بررسی فراوانی مایکوپلاسما ژنیتالیوم در زنان مبتلا به عفونت واژینال با استفاده از روش PCR در مقایسه با کشت

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 استادیار، گروه زیست شناسی، دانشکده علوم پایه، واحد پرند، دانشگاه آزاد اسلامی، پرند، ایران

2 استادیار، گروه زیست فناوری انرژی و محیط زیست، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، تهران، ایران

3 دانشجوی دکترا، گروه سلولی-مولکولی، دانشکده زیست شناسی، پردیس علوم، دانشگاه تهران، تهران، ایران

4 دانشجوی دکترا، گروه سلولی-مولکولی، دانشکده زیست شناسی، واحد سیرجان، دانشگاه آزاد، سیرجان، ایران

چکیده

مقدمه: مایکوپلاسما ژنیتالیوم از باکتری‌های بیماری‌زای واژن محسوب می‌شود که استفاده از روش‌های سنتی میکروبی برای تشخیص آن دقت کمی دارد. هدف مطالعۀ حاضر شناسایی و تعیین فراوانی این باکتری در زنان مبتلا به عفونت واژینال و مقایسۀ آن با افراد سالم به روش واکنش زنجیره‌ای پلیمراز (PCR)و کشت است.
مواد و روش‏‏ها: شرکت‌کنندگان شامل 150 فرد مبتلا به عفونت واژن و 45 فرد سالم (بدون هیچ‌گونه عفونت واژینال) مراجعه‌کننده به بیمارستان امام زمان در رباط کریم طی اردیبهشت تا آبان سال 1392 بودند. به‌منظور بررسی و شناسایی نمونه‌های آلوده به مایکوپلاسما ژنیتالیوم از دو روش کشت و واکنش زنجیره‌ای پلیمراز استفاده شد. سپس میزان حساسیت و ویژگی هریک از روش‌های یادشده محاسبه شد. داده‌ها با نرم‌افزار SPSS نسخۀ 19 بررسی شدند و مقادیر P کمتر از 05/0 معنادار تلقی شد.
نتایج: نتایج نشان می‌دهند از میان 150 نمونۀ عفونی، 107 نمونه (8/71 درصد) در روش PCR و فقط 73 نمونه (3/49 درصد) در روش کشت مثبت گزارش شدند. میزان حساسیت برای PCR 71 درصد و برای روش کشت 49 درصد بود. در گروه افراد سالم، 100 درصد نمونه‌های کشت‌شده منفی بودند که بیان‌کنندۀ ویژگی اختصاصی (Specificity) 100 درصدی این روش است؛ درحالی‌که ویژگی اختصاصی‌بودن محاسبه‌شده در روش PCR 90 درصد است.
بحث و نتیجه‏گیری: یافته‌های پژوهش حاضر حساسیت بیشتر روش PCR در مقایسه با روش کشت برای شناسایی مایکوپلاسما ژنیتالیوم و ارتباط قوی بین ابتلا به واژینوز باکتریایی و حضور این باکتری را نشان می‌دهند.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Frequency of Mycoplasma genitalium among Patients with Bacterial Vaginosis by PCR in comparison with Culturing Method

نویسندگان [English]

  • khadijeh onsory 1
  • Hossein Shahbani zahiri 2
  • Mona Abdollahi 3
  • Zahra Haji Mehdi Nouri 4
1 Assistant Professor, Department of Biology, Faculty of Science, Parand Branch, Islamic Azad University, Parand, Iran
2 Assistant Professor, Microbiology Department, National Genetics Research Center, Tehran, Iran
3 Ph.D student, Biology Department, Pardis Building, Tehran University, Tehran, Iran
4 Ph.D student, Cellular-Molecular Department, Faculty of Science, Sirjan Branch, Islamic Azad University, Sirjan, Iran
چکیده [English]

