نوع مقاله : پژوهشی- انگلیسی


1 استادیار قارچ شناسی، دانشگاه رازی کرمانشاه، ایران

2 دانشجوی کارشناسی ارشد گرایش میکروبیولوژی، دانشگاه رازی کرمانشاه، ایران


مقدمه: پژوهش حاضر به منظور ارزیابی وقوع جدایههای قارچ فوزاریوم پرولیفراتوم تولیدکننده مایکوتوکسین در آجیل در عراق انجام شد.
مواد و روش‏‏ها: در این پژوهش 108 نمونه آجیل از فروشگاههای مختلف در عراق جمع آوری شد. ویژگیهای ریخت شناسی گونههای فوزاریوم با استفاده از محیط کشتهای برگ میخک-آگار و عصاره سیب زمینی-دکستروز-آگار بررسی شد. جدایههای فوزاریوم پرولیفراتوم با استفاده از آغازگرهای اختصاصی PRO1/PRO2 تایید شد. در این پژوهش همچنین قابلیت تولید زهرابه فومونیزین توسط جدایههای فوزاریوم پرولیفراتوم با استفاده از آغازگرهای طراحی شده برای ژن FUM1 (FUM1 F/FUM1 R) بررسی شد.
نتایج: در این تحقیق 28 جدایه قارچ جداسازی شد که بر اساس بررسی‌های ریخت‌شناسی 3 گونه قارچی شناسایی شد که شامل گونههای فوزاریوم پرولیفراتوم (12)، آسپرژیلوس نایجر (8)، آسپرژیلوس فلاووس (5) و گونه نامشخصی از پنیسلیوم (3) بودند. آغازگرهای اختصاصی PRO1/PRO2، قطعه 585 جفت بازی را در همه جدایه‌های فوزاریوم پرولیفراتوم را تولید کردند. تکثیر قطعه دیانای (183 جفت بازی) ژن FUM1 با استفاده از آغازگرهای FUM1 F/FUM1 R تقریبا در 42 درصد از جدایه های فوزاریوم پرولیفراتوم بدست آمد.
بحث و نتیجهگیری: از بین 12 جدایه فوزاریوم پرولیفراتوم، 5 جدایه (42~) قابلیت تولید فومونیزین داشتند. این پژوهش برای نخستین بار در عراق انجام شد و بر اساس مطالعات مولکولی قابلیت جدایه‌های گونه مرکب فوزاریوم فوجیکوروی (FFSC) ارزیابی شد.



عنوان مقاله [English]

Detection of fumonisin chemotype produced by Fusarium proliferatum isolated from nuts in Iraq using specific PCR assays

نویسندگان [English]

  • Khosrow Chehri 1
  • Hussein Sattar Abod 2

1 Assistant Professor of Mycology, Biology Department, Faculty of Science, Razi University, Kermanshah, Iran

2 Master of Science Student in Microbiology, Biology Department, Faculty of Science, Razi University, Kermanshah, Iran

چکیده [English]

Introduction: The present study was carried out to evaluate the occurrence of toxicogenic Fusarium proliferatumstrains isolated from nuts in Iraq.
Materials and methods: A total of 108 nut samples collected from different markets in Iraq. Strains of Fusarium spp. isolated from nuts seeds and their morphological characterization of the strains were examined based on their growth on carnation leaf agar (CLA) and potato dextrose agar (PDA). The identification of F. proliferatum isolates were confirmed molecularly using species specific primers of PRO1/PRO2 primers. PCR-based detection of fumonisin-synthesis-pathway gene was also used to determine the potential of F. proliferatum isolates to produce fumonisin using FUM1 gene-based (FUM1 F/FUM1 R) primers.
Results: Based on morphological features 28 fungal isolates were obtained from nuts and identified into four species F. proliferatum (12), Aspergillus niger (8), Aspergillus flavus (5), and Penicillium sp. (3). The primers PRO1/PRO2 produced DNA fragments 585 bp in all F. proliferatum strains. PCR assays also showed DNA fragments (183 bp) were amplified in nearly 42% of F. proliferatum strains.
Discussion and conclusion: Of 12 tested isolates, 5 isolates (~42%) being fumonisin chemotype. To our knowledge, this is the first report on molecular identification and mycotoxigenic capacity of Fusarium fujikuroi species complex (FFSC) isolated from nuts in Iraq.

