض آنیونی تهیه و آنزیم خالص‌شده برای تعیین ویژگی‌ها استفاده شد.

 

 

جدول 2- مراحل خالص‌سازی آنزیم پروتئاز مربوط به باکتری Bacillus sp. DEM07

مرتبه تخلیص

بازدهی(درصد)

فعالیت ویژه (U/mg)

پروتئین کل (mg)

فعالیت کل (U)

مرحله تخلیص

1

100

54/1

1942

2990

محیط کشت

19/3

61

92/4

371

1826

سولفات‌آمونیوم 85 درصد

4

29

19/6

142

880

ستون اول کروماتوگرافی DEAE- سفارز

28/14

20

22

28

616

ستون دوم کروماتوگرافی DEAE- سفارز

 


وﻳﮋگی‌های آﻧﺰﻳﻢ ﭘﺮوﺗﺌﺎز خالص‌شده

تأثیر اسیدیته بر فعالیت و پایداری پروتئاز: در بررسی اثر اسیدیته بر فعالیت آنزیم (شکل 8، الف) بیشترین فعالیت (100 درصد) آنزیم در اسیدیتۀ 10 مشاهده شد که نشان می‌دهد آنزیم خالص‌شده جزو آلکالین‌پروتئازهاست. این آنزیم در محدودۀ اسیدیتۀ 7 تا 11 نیز فعالیت زیادی نشان داد؛ به‌طوری‌که در اسیدیته‌های 7 و 11 به‌ترتیب 82 و 1/87 درصد فعالیت داشت و سپس فعالیت آن کاهش یافت. در بررسی پایداری آنزیم در اسیدیته‌های مختلف، همان‌طور که در شکل 8، ب دیده می‌شود آنزیم در اسیدیتۀ 7 بیشترین پایداری را نشان داد. همچنین آنزیم در محدودۀ گسترده‌ای از اسیدیته (اسیدی تا قلیایی) پایدار بود. آنزیم خالص‌شده پس‌از 1 ساعت نگهداری در دمای 37 درجۀ سانتی‌گراد 5/79 درصد فعالیت اولیۀ خود در اسیدیتۀ بهینه یعنی 10 را حفظ کرد.

 

 

شکل 8- منحنی فعالیت و پایداری آنزیم در اسیدیته‌های مختلف. الف. آنزیم دارای محدودۀ وسیع فعالیت در اسیدیته‌های 7 تا 11 است و اسیدیتۀ بهینه آن 10 است، ب. حداکثر پایداری آنزیم در اسیدیتۀ 7 است.

 

ﺗﺄﺛﻴﺮ دﻣﺎ ﺑﺮ ﻓﻌﺎﻟﻴﺖ و ﭘﺎﻳﺪاری ﭘﺮوﺗﺌﺎز: آﻧﺰیم‌ها ﺑﻪ‌ﻃﻮر ﻋﻤﺪه ﻣﺎﻫﻴﺖ ﭘﺮوﺗﺌﻴﻨﻲ دارﻧﺪ و دﻣﺎ ﺑﺮ عملکرد و ﺳﺎﺧﺘﺎر ذاﺗﯽ آنها مؤثر اﺳﺖ. ازآنجاﮐﻪ بیشتر ﻓﺮاﯾﻨﺪﻫﺎی ﺻﻨﻌﺘﯽ در دﻣﺎﻫﺎی زیاد اﻧﺠﺎم می‌شوند استفاده از آﻧﺰﯾﻢﻫﺎیی ﮐﻪ توانایی فعالیت و حفظ ﺳﺎﺧﺘﺎر ﺧﻮد را در دﻣﺎﻫﺎی زیاد داشته باشند اﻫﻤﯿﺖ بسزایی دارد. به‌منظور ﺗﻌﻴﻴﻦ درﺟﻪ‌ﺣﺮارت ﻣﻨﺎﺳﺐ ﺑﺮای ﻋﻤﻠﻜﺮد آﻧﺰﻳﻢ، ﻣﺤﻠﻮل واﻛﻨﺶ در دﻣﺎﻫﺎی مختلف تا 90 درجۀ سانتی‌گراد ﻗﺮار ﮔﺮفت و ﻣﻴﺰان ﻓﻌﺎﻟﻴﺖ آﻧﺰﻳﻢ اندازهﮔﻴﺮی ﺷﺪ. نتایج نشان دادند آنزیم در محدودۀ دمایی 40 تا 50 درجۀ سانتی‌گراد بیش از 60 درصد فعالیت دارد هرچند دمای بهینه برای فعالیت آن (100 درصد) 50 درجۀ سانتی‌گراد است. مطابق شکل 9، الف میزان فعالیت آنزیم با افزایش دما به 55 درجۀ سانتی‌گراد به‌سرعت کاهش می‌یابد؛ به‌طوری‌که آنزیم در دمای 55 درجۀ سانتی‌گراد حدود 40 درصد فعالیت خود دارد.

