ردیابی کموتیپ فومونیزین تولید شده توسط قارچ فوزاریوم پرولیفراتوم جدا شده از آجیل در عراق با استفاده از روش پی سی آر اختصاصی

Introduction

Agricultural products and foods are proper media for growing fungi. There are many studies that show fungi belong to various genera are present in different stages of agricultural products such as seeds, whole plants, yields, and foods (1-4). Nuts are classified as highly important agricultural products that in addition to direct consumption are also economically important due to their widespread usage in food industry. Nuts contain different nutrients and high level of condensed energy (5). High protein and fat contents as well as low amount of water turned nuts into products with extreme potency to be invaded by fungi. Several species of fungi have been isolated from nuts such as pistachio, peanut, hazelnut, almond, pecan, pine nut, walnut (6-9). Most of toxic species belong to Aspergillus, Penicillium and Fusarium species (9). Fungal contamination of nuts makes economically massive losses. As a matter of fact, growth of fungi on nuts leads to mycotoxin contamination which results in severs health problems in consumers (10).

Fusarium fujikuroi species complex (FFSC) encompasses important pathogenic fungi which their anamorphs are found within Fusarium. At least 36 described species are classified in FFSC such as F. circinatum, F. fujikuroi, F. proliferatum, F. subglutinans and F. verticillioides (11). Members of FFSC are responsible for some diseases in plants such as Bakana on rice seedlings, root rot of Soybean, and ear and stalk rot of maize (12-14).

Members of FFSC are potential producers of mycotoxins such as fumonisins (15). Although, in most of studies Aspergillus members are reported as major contaminants of nuts,  Fusarim spp. have been isolated from nuts, as well (6, 8, 16). Toxins produced by these fungi are a major concern in the production and storage of nuts (8, 17).

Mycotoxins as secondary metabolites are produced by some species of fungi and make harmful effects on consumers either human or other organisms. Fusarium and other genera such as Aspergillus, Penicillium, Alternaria and Claviceps encompass species that produce important mycotoxins such as trichothecenes, fumonisins, moniliformin, aflatoxins, altenuene, and ergot alkaloids (18). Depends on the type, mycotoxins have different effects on consumer health, therefore using ways to detect them through a rapid procedure is inevitable (19).

Fumonisins are from highly important mycotoxins that influence agriculture and the food industries. Accumulated fumonisins in plants such as maize and consequently consuming with human and animals result in hazardous affects such as cancer and neural tube defects (20, 21). At least 16 defined substances have been detected that are classified as fumonisins (10). A rapid procedure based PCR of specific genes encoding for proteins involving in mycotoxins biosynthesis is developed which help to identify the chemotypes of fungal species through a rapid way. Molecular studies of F. verticillioides revealed that a gene cluster (FUM) consist of 15 genes is responsible for fumonisins production (22). Their presence in a species can be investigated using PCR to identify ability of a particular maycotoxin biosynthesis and also chemotypes of the fungi (23).

As nuts are valuable and widely used agricultural products and are also absolutely susceptible to toxic fungi, it is necessary to be studied for fungal flora and potential toxins producers in them. Therefore, aims of this investigation are firstly, identification of fungal species on nuts samples collected from markets in Iraq and secondly, determination of chemotypes of the Fusarium isolates using the PCR-based molecular analyses.

Materials and methods

Isolation and Identification of Fusarium spp.:Nuts seeds were collected from different markets of Baghdad city and transferred to the lab in plastic bags. Strains of Fusarium spp. isolated from nuts seeds and their morphological characterization of the strains was examined based on their growth on carnation leaf agar (CLA) and potato dextrose agar (PDA) (24).

DNA extraction:Briefly, following culturing Fusarium isolates in Potato Dextrose Broth (PDB, Sigma) shaking at 150 rpm at 25±2^oC for 5 days, mycelia were harvested by filtration through Whatman paper 1 and freeze-dried for 20 h. DNeasy® Plant Mini Kit (Qiagen) according to the manufacturer's protocol to extract DNA.

Molecular identification using species-specific PCR:To confirm identification of F. proliferatum isolates were considered molecularly using species-specific primers of PRO1 (CTTTCCGCCAAGTTTCTTC) and PRO2 (TGTCAGTAACTCGACGTTGTTG) (25). Amplification reactions were done in a total volume of 25 µl, by mixing 1 µl of template DNA with 17.8 µl ddH₂O, 1 µl of deoxynucleotide triphosphate (dNTP) (Promega); 0.5 µl of MgCl₂ (Promega); 1 µl of each primer; 0.2 µl of Taq DNA polymerase (Promega) and 2.5 µl of PCR 5X reaction buffer (Promega, Madison, Wl, USA). PCR amplification was performed in the Peltier Thermal Cycler, PTC-100^® (MJ Research, Inc. USA) with the following programs: an initial denaturation step at 94^oC for 5 min, 35 cycles of 94°C (1 min), 56°C (1 min), 72°C (3 min), and a final extension step at 72°C for 10 min. To visualize the PCR products 1×TBE electrophoresis in ethidium-bromide-stained and 1% agarose gel were used.

Molecular analyses for fumonisin-producing Fusarium strains:To investigate potential ability of fumonisin production in the Fusarium strains, FUM1 F (CCATCACAGTGGGACACAGT) and FUM1 R (CGTATCGTCAGCATGATGTAGC)

primers were applied. PCR amplification was carried out in the Peltier Thermal Cycler, PTC-100^® (MJ Research, Inc. USA) according to temperature profiles described by bluhm and colleagues (26). To visualize PCR products 1×TBE electrophoresis in ethidium-bromide-stained and 1.8% agarose gel were used.

Results

One hundred and eight nut samples were collected from different markets in Baghdad city. Based on morphological features, 28 fungal isolates were recovered from infected nut seeds. Macroscopic and microscopic characteristics showed that all isolates belonged toF. proliferatum (12) as the known FFSC members, Aspergillus niger (8), Aspergillus flavus (5), and Penicillium sp. (3). Twelve strains of F. proliferatum were characterized by the production of abundant aerial mycelium. Also they produced slightly straight macroconidia with 3-5-septate and club shaped microconidia. The conidiogenous cells producer false head and chain microconidia were monophialides and polyphialides (Fig. 1). The identification of F. proliferatum isolates were confirmed molecularly using species specific primers of PRO1/PRO2 primers, which selectively amplified the partial calmodulin gene of rDNA. The primers PRO1/2 produced DNA fragments 585 bp in all F. proliferatum strains (Fig. 2). PCR-based detection of fumonisin-synthesis-pathway gene was also used to determine the potential of F. proliferatum isolates to produce fumonisin using FUM1 gene-based primers. PCR assays showed DNA fragments (183 bp) were amplified in nearly 42% of F. proliferatum strains (Fig. 3).

Fig. 1. Monophialidic and polyphialidic conidiogenous cells (a), macroconidia (b), and microconidia (c) shapes of Fusarium proliferatum isolated from nuts in Iraq. Bar= 20 µm for all figures.

Fig. 2. PCR products obtained with specific primer pairs PRO1/2 (band, 585 bp) from 12 isolates of F. proliferatum. Lane M: GeneRuler 1 kb DNA Ladder. Lane 1: F. subgultinans (negative control).

Fig. 3. PCR products obtained with specific primer pairs FUM1 F/FUM1 R (band, 183 bp) from 5 isolates of F. proliferatum. Lane M: GeneRuler DNA Ladder Mix, 100–10,000 bp Ladder.