کلیدواژه‌ها [English]

  • FFSC
  • species specific primers
  • nuts
  • Iraq


Agricultural products and foods are proper media for growing fungi. There are many studies that show fungi belong to various genera are present in different stages of agricultural products such as seeds, whole plants, yields, and foods (1-4). Nuts are classified as highly important agricultural products that in addition to direct consumption are also economically important due to their widespread usage in food industry. Nuts contain different nutrients and high level of condensed energy (5). High protein and fat contents as well as low amount of water turned nuts into products with extreme potency to be invaded by fungi. Several species of fungi have been isolated from nuts such as pistachio, peanut, hazelnut, almond, pecan, pine nut, walnut (6-9). Most of toxic species belong to Aspergillus, Penicillium and Fusarium species (9). Fungal contamination of nuts makes economically massive losses. As a matter of fact, growth of fungi on nuts leads to mycotoxin contamination which results in severs health problems in consumers (10).

Fusarium fujikuroi species complex (FFSC) encompasses important pathogenic fungi which their anamorphs are found within Fusarium. At least 36 described species are classified in FFSC such as F. circinatum, F. fujikuroi, F. proliferatum, F. subglutinans and F. verticillioides (11). Members of FFSC are responsible for some diseases in plants such as Bakana on rice seedlings, root rot of Soybean, and ear and stalk rot of maize (12-14).

Members of FFSC are potential producers of mycotoxins such as fumonisins (15). Although, in most of studies Aspergillus members are reported as major contaminants of nuts,  Fusarim spp. have been isolated from nuts, as well (6, 8, 16). Toxins produced by these fungi are a major concern in the production and storage of nuts (8, 17).

Mycotoxins as secondary metabolites are produced by some species of fungi and make harmful effects on consumers either human or other organisms. Fusarium and other genera such as Aspergillus, Penicillium, Alternaria and Claviceps encompass species that produce important mycotoxins such as trichothecenes, fumonisins, moniliformin, aflatoxins, altenuene, and ergot alkaloids (18). Depends on the type, mycotoxins have different effects on consumer health, therefore using ways to detect them through a rapid procedure is inevitable (19).

Fumonisins are from highly important mycotoxins that influence agriculture and the food industries. Accumulated fumonisins in plants such as maize and consequently consuming with human and animals result in hazardous affects such as cancer and neural tube defects (20, 21). At least 16 defined substances have been detected that are classified as fumonisins (10). A rapid procedure based PCR of specific genes encoding for proteins involving in mycotoxins biosynthesis is developed which help to identify the chemotypes of fungal species through a rapid way. Molecular studies of F. verticillioides revealed that a gene cluster (FUM) consist of 15 genes is responsible for fumonisins production (22). Their presence in a species can be investigated using PCR to identify ability of a particular maycotoxin biosynthesis and also chemotypes of the fungi (23).

As nuts are valuable and widely used agricultural products and are also absolutely susceptible to toxic fungi, it is necessary to be studied for fungal flora and potential toxins producers in them. Therefore, aims of this investigation are firstly, identification of fungal species on nuts samples collected from markets in Iraq and secondly, determination of chemotypes of the Fusarium isolates using the PCR-based molecular analyses.

Materials and methods

Isolation and Identification of Fusarium spp.:Nuts seeds were collected from different markets of Baghdad city and transferred to the lab in plastic bags. Strains of Fusarium spp. isolated from nuts seeds and their morphological characterization of the strains was examined based on their growth on carnation leaf agar (CLA) and potato dextrose agar (PDA) (24).

DNA extraction:Briefly, following culturing Fusarium isolates in Potato Dextrose Broth (PDB, Sigma) shaking at 150 rpm at 25±2oC for 5 days, mycelia were harvested by filtration through Whatman paper 1 and freeze-dried for 20 h. DNeasy® Plant Mini Kit (Qiagen) according to the manufacturer's protocol to extract DNA.