در بررسی پایداری آنزیم خالص‌شده در محدودۀ دمایی یادشده مشخص شد پس‌از گذشت 2 ساعت از زمان گرماگذاری، آنزیم در دمای 37 درجۀ سانتی‌گراد بیشترین پایداری را دارد و تا دمای 50 درجۀ سانتی‌گراد بیش از 80 درصد فعالیت خود را حفظ می‌کند؛ اما با افزایش دما ساختار خود را از دست می‌دهد و فعالیت باقیماندۀ آن کاهش می‌یابد (شکل 9، ب).

 

 

 

شکل 9- منحنی فعالیت و پایداری آنزیم در دماهای مختلف. االف. حداکثر فعالیت آنزیم در دمای 50 درجۀ سانتی‌گراد مشاهده می‌شود، ب. پایداری آنزیم در دماهای مختلف پس‌از یک ساعت گرماگذاری در آن دما

بحث.

بیشتر مطالعه‌ها در زمینۀ تولید آنزیم آلکالین‌پروتئاز با استفاده از سویه‌های استاندارد انجام شده‌ است. تولید زیاد آنزیم در سویۀ مطالعه‌شده که از منبعی باکتریایی و در دسترس مانند چشمۀ آب گرم تهیه می‌شود برای کاربردهای صنعتی، دارویی و غذایی مناسب است. ﻧﺘﺎﻳﺞ ﭘﮋوﻫﺶ حاضر ﻧﺸﺎن دادند دمای بهینه برای تولید آلکالین‌پروتئاز و رشد باکتری 50 درجۀ سانتی‌گراد است که با نتایج آبیدی[xxi] و همکاران (2011) دربارۀ آلکالین پروتئاز تولیدی توسط باکتری بوتریتیس سینره[xxii] مطابقت دارد (23). آﻧﺎﻣﺎﻻی[xxiii] و ﻫﻤﻜﺎران (2014) دمای بهینۀ 40 درجۀ سانتی‌گراد را برای آنزیم آلکالین‌پروتئاز باکتری باسیلوس فیرموس CAS7[xxiv] گزارش کرده‌اند (24). دمای بهینۀ کمتر از 30 درجۀ سانتی‌گراد برای تولید پروتئاز توسط سویۀ باسیلوس گرمادوست گزارش شده است (25). در سال 2004 دمای بیش از 60 درجۀ سانتی‌گراد برای سویۀ باسیلوس  SMIA-2گزارش شده است. دمای کشت با تأثیر بر واکنش‌های بیوشیمیایی درون سلول و درنتیجه تحریک یا سرکوب تولید آنزیم بر سنتز پروتئین اثر می‌گذارد (26).

اسیدیته یکی از مهم‌ترین عوامل تعیین‌کنندۀ رشد و ریخت‌شناسی ریزموجودات است؛ زیرا آنها به غلظت یون‌های هیدروژن موجود در محیط حساس هستند. در میان شاخص‌های فیزیکی، اسیدیتۀ محیط رشد نقش مهمی در ایجاد تغییرات ریخت‌شناختی در موجود و ترشح آنزیم ایفا می‌کند. مطالعه‌های پیشین نشان می‌دهند باکتری‌ها به اسیدیتۀ خنثی برای رشد مطلوب نیاز دارند. با‌توجه‌به اینکه ریزموجودات محیط‌های خنثی تا اندکی اسیدی را برای رشد و متابولیسم ترجیح می‌دهند و اسیدیته‌های شدیداً قلیایی باعث رسوب‌کردن نمک‌ها و املاح ضروری برای رشد ریزموجودات می‌شوند، کاهش چشمگیر رشد و تولید آنزیم پروتئاز قلیایی در اسیدیته‌های قلیایی مشاهده می‌شود. در پژوهش حاضر تولید بهینۀ آنزیم پروتئاز قلیایی در اسیدیتۀ اولیۀ 7 مشاهده شد. این یافته با نتایج مطالعۀگودو[xxv] در سال (2009) همخوانی دارند (27). اسیدیتۀ بهینۀ بیشتر گونه‌های باسیلوس برای تولید پروتئاز 7 تا 11 گزارش شده است (28 و 29).