Introduction: Mycoplasma genitalium is a vaginosis pathogen bacterium to which conventional clinical microbiology techniques cannot be applied due to difficulties in cultivation and slow growth incubation. The aim of this study was  to detect the frequency of this bacteriaamong vaginosis infected women and compare it with healthy individuals using PCR and culture methods.
Materials and Methods: For this purpose, we conducted a study among 150 patients with bacterial vaginosis and compared the frequency with 45 healthy women with no vaginal infections collected from Imam Zaman Hospital, Robat karim city in May up to September, 1392 (2013). To detect the cases infected with Mycoplasma genitalium, we used culture technique and Polymerase Chain Reaction (PCR) as well. Then, the sensitivity and specificity were calculated. The data was analyzed using the computer software SPSS for windows (version 19), using Cross Tab and Chi square. PResults: The results indicated that among the infected cases, 107%) 71.8) samples were positive using PCR but only 73(49.3) of samples were growing in culture. The sensitivity for culture method was reported to be 49% only while, using PCR method came to 71%. In healthy individuals, 100% of samples were negative in culture which shows specify of 100% of this technique. The specificity of PCR method was 89%.
Discussion and conclusion: The findings showed that PCR is a more reliable technique to detect Mycoplasma genitalium compared to culturing method. It is also suggested that presence of this organism is strongly associated with bacterial vaginosis in female.

کلیدواژه‌ها [English]

  • Mycoplasma genitalium
  • Bacterial Vaginosis
  • Culture
  • PCR

مقدمه

مایکوپلاسماتاسه کوچک‌ترین (قطر 1/0 تا 3/0 میکرومتر) باکتری‌های شناخته‌شده هستند که بسیار کند و به‌سختی روی محیط‌‌کشت‌های مصنوعی رشد می‌کنند (1). این باکتری‌ها به‌علت نداشتن دیوارۀ سلولی در میان پروکاریوت‌ها منحصربه‌فرد هستند و همین ویژگی مسئول بسیاری از ویژگی‌های زیستی آنها مانند رنگ‌پذیر‌نبودن در رنگ‌آمیزی گرم و حساس‌نبودن به بسیاری از آنتی‌بیوتیک‌های معمول نظیر بتالاکتام‌ها است (2). این ریزموجودات در دستگاه تناسلی و منی مردان به‌وفور یافت و سبب بیماری‌های مختلفی در دستگاه‌های تنفسی و ادراری- تناسلی می‌شوند، در تولیدمثل اختلال ایجاد می‌کنند و سبب مرگ‌ومیر نوزادان می‌شوند (3). این باکتری‌ها در طول بارداری با عبور از جفت باعث ایجاد سپسیس در جنین و به دنبال آن، عفونت داخل‌رحمی می‌شوند. مایکوپلاسما ژنیتالیوم سبب عفونت گردن رحم، مخاط رحم و لگن می‌شود (4). این باکتری با اتصال به اسپرم باعث بی‌تحرکی آن می‌شود و یا با اسپرم متحرک حمل و طی تماس جنسی باعث ایجاد عفونت و ناباروری در زنان می‌شود (5). با‌توجه‌به اهمیت بیماری‌هایی که مایکوپلاسما ژنیتالیوم ایجاد می‌کند و عواقب وخیمی که در پی دارد تشخیص به‌هنگام این ریزموجود اهمیت بسزایی در جلوگیری از عوارض ابتلا به آن و درپیش‌گرفتن روش‌های درمانی مناسب دارد. روش‌های متداول تشخیص این باکتری دارای محدودیت‌‌هایی هستند؛ به‌طوری‌که جداسازی آن از طریق کشت گاهی به بیش از 8 هفته زمان نیاز دارد. این باکتری به‌علت سخت‌رشد‌بودن به محیط‌کشت‌های اختصاصی احتیاج دارد و محیط‌های یادشده به‌علت گرانی و ناپایداری، نیاز مبرم به عوامل رشد ضروری، نیاز به کنترل دقیق اسیدیتۀ محیط و گرانی فیلتر کمتر استفاده می‌شوند. درحال‌حاضر، از روش‌های سرولوژی و کشت در آزمایشگاه‌ استفاده می‌شود که دارای سرعت و حساسیت کمی هستند و عواملی ازجمله مدت زمان طولانی کشت و واکنش‌های متقاطع سرولوژیکی استفاده از آنها را نامناسب کرده‌اند (6). آزمون‌های سرولوژیکی به‌کاررفته نیز در تشخیص عفونت‌های ژنیتال اختصاصی نیستند و ازنظر آنتی‌ژنی میان مایکوپلاسما پنومونیه و مایکوپلاسما ژنیتالیوم واکنش متقاطع وجود دارد (4)؛ از‌این‌رو، استفاده از روش‌های مولکولی مانند PCR روش مناسبی برای تشخیص دقیق و سریع این عامل بیماری‌زا محسوب می‌شود که قادر به افتراق گونه‌های مختلف مایکوپلاسما است و بنابراین، امکان شروع سریع‌تر درمان آنتی‌بیوتیکی برای بیماران امکان‌پذیر است (7). هدف مطالعۀ حاضر شناسایی و تعیین فراوانی مایکوپلاسما ژنیتالیوم در زنان مبتلا به واژینوز باکتریایی به روش PCR و مقایسۀ آن با روش کشت است.