Molecular identification using species-specific PCR:To confirm identification of F. proliferatum isolates were considered molecularly using species-specific primers of PRO1 (CTTTCCGCCAAGTTTCTTC) and PRO2 (TGTCAGTAACTCGACGTTGTTG) (25). Amplification reactions were done in a total volume of 25 µl, by mixing 1 µl of template DNA with 17.8 µl ddH2O, 1 µl of deoxynucleotide triphosphate (dNTP) (Promega); 0.5 µl of MgCl2 (Promega); 1 µl of each primer; 0.2 µl of Taq DNA polymerase (Promega) and 2.5 µl of PCR 5X reaction buffer (Promega, Madison, Wl, USA). PCR amplification was performed in the Peltier Thermal Cycler, PTC-100® (MJ Research, Inc. USA) with the following programs: an initial denaturation step at 94oC for 5 min, 35 cycles of 94°C (1 min), 56°C (1 min), 72°C (3 min), and a final extension step at 72°C for 10 min. To visualize the PCR products 1×TBE electrophoresis in ethidium-bromide-stained and 1% agarose gel were used.

Molecular analyses for fumonisin-producing Fusarium strains:To investigate potential ability of fumonisin production in the Fusarium strains, FUM1 F (CCATCACAGTGGGACACAGT) and FUM1 R (CGTATCGTCAGCATGATGTAGC)

primers were applied. PCR amplification was carried out in the Peltier Thermal Cycler, PTC-100® (MJ Research, Inc. USA) according to temperature profiles described by bluhm and colleagues (26). To visualize PCR products 1×TBE electrophoresis in ethidium-bromide-stained and 1.8% agarose gel were used.



One hundred and eight nut samples were collected from different markets in Baghdad city. Based on morphological features, 28 fungal isolates were recovered from infected nut seeds. Macroscopic and microscopic characteristics showed that all isolates belonged toF. proliferatum (12) as the known FFSC members, Aspergillus niger (8), Aspergillus flavus (5), and Penicillium sp. (3). Twelve strains of F. proliferatum were characterized by the production of abundant aerial mycelium. Also they produced slightly straight macroconidia with 3-5-septate and club shaped microconidia. The conidiogenous cells producer false head and chain microconidia were monophialides and polyphialides (Fig. 1). The identification of F. proliferatum isolates were confirmed molecularly using species specific primers of PRO1/PRO2 primers, which selectively amplified the partial calmodulin gene of rDNA. The primers PRO1/2 produced DNA fragments 585 bp in all F. proliferatum strains (Fig. 2). PCR-based detection of fumonisin-synthesis-pathway gene was also used to determine the potential of F. proliferatum isolates to produce fumonisin using FUM1 gene-based primers. PCR assays showed DNA fragments (183 bp) were amplified in nearly 42% of F. proliferatum strains (Fig. 3).




















Fig. 1. Monophialidic and polyphialidic conidiogenous cells (a), macroconidia (b), and microconidia (c) shapes of Fusarium proliferatum isolated from nuts in Iraq. Bar= 20 µm for all figures.



1         2         3         4          5         6         7          8         9         10      11         12         13


1000 bp


500 bp


250 bp



















Fig. 2. PCR products obtained with specific primer pairs PRO1/2 (band, 585 bp) from 12 isolates of F. proliferatum. Lane M: GeneRuler 1 kb DNA Ladder. Lane 1: F. subgultinans (negative control).



M        1           2          3           4           5           6           7           8           9          10         11         12        M


300 bp


200 bp


100 bp










Fig. 3. PCR products obtained with specific primer pairs FUM1 F/FUM1 R (band, 183 bp) from 5 isolates of F. proliferatum. Lane M: GeneRuler DNA Ladder Mix, 100–10,000 bp Ladder.



Nuts are classified as highly important agricultural products, which are commonly invaded by fungi. In the present study, we considered the nuts collected from markets in Baghdad, Iraq, to identify fungal species in them and more deeply to study fuasaria isolates using molecular techniques to detect their species and chemotypes.

From 108 samples of nuts, 28 isolates were recovered that encompass 12 isolates of F. proliferatum, 8 of Aspergillus niger, 5 of Aspergillus flavus, and 3 of Penicillium sp.. Identification of these fungi is accorded to previous researches on nuts. Abdulla (8) considered the fungal flora and mycotoxins in the nuts (almond, cashew nut, hazelnut, Peanut and pistachio) collected from local stores of Erbil, Iraq and species from Aspergillus and Penicillium were identified in the nuts. Our results confirmed his studies (8). To our knowledge, this is the first report on molecular identification F. proliferatum isolated from nuts in Iraq.