در پژوهشی رشد سلولی و تولید پروتئاز سویۀ باسیلوس APP1 پس‌از اسیدیتۀ 9 کاهش یافت؛ همچنین در محدودۀ اسیدیتۀ 5 تا 12 به‌خوبی رشد کرد اما تولید بهینۀ پروتئاز در اسیدیتۀ 9 مشاهده شد (30).

در مطالعۀ حاضر فعالیت آنزیم پس‌از اسیدیتۀ 11به‌طور چشمگیری کاهش می‌یابد. آنزیم در طیف وسیع اسیدیته از 7 تا 11 بیشترین فعالیت را دارد و در اسیدیتۀ 7 بسیار پایدار است. آنزیم‌های مهم مواد شوینده، سوبتیلیزین[xxvi] Carlberg و سوبتیلیزین Novo حداکثر فعالیت را در اسیدیته‌های 8 تا 10 نشان می‌دهند (31).

دما شاخصی ضروری است که باید کنترل شود و معمولاً تأثیر آن در موجودات مختلف متفاوت است. پروتئاز مطالعه‌شده 99 درصد فعالیت اولیۀ خود را در دمای 50 درجۀ سانتی‌گراد پس‌از 60 دقیقه گرماگذاری حفظ کرد. برخی گزارش‌ها مربوط به پروتئاز مقاوم به حرارت فعالیت درخور توجهی را در دمای 40 تا 60 درجۀ سانتی‌گراد نشان می‌دهند اما آنزیم در دمای 80 درجۀ سانتی‌گراد به‌طور کامل غیرفعال می‌شود (32-34).

در پژوهش حاضر تولید بهینۀ آلکالین‌پروتئاز طی 48 ساعت گرماگذاری و رشد سلولی بهینه طی 48 تا 60 ساعت بود؛ از‌این‌رو، دورۀ بهینۀ گرماگذاری ازنظر تولید پروتئاز و رشد سلولی مطلوب در دورۀ 48 ساعت گرماگذاری مشاهده شد که با  نتایج ردی[xxvii] و همکاران درمورد گونه‌های باسیلوس (2011) همخوانی دارد (35). گونۀ هالوباکتریوم که حداکثر تولید پروتئاز را در دورۀ گرماگذاری 96 ساعت دارد (36) و گونۀ باسیلوس لیکنی‌فورمیس TD4 که دارای دورۀ کوتاه‌تر (24 ساعت) گرماگذاری برای تولید پروتئاز است (37) نیز گزارش شده‌اند.

بهینه‌سازی شاخص‌های مختلف تخمیر به افزایش رشد و بازدهی تولید آنزیم در سویۀ DEM07 منجر شد. پایداری زیاد آنزیم آلکالین‌پروتئاز خارج سلولی این سویه در دما و اسیدیته‌های مختلف نشان‌دهندۀ پتانسیل چشمگیر این آنزیم برای کاربردهای مختلف در صنایع چرم و صنایع شوینده و داروسازی و ... است. مراحل به‌کار‌رفته در بررسی حاضر برای خالص سازی آنزیم در مقایسه با گزارش‌های سایر پژوهشگران کوتاه و مقرون‌به‌صرفه بودند.