 

مواد و روش‌ها

در پژوهش حاضر از 150 بیمار با نشانه‌های بالینی سوزش، خارش، ترشح فراوان، تکرر ادرار، درد زیر شکم، واژنیتریال سرویسیت و اندومتریک نمونه‌برداری شد؛ این بیماران از اردیبهشت تا آبان 1392 به بیمارستان امام زمان (عج) در شهرستان رباط کریم مراجعه کرده بودند. هیچ‌یک از زنانی که در مطالعۀ حاضر شرکت کردند باردار نبودند و طی 3 روز پیش‌از مراجعه آنتی‌بیوتیک مصرف نکرده بودند. 45 زن سالم (بدون هیچ‌گونه عفونت واژینال) انتخاب و گروه شاهد در نظر گرفته شدند. هریک از بیماران و افراد شاهد پرسش‌نامه‌ای دربارۀ اطلاعات فردی ازجمله سن، سن ازدواج، سن نخستین بارداری، دفعات بارداری، روش جلوگیری از بارداری، پیشینۀ سقط جنین، استفاده از استخرهای عمومی و استفاده از پمادهای آنتی‌بیوتیک واژینال تکمیل کردند. سپس با سواب سرپنبه‌ای استریل دو نمونه از بیماران تهیه شد که یکی در محیط‌کشت انتقالی PPLO و دیگری در محیط PBS به آزمایشگاه منتقل شد. نمونه‌های درون محیط‌کشت انتقالی بی‌درنگ با سرنگ‌های 5 میلی‌لیتری از فیلترهای سرسرنگی با قطر منافذ 45/0 میکرون عبور داده شدند. 20 میکرولیتر از محلول فیلترشده به داخل 180 میکرولیتر محلول PPLO broth تلقیح و به‌منظور تأمین 7 تا 10 درصد CO2 در انکوباتور CO2‌دار با دمای 37 درجۀ سانتی‌گراد نگهداری شد. محیط‌ها طی 8 هفته نگهداری در انکوباتور به‌طور روزانه ازنظر تغییر رنگ بررسی شدند. در صورت مثبت‌بودن کشت، اسید تولید‌شده در اثر تجزیۀ آنزیمی گلوکز توسط باکتری باعث کاهش اسیدیتۀ محیط و تغییر رنگ محیط از قرمز (به‌علت وجود فنل‌رد) به زرد می‌شود؛ از همین ویژگی برای شناسایی استفاده شد و به‌محض مشاهدۀ تغییر رنگ، چند قطره از محیط به سطح محیط‌های آگار اختصاصی منتقل شد (8)و طی این مدت، با عدسی 4 و 10 میکروسکوپ بررسی شدند. در ادامه، از تمام نمونه‌های بافرهای انتقالی، DNA ژنومی توسط کیت استخراج شرکت کیاژن (ساخت ایران) استفاده شد و سپس با الکتروفورز روی ژل 5/1 درصد بررسی شد (9). تکثیر DNA توسط واکنش زنجیره‌ای پلیمراز (PCR) در حضور آغازگرهای اختصاصی انجام شد. MgPa-1 توالی دو رشتۀ 179 تا 206 را روی DNA هدف شناسایی می‌کند که رمزگردان یک ادهسین با Kda140 است. MgPa-2 مکمل توالی دو رشتۀ 348 تا 373 است (10). طول قطعۀتکثیر‌یافتۀ حاصل از PCR با استفاده از آغازگرهای استفاده‌شده در جدول ۱ آورده شده است.