A study evaluated the mycobiota and mycotoxins in almond samples collected from different region in Brazil. They detected that the most frequent species belonged to Phialemonium spp. (54%), Penicillium spp. (16%), and Fusarium spp. (13%) (27). Khosravi and colleagues (6) investigated the fungal flora in nuts including pistachio, peanut, hazelnut and almond collected from different regions of Tehran, Iran and reported Aspergillus spp.(32.2%), Penecillium spp.(30.3%) Mucor spp. (17.1%), and Fusarium spp. (18.2%) as the most frequent fungi (6). Tournas et al. (9) revealed that Aspergillus, Penicillium, Fusarium, and Alternaria species contaminated the nut samples purchased from local markets in Washington, D.C., the United States of America. Our results were in agreement with the previous studies, but in our studies, the frequency of Fusarium species were higher compared to Aspergillus spp. and Penicilllium spp..

Through other part of this study, we detected chemotype of fumonisins produced by Fusarium isolates based on PCR analysis. Considering genes related to biosynthesis of the fumonisins are performed in previous studies of fusaria (25, 28). Mateo and Jiménez (29) considered production of fumonisins by strains of FFSC in autoclaved tiger nuts. They revealed that amount of produced fumonisin B1 was similar to level of that on rice and wheat (28). Another study was done to consider production of fumonisin B1 in pine nuts which showed some isolates of F. proliferatum can biosynthesis fumonisin B1 in the husk of pine nuts (7). In our study, we considered potency of F. proliferatum as the known members of FFSC to produce fumonisin that according to our results about 42% (5 of 12) of them were fumonisin chemotypes. Fumonisins are classified as very important mycotoxins with severe impact on consumers’ health, therefore, detecting chemotypes of fungi can be a very helpful tool to manage their contaminations (21). To the best of our knowledge, this is the first report of fumonisin chemotypes of Fusarium spp. in the nuts collected from Iraq. 

In conclusion, through this study, the mycoflora of the nuts collected from Baqdad, Iraq was identified morphologically and F. proliferatum were confirmed using molecular analysis. We revealed that F. proliferatum are forming a major part of contaminants in the samples. Moreover, we detected fumonisins chemotypes molecularly which to the best of our knowledge is reported for the first time in Iraq.

(1) Priyanka SR., Venkataramana M., Kumar GP., Rao VK., Murali HCS., Batra HV. Occurrence and molecular detection of toxigenic Aspergillus species in food grain samples from India. Journal of the Science of Food and Agriculture 2014; 94(3):537-543.

(2) Wisniewska H., Stepien L., Waskiewicz A., Beszterda M., Goral T., Belter J. Toxigenic Fusarium species infecting wheat heads in Poland. Central European Journal of Biology 2014; 9(2):163-172.

(3) Del Palacio A., Bettucci L., Pan D. Fusarium and Aspergillus mycotoxins contaminating wheat silage for dairy cattle feeding in Uruguay. Brazilian Journal of Microbiology 2016; 47(4):1000-1005.

(4) Han X., Zhao X., Zhang J., Zhang H., Yu D., Jiang T., Li F., Han C. Survey on fungi contamination of feed ingredients in China. Journal of hygiene research 2014; 43(3):430-434.

(5) Tan SY., Dhillon J., Mattes RD. A review of the effects of nuts on appetite, food intake, metabolism, and body weight. The American journal of clinical nutrition 2014; 100(Supplement 1):412-422. doi: 10.3945/ajcn.113.071456.

(6) Khosravi AR., Shokri H., Ziglari T. Evaluation of fungal flora in some important nut products (Pistachio, Peanut, Hazelnut and Almond) in Tehran, Iran. Pakistan Journal of Nutrition 2007; 6(5):460-462.

(7) Marin S., Ramos AJ., Vazquez C., Sanchis V. Contamination of pine nuts by fumonisin produced by strains of Fusarium proliferatum isolated from Pinus pinea. Letters in applied microbiology 2007; 44(1): 68-72. doi:10.1111/j.1472-765X.2006.02028.x.