[1]- Skim Milk Agar

[2]- Incubation period

[3]- Agar-agar

[4]- Tripton

[5]- Yeast extract

[6]- Gram

[7]- Penicillin

[8]- Bergey

[9]- Primer

[10]- Polymerase chain reaction

[11]- Casein

[12]- Revolutions per minute

[13]- Folin-Ciocalteu`s phenol reagent

[14]- Unit

[15]- Preculture medium

[16]- Production medium 

[17]- Ammonium sulfate

[18]- Dialysis

[19]- Sodium dodecyl sulphate

[20]- Stationary

[xxi]- Abidi

[xxii]- Botrytis cinerea

[xxiii]- Annamalai

[xxiv]- Bacillus firmus CAS7

[xxv]- Gouda

[xxvi]- Subtilisin

[xxvii]- Reddy

 (1)              Antranikian G. and Egorova K. Extremophiles, a unique resource of biocatalysts for industrial biotechnology. American Society of Microbiology 2007; 361-406.
(2)              Zilda DS., Harmayani E., Widada J., Asmara W., Irianto HE., Patantis G., et al. Screening of thermostable protease producing microorganisms isolated from Indonesian hot spring. Squalen 2012; 7(3): 105-114.
(3)              Zeikus JG., Vieille C., Savchenko A. Thermozymes: biotechnology and structure-function relationships. Extremophiles 1998; 2(3): 179-183.
(4)              Vijayaraghavan P., Vijayan A., Arun A., Jenisha J., Vincent SGP. Cow dung: a potential biomass substrate for the production of detergent-stable dehairing protease by alkaliphilic Bacillus subtilis strain VV. Springerplus 2012; 1(1): 76-77.
(5)              Mani P., Johnbastin TMM., Arunkumar R., Lalithambikai B., Brindha B., Rinikarunya R., Kannan VR. Thermostable alkaline protease from thermophilic and alkaliphilic Bacillus licheniformis and its application as a laundry detergent additive. International Journal of Bioscience and Medicine 2012; 1(2) 18-26.
(6)              Rawlings ND., Barrett AJ. Evolutionary families of peptidases. Biochemical Journal 1993; 290(1): 205-218.
(7)              Singh RP., Nath Jha P. Characterization and optimization of alkaline protease production from bacillus licheniformis hsw-16 isolated from sambhar salt lake. International Journal of Applied Sciences and Biotechnology 2015; 3(2): 347-351.
(8)              Fox J., Shannon J., Bjarnason J. Proteinases and their inhibitors in biotechnology. enzymes in biomass conversion. ACS Symposium Series 1991; 460(6) 62-79.
(9)              Babu KR., Satyanarayana T. Alpha-amylase production by thermophilic Bacillus coagulans in solid state fermentation. Process Biochemistry 1995; 30(4): 305-309.
(10)          Whitman WB., Goodfellow M., Kampfer P., Busse HJ., Trujillo ME., Ludwig W., et al. Bergey’s Manual of Systematic Bacteriology. 2nd ed. New York: Springer-Verlag; 2012.
(11)          Azadian F., Badoei-Dalfard A., Namaki-Shoushtari A., Hassanshahian M. Purification and biochemical properties of a thermostable, haloalkaline cellulase from Bacillus licheniformis AMF-07 and its application for hydrolysis of different cellulosic substrates to bioethanol production. Molecular Biology Research Communications2016; 5(3): 143-155.
(12)          Tamura K., Dudley J., Nei M., Kumar S. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 2007; 24(8): 1596-1599.
(13)          Lowry OH., Rosebrough N., Farr A., Rundall R. Protein measurement with folin phenol reagent. Journal of Biological Chemistry 1951; 193(1): 265-275.
(14)          Gupta R., Beg Q., Lorenz P. Bacterial alkaline proteases: molecular approaches and industrial applications. Applied Microbiology and Biotechnology 2002; 59(1): 15-32.
(15)          Joshi RH., Dodia MS., Singh SP. Production and optimization of a commercially viable alkaline protease from a Haloalkaliphilic bacterium. Biotechnology and Bioprocess Engineering 2008; 13(5): 552-559.
(16)          Pathak AP., Deshmukh KB. Alkaline protease production, extraction and characterization from alkaliphilic Bacillus licheniformis KBDL4: A Lonar soda lake isolate. Indian Journal of Experimental Biology 2012; 50(8): 569-576.
(17)          Srividya S., Mala M. Influence of process parameters on the production of detergent compatible alkaline protease by a newly isolated Bacillus sp. Y. Turkish Journal of Biology 2011; 35(2): 177-182.
(18)          Gupta R., Gigras P., Mohapatra H., Goswami VK., Chauhan B. Microbial a-amylases: a biotechnological perspective. Process Biochemistry 2003; 38(11): 1599-1616.