 

جدول ۱- ویژگی‌ها و توالی آغازگرهای PCR

توالی شناسایی‌شده

توالی آغازگر (5′→3′)

206-179

F- AGTTGATGAAACCTTAACCCCTTGG

373-348

R- GACCATCAAGGTATTTCTCAACAGC

 

واکنش PCR در حجم نهایی 50 میکرولیتر شامل 10 میکرولیتر بافر PCR (10 X)، 1 میکرولیتر از هریک از آغازگرها (غلظت نهایی 500 نانومول)، 5 میکرولیتر DNA الگو، 200 میکرومول از هر dNTPs، 5/2 میلی‌مول منیزیم‌کلراید و 5/1 واحد آنزیم Taq polymerase با افزودن آب مقطر دیونیزه تهیه شد. شرایط PCR شامل دمای اولیۀ 94 درجۀ سانتی‌گراد به‌مدت 3 دقیقه، 35 چرخه شامل 1 دقیقه دمای 95 درجۀ سانتی‌گراد، 1 دقیقه دمای 62 درجۀ سانتی‌گراد برای اتصال آغازگر و 1 دقیقه دمای 72 درجۀ سانتی‌گراد برای ادامۀ واکنش و درنهایت، 10 دقیقه دمای 72 درجۀ سانتی‌گراد بود.

داده‌های حاصل با نرم‌افزار SPSS نسخۀ 19 و آزمون کای مربع تجزیه‌وتحلیل شدند. سطح معناداری P

 

نتایج

محدودۀ سنی در گروه بیماران بین 18 تا 63 سال با میانگین سنی (34/11±) 5/40 و در گروه شاهد بین 19 تا 65 سال با میانگین سنی (08/12±) 42 بود (جدول ۲).

در مطالعۀ حاضر، افراد به سه گروه سنی 18 تا 33، 34 تا 49 و 50 تا 65 تقسیم شدند که بیشترین تعداد مراجعه‌کنندگان در هر دو گروه بیماران (3/59 درصد) و شاهد (45/4 درصد) در گروه سنی 18 تا 33 سال قرار داشتند؛ از‌این‌رو ارتباط معناداری بین افزایش سن و میزان خطر ابتلا به مایکوپلاسما ژنیتالیوم در شرکت‌کنندگان به چشم می‌خورد. همچنین میزان خطر آلودگی در زنانی که 1 تا 2 زایمان داشته‌اند در مقایسه با زنان بدون سابقۀ بارداری به میزان 94/2 برابر افزایش داشت که ازنظر آماری معنادار است (جدول ۳).

 

جدول ۲- میانگین سنی افراد شرکت‌کننده در دو گروه بیمار و شاهد

متغیر

بیماران

شاهد

سن

63-18

65-19

Mean (±SD)

(34/11±)5/40

(08/12±)42

 

 

جدول 3- بررسی شانس ابتلا به مایکوپلاسما ژنیتالیوم در دو گروه بیماران و شاهد به تفکیک سن و تعداد زایمان

P value

OR (95% CI)

شاهد (درصد)

بیماران (درصد)

 

متغیر

 

1

20 (4/44 درصد)

89 (4/59 درصد)

33-18

سن

01/0

(01/7-1/1) 07/3

15 (3/33 درصد)

49 (6/32 درصد)

49-34

17/0

(5/7-65/0) 14/2

10 (2/22 درصد)

12 (8 درصد)

65-50

 

1

6 (33/13 درصد)

40 (7/26 درصد)

نداشته

تعداد زایمان

03/0

(61/8-07/1) 94/2

11 (45/24 درصد)

40 (7/26 درصد)

2-1

25/0

(16/2-816/0) 31/1

28 (22/62 درصد)

70 (6/46 درصد)

<2

 

 

بررسی حضور و یا نبود مایکوپلاسما ژنیتالیوم در مراجعه‌کنندگان به روش PCR بررسی شد. در این روش، مشاهدۀ قطعه‌ای به طول 194 جفت باز بیان‌کنندۀ وجود باکتری مایکوپلاسما ژنیتالیوم بود (شکل ۱). به‌منظور بررسی درستی نتایج، 50 عدد از نمونه‌های مثبت PCR توالی‌یابی شدند و مقایسۀ توالی‌های حاصل با توالی‌های موجود در Gen Bank شباهت 100 درصدی نمونه به سویۀ Mycoplasma genitaliumراتأیید کرد.

73 (3/49 درصد) نمونۀ مثبت از جمعیت مطالعه‌شده در روش کشت شناسایی شدند؛ در‌حالی‌که به روش PCR، 107 (8/71 درصد) نمونه مثبت گزارش شدند (جدول 4). میزان حساسیت (Sensitivity) محاسبه‌شده برای روش کشت برابر 49 درصد و برای روش PCR برابر 71 درصد بود. از سوی دیگر، 100 درصد نمونه‌های کشت‌شده در گروه افراد سالم (شاهد) منفی گزارش شدند که بیان‌کنندۀ ویژگی Specificity 100 درصدی این روش است؛ این در حالی است که ویژگی محاسبه‌شده در روش PCR 89 درصد بود.

 

 

شکل ۱- ژل آگارز محصولات PCR؛ 1. نشانگر، 2. شاهد مثبت،3. شاهد منفی، 4 تا 8. نمونه‌های مثبت

 

 

جدول۴- مقایسۀ نتایج کشت و PCR در دو گروه بیماران و شاهد

کشت

PCR

 

مثبت

منفی

 

مثبت

منفی

بیمار

73 (3/49 درصد)

77 (7/50 درصد)

بیمار

107 (8/71 درصد)

43 (4/28 درصد)

شاهد

0

45 (100 درصد)

شاهد

5 (11 درصد)

40 (89 درصد)

 