(19)          Haseltine C., Rolfsmeier M., Blum P. The glucose effect and regulation of α-amylase synthesis in the hyperthermophilic archaeon Sulfolobus solfataricus. Journal of Bacteriology 1996; 178(4): 945-950.
(20)          Hamilton LM., Kelly CT., Fogarty WM. Purification and properties of the raw starch degrading α-amylase of Bacillus sp.IMD434. Biotechnology Letters 1999; 21(2): 111-115.
(21)          Sarikaya E. Increase of the a-amylase yield by some Bacillus strain. Turkish Journal of Biology 2000; 24(2): 299-308.
(22)          Patel RK., Dodia MS., Joshi RH., Singh SP. Production of extracellular halo-alkaline protease from a newly isolated haloalkaliphilic Bacillus sp. isolated from seawater in Western India. World Journal of Microbiology and Biotechnology 2006; 22(4): 375-382.
(23)          Abidi F., Chobert J., Haertle Th., Marzouki M. Purification and biochemical characterization of stable alkaline protease Prot-2 from Botrytis cinerea. Process Biochemistry 2011; 46(12): 2301-2310.
(24)          Annamalai N., Veeramuthu Rajeswari M., Kumar Sahu S., Balasubramanian Th. Purification and characterization of solvent stable, alkaline protease from Bacillus firmus CAS 7 by microbial conversion of marine wastes and molecular mechanism underlying solvent stability. Process Biochemistry 2014; 49(6): 1012-1019.
(25)          Nascimento WCA., Martins MLL. Production and properties of an extracellular protease from thermophilic Bacillus sp. Brazilian Journal of Microbiology 2004; 35(1): 91-96.
(26)          Bakermans C., Nealson KH. Relationship of critical temperature to macromolecular synthesis and growth yield in Psychrobacter cryopegella. Journal of Bacteriology 2004; 186(8): 2340-2345.
(27)          Gouda MK. Optimization and purification of alkaline proteases produced by marine Bacillus sp. MIG newly isolated from eastern harbour of Alexandria. Polish Journal of Microbiology 2006; 55(2): 119-126.
(28)          Joo HS., Chang CS. Production of protease from a new alkalophilic Bacillus sp. I-312 grown on soybean meal: Optimization and some properties. Process Biochemistry 2005; 40(3): 1263-1270.
(29)          Shivanand P., Jayaraman G. Production of extracellular protease from halotolerant bacterium, Bacillus aquimaris strain VITP4 isolated from Kumta coast. Process Biochemistry 2009; 44(10): 1088-1094.
(30)          Chu WH. Optimization of extracellular alkaline protease production from species of Bacillus. Journal of Industrial Microbiology and Biotechnology 2007; 34(3): 241-245.
(31)          Gupta R., Beg QK., Lorenz P. Bacterial alkaline proteases: Molecular approaches and industrial applications. Applied Microbiology and Biotechnology 2002; 59(1): 15-32.
(32)          Abusham RA., Zaliha RN., Salleh B., Basri M. Optimization of physical factors affecting the production of thermo-stable organic solvent-tolerant pro- tease from a newly isolated halotolerant B. subtilis strain Rand. Microbial Cell Factories 2009; 8(20): 1-9.
(33)          Nilegaonkar SS., Zambare VP., Kanekar PP., Dhake- phalkar PK., Sarnaik SS. Production and partial characterization of dehairing protease from Bacil- lus cereus MCMB-326. Bioresource Technology 2007; 98(6): 1238-1245.
(34)          Rai SK., Roy JK., Mukherjee AK. Characterisation of a detergent-stable alkaline protease from a novel thermophilic strain Paenibacillus tezpurensis sp. nov. AS-S24-II. Applied Microbiology and Biotechnology 2010; 85(5): 1437-1450.
(35)          Reddy NM., Kumar CG., Swathi K., Nagamani B., Venkateshwar S., Rao LV. Extracellular alka-line protease production from isolated Bacillus subtilis SVR-07 by using submerged fermentation. International Journal of Pharmaceutical Research Development 2011; 3(1): 216-223.
(36)          Anand SV., Hemapriya J., Selvin J., Kiran S., Global J. Production and Optimization of Haloalkaliphilic Protease by an Extremophile -Halobacterium SP Js1, Isolated from Thalassohaline Environment. Biotechnology and Biochemistry 2010; 5(1): 44-49.
(37)          Suganthi C., Mageswari A., Karthikeyan S., Anbalagan M., Sivakumar A., Gothandam KM. Screening and optimization of protease production from a halotolerant Bacillus licheniformis isolated from saltern sediments. Journal of Genetic Engineering and Biotechnology 2013; 11(1): 47-52.