بحث و نتیجه‌گیری

عفونت‌های ناشی از مایکوپلاسما ژنیتالیوم ممکن است از چند ماه تا چند سال ادامه داشته باشند که نشان‌دهندۀ توانایی این باکتری برای فرار از سیستم ایمنی است. اهمیت بالینی این عفونت مزمن درخور تأکید است زیرا این‌گونه عفونت‌ها امکان ابتلای افراد به HIV و مقاومت در برابر درمان را افزایش می‌دهند (11). جداسازی مایکوپلاسما ژنیتالیوم به‌عنوان عامل بیماری ‌از نمونه‌های بالینی کار بسیار مشکلی است زیرا این باکتری مشکل‌پسند به‌سختی روی محیط‌کشت رشد می‌کند و حتی در صورت موفقیت کشت چند ماه طول می‌کشد تا بتوان کلنی‌های آن را مشاهده کرد. ازآنجاکه کشت مایکوپلاسما ژنیتالیوم به‌طور معمول حدود 8 هفته طول می‌کشد امکان دسترسی به نتایج مطلوب در زمان کوتاه امکان‌پذیر نیست. روش‌های سرولوژی نیز معمولاً به‌علت شباهت آنتی‌ژنی این باکتری با سایر باکتری‌ها کمکی به شناسایی آن نمی‌کنند (12). روش‌های مبتنی بر شناسایی مولکولی با استفاده از روش PCR برای تشخیص وجود این باکتری در نمونه‌های بالینی بسیار سودمند هستند (12-14). مایکوپلاسماها به‌علت نداشتن دیوارۀ سلولی در برابر شرایط محیطی حساس هستند و بنابراین، نتایج کشت به‌شکل منفی کاذب تلقی می‌شوند؛ در‌حالی‌که PCR روشی حساس، سریع و دارای ویژگی‌های اختصاصی است که برخلاف روش کشت حتی DNA باکتری‌های مرده را نیز شناسایی می‌کند. مطالعه‌های اندکی در زمینۀ جداسازی مایکوپلاسما ژنیتالیوم از نمونه‌های بالینی در ایران انجام شده و اطلاعات مربوط به میزان دقیق شیوع مایکوپلاسما ژنیتالیوم به‌ویژه در زنان ناکافی است (15). در مطالعه‌ای که وطنی (2006) به جداسازی این باکتری از افراد دچار عفونت‌های تناسلی پرداخت این میزان حدود 2 درصد گزارش شد (8).در مطالعه‌ای دیگر، 7/5 درصد جامعۀ مطالعه‌شده به مایکوپلاسما ژنیتالیوم آلوده بودند (16) و نتایج با مطالعۀ انجام‌شده روی زنان نابارور به روش PCR که نشان‌دهندۀ شیوع 6/3 درصدی مایکوپلاسما ژنیتالیوم بود مطابقت نسبی داشت؛ باوجوداین، نتایج پژوهش یادشده در مقایسه با مطالعۀ اخیر نشان‌دهندۀ شیوع کمتر آلودگی است (17). میزان جداسازی مایکوپلاسما ژنیتالیوم بین صفر (در انگلیس) تا 4/34 درصد (در نیوزیلند) متغیر است (12 و 17). بین بیماران، افرادی که بهداشت را در تعویض به‌موقع لباس زیر خود رعایت نمی‌کردند بیشترین درصد ابتلا (2/59 درصد) را به خود اختصاص دادند و خطر آلودگی آنها به این باکتری ازنظر آماری معنادار بود (03/0P=). تعداد زایمان افراد یکی دیگر از متغیرهای بررسی‌شده بود که 40 نفر (6/26 درصد) از بیماران با داشتن 2 زایمان ارتباط معناداری (03/0P=) بین حضور مایکوپلاسما ژنیتالیوم و تعداد زایمان نشان دادند. میزان شیوع فراوان باکتری مایکوپلاسما ژنیتالیوم در مطالعۀ حاضر در مقایسه با سایر مطالعه‌های انجام‌شده در این زمینه را می‌توان به شیوۀ نمونه‌گیری انجام‌شده مرتبط دانست. ازآنجاکه نمونه‌ها از بیمارستان امام زمان (عج) واقع در شهرستان رباط کریم استان تهران جمع‌آوری شدند پایین‌بودن سطح رفاه اجتماعی و بهداشت مردم منطقۀ مطالعه‌شده یکی از دلایل درصد زیاد مبتلایان به عفونت واژینال در میان مراجعه‌کنندگان به این مرکز درمانی به شمار می‌آید. همان‌طور که مشاهده می‌شود میزان شیوع مایکوپلاسما ژنیتالیوم در مطالعه‌های گوناگون متفاوت است و این امر از نوع مطالعه، ویژگی‌های جمعیت مطالعه‌شده (مصرف آنتی‌بیوتیک، وجود شرکای جنسی و ...)، تعداد نمونه، روش نمونه‌گیری، سن بیماران، نژاد، فرهنگ و منطقۀ جغرافیایی و روش آزمایشگاهی استفاده‌شده برای تشخیص (کشت و PCR) ناشی می‌شود. باتوجه‌به ژنوتیپ‌های یکسان سویه‌های جداسازی‌شده از شرکای جنسی و همچنین ارتباط شیوع آن با تعدد شرکای جنسی، مایکوپلاسما ژنیتالیوم باکتری بیماری‌زای منتقل‌شونده از راه جنسی (sexually transmitted pathogen) تلقی می‌شود (8). برخی دیگر از پژوهشگران نیز شیوع زیاد این باکتری بین مراجعه‌کنندگان به کلینیک بیماری‌های عفونی جنسی را گزارش کرده‌اند (8، 18-20). نتایج پژوهش اهمیت شیوع این باکتری در عفونت‌های واژینال زنان را نشان می‌دهند؛ ازاین‌رو، تشخیص به‌موقع و سریع این باکتری از عوارض و مشکلات ناشی از آن می‌کاهد.

پیش‌ازاین، ژن کدکنندۀ MgPa که یک ادهسین است برای بررسی شیوع مایکوپلاسما ژنیتالیوم استفاده شده است (21). ادبرگ و همکاران (2006) نشان دادند استفاده از این ژن و روش PCR کمّی روش مناسبی برای شناسایی و تعیین میزان شیوع این باکتری است (19). همچنین آنها نشان دادند استفاده از این ژن حساسیت بیشتری نسبت به ژن 16S rRNA دارد. باتوجه‌به هزینه‌های زیاد PCR کمّی و نبود دسترسی کافی به تجهیزات لازم، طراحی روش‌های جایگزین دارای حساسیت و اختصاصیت زیاد ضروری به نظر می‌رسد. در پژوهش حاضر از ژن کدکنندۀ ادهسین MgPa استفاده شد.

نتایج مطالعۀ حاضر نشان دادند با استفاده از این ژن نتایج دقیقی حتی به روش PCR معمولی به دست می‌آیند. با درنظرگرفتن اغلب موارد ناموفق و همچنین زمان‌بربودن روش‌های مبتنی بر کشت که به شناسایی‌نشدن (منفی کاذب زیاد) و تشخیص‌ندادن درست منجر می‌شوند به‌کارگیری روش مولکولی PCR با استفاده از ژن کد‌کنندۀ ادهسین MgPa روش جایگزینی برای شناسایی مایکوپلاسما ژنیتالیوم پیشنهاد می‌شود.

 

سپاسگزاری

از بخش پژوهش و فناوری دانشگاه آزاد اسلامی واحد پرند که پشتیبانی مالی طرح پژوهشی حاضر را به عهده داشتند صمیمانه سپاسگزاری می‌شود. همچنین از پرسنل بیمارستان‌های امام خمینی و امام زمان (عج) واقع در شهرستان رباط کریم که در جمع‌آوری نمونه‌ها ما را یاری کردند قدردانی می‌شود.

 
(1) Mosavian MPH. Check urogenital respiratory infections in patients admitted to Imam Khomeini hospital of Ahwaz. Journal of Kerman University Medical Science 2012; 4(10): 185-192.
(2) Amirmozaffari N., Ahmadi MH., Gilani S., Kazemi BA., Masjedian Jazi F. Detection of mycoplasma hominis and ureaplasma urealyticum from semen samples of infertile men referred to Royan institute in 2008. Razi Journal of Medical Sciences 2010; 17(71): 14-26.
 
(3) Serin MS., Evruke C., Kibar F., Koksal F. Comparison of PCR and cultivation methods to determine the incidence of infections due to mycoplasma hominis and mycoplasma fermentans in women genitourinary tract. Eastern Journal of Medicine 2001; 6(2): 48-52.
(4) Cruickshank R., Duguid JP., Marmion BP., Swain RH. Medical microbiology; a guide to the laboratory diagnosis and control of infection. -v. 1: Microbial infections. -v. 2: The practice of medical microbiology. 12th ed. 1973.
(5) Manhart LE., Critchlow CW., Holmes KK., Dutro SM., Eschenbach DA., Stevens CE., et al. Mucopurulent cervicitis and Mycoplasma genitalium. The Journal of Infectious Diseases 2003; 187(4): 650-657.
(6) Blaylock MW., Musatovova O., Baseman JG., Baseman JB. Determination of infectious load of Mycoplasma genitalium in clinical samples of human vaginal cells. Journal of Clinical Microbiology 2004; 42(2): 746-752.
(7) McGowin Chris L., Colin ASmits. Mycoplasma genitalium: an emerging cause of sexually transmitted disease in women. PLoS pathogees 2011; e1001324.
(8) Vatani SH., Ghazi Saeidi K., Mohammadi M., Naji AR., Fatemi Nasab F., Zeraati H., et al. The survey of contamination with genital Mycoplasma in women with bacterial vaginosis by PCR method. Journal of Gorgan University of Medical Sciences 2006; 8(7): 45-50.
(9) Yoshida T., Maeda S., Deguchi T., Miyazawa T., Ishiko H. Rapid detection of Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma parvum, and Ureaplasma urealyticum organisms in genitourinary samples by PCR-microtiter plate hybridization assay. Journal of Clinical Microbiology 2003; 41(5): 1850-1885.
(10) Manhart LE., Broad JM., Golden MR. Mycoplasma genitalium: should we treat and how? Clinical Infectious Diseases 2011; 53 (suppl-3): S129-42.
(11). Lind KL., Lindhardt BO., Schütten HJ., Blom J., Christiansen C. Serological cross-reactions between Mycoplasma genitalium and Mycoplasma pneumoniae. Journal of Clinical Microbiology 1984; 20(6): 1036-1043.
(12) Keane EA., Thomas J., Gilroy B., Renton A., Taylor-Robinson D. The association of Mycoplasma hominis, Ureaplasma urealyticum and Mycoplasma genitalium with bacterial vaginosis: observations on heterosexual women and their male partners. International Journal of STD and AIDS 2000; 11(6): 356-360.
(13) Naher HS., Said IH. Culturing and PCR Methods for Detection of Mycoplasma hominis and Ureaplasma urealyticum in Women with Genitourinary Tract Infections. International of Research Journal of Medical Science 2013; 1(3): 25-29.
(14) Stellrecht KA., Woron AM., Mishrik NG., Venezia RA. Comparison of multiplex PCR assay with culture for detection of genital mycoplasmas. Journal of Clinical Microbiology 2004; 42(4): 1528-1533.
(15) Jensen JS. Mycoplasma genitalium: the aetiological agent of urethritis and other sexually transmitted diseases. Journal of the European Academy of Dermatology and Venereology 2004; 18(1): 1-11.
(16) Nikan M., Ghafari M., Abedi F. The abundance of bacteria, Mycoplasma hominis and Ureaplasma urealyticum infection in women with infertile husbands. Journals of Kermanshah University of Medical Sciences 2009; 3(13): 197-202.
(17) Luki N., Lebel P., Boucher M., Doray B., Turgeon J., Brousseau R. Comparison of polymerase chain reaction assay with culture for detection of genital mycoplasmas in perinatal infections. European Journal of Clinical Microbiology and Infectious Diseases 1998; 17(4): 255-263.
(18) Edberg A., Jurstrand M., Johansson E., Wikander E., Höög A., Ahlqvist T. et al. A comparative study of three different PCR assays for detection of Mycoplasma genitalium in urogenital specimens from men and women. Journal of Medical Microbiology 2008; 304-309.
(19) Korte JE., Baseman JB., Cagle MP., Herrera C., Piper JM., Holden AE., et al. Cervicitis and genitourinary symptoms in women culture positive for Mycoplasma genitalium. American Journal of Reproductive Immunology 2006; 55(4): 265-275.
(20) Casin I., Vexiau-Robert D., De La SalmoniÈre P., Eche A., Grandry B., Janier M. High prevalence of Mycoplasma genitalium in the lower genitourinary tract of women attending a sexually transmitted disease clinic in Paris, France. Sexually Transmitted Diseases 2002; 29(6): 353-359.
(21) Jensen JS., Björnelius E., Dohn B., Lidbrink P. Use of TaqMan 5′ nuclease real-time PCR for quantitative detection of Mycoplasma genitalium DNA in males with and without urethritis who were attendees at a sexually transmitted disease clinic. Journal of Clinical Microbiology 2004; 42(2): 683-692.