(8) Abdulla NQF. Evaluation of fungal flora and mycotoxin in some important nut products in Erbil local markets. Research Journal of Environmental and Earth Sciences 2013; 5(6):330-336.

(9) Tournas VH., Niazi NS., Kohn JS. Fungal presence in selected tree nuts and dried fruits. Microbiology insights 2015; 8:1-6. doi: 10.4137/MBI.S24308.

(10) da Rocha MEB., Freire FDCO., Maia FEF., Guedes MIF., Rondina D. Mycotoxins and their effects on human and animal health. Food Control 2014; 36(1):159-165.        

(11) O’Donnell K., Cigelnik E., Nirenberg H. Molecular systematics and phylogeography of the Fusarium fujikuroi species complex. Mycologia 1998; 90(3):465-493.

(12) Wulff EG., Sorensen JL., Lubeck M., Nielsen KF., Thrane U., Torp J. Fusarium spp. associated with rice Bakanae: ecology, genetic diversity, pathogenicity and toxigenicity. Environmental Microbiology 2009; 12(3):649-657. doi: 10.1111/j.1462-2920.2009.02105.x.

(13) Arias MMD., Munkvold GP., Leandro LF. First report of Fusarium proliferatum causing root rot on soybean (Glycine max) in the United States. Plant Disease 2011; 95(10):1316-1316.

(14) Scauflaire J., Gourgue M., Callebaut A., Munaut F. Fusarium temperatum, a mycotoxin-producing pathogen of maize. European Journal of Plant Pathology 2012; 133(4):911-922. doi: 10.1007/s10658-012-9958-8.

(15) Hyung LS., Hye KJ., Wan SS., Theresa L., Hwan YS. Fumonisin production by field isolates of the Fusarium fujikuroi species complex and Fusarium commune obtained from rice and corn in Korea. Research in Plant Disease 2012; 18(4):310-316.

(16) Baquiao AC., Zorzete P., Reis TA., Assuncao E., Vergueiro S., Correa B. Mycoflora and mycotoxins in field samples of Brazil nuts. Food Control 2012; 28(2):224-229.

(17) Molyneux RJ., Mahoney N., Kim JH., Campbell BC. Mycotoxins in edible tree nuts. International journal of food microbiology 2007; 119(1-2):72-78.

(18) Marin S., Ramos AG., Cano-Sancho G., Sanchis V. Mycotoxins: Occurrence, toxicology, and exposure assessment. Food and Chemical Toxicology 2013; 60(October):218-237. doi: 10.1016/j.fct.2013.07.047.

(19) Eskola M., Parikka P., Rizzo A. Trichothecenes, ochratoxin A and zearalenone contamination and Fusarium infection in Finnish cereal samples in 1998. Food Additives and Contaminants 2001; 18(8):707-718.

(20) Voss KA., Riley RT., Waes JGV. Fumonisin B1 induced neural tube defects were not increased in LM/Bc mice fed folate-deficient diet. Molecular Nutrient Food Research 2014; 58(6):1190-1198.

(21) Ruyck KD., Boevre MD., Huybrechts I., Saeger SD. Dietary mycotoxins, co-exposure, and carcinogenesis in humans: Short review. Mutation Research 2015; 766(October–December):32-41. doi: 10.1016/j.mrrev.2015.07.003.

(22) Proctor RH., Brown DW., Plattner RD., Desjardins AE. Co-expression of 15 contiguous genes delineates a fumonisin biosynthetic gene cluster in Fusarium moniliformis. Fungal Genetics and Biology 2003; 38(2):237-249. doi: 10.1016/S1087-1845(02)00525-X.

(23) Yoruk E., Tunali B., Kansu B., Olmez F., Uz G., Zumrut IM., Sarıkaya A., Meyva G. Characterization of high-level deoxynivalenol producer Fusarium graminearum and F. culmorum isolates caused head blight and crown rot diseases in Turkey. Journal of Plant Diseases and Protection 2016; 123(4):177-186.

(24) Leslie JF., Summerell BA. The Fusarium Laboratory Manual. UK: Blackwell Publish Ltd (2006).

(25) Mulé G., Susca A., Stea G., Moretti A. A species-specific PCR assay based on the calmodulin partial gene for identification of Fusarium verticillioides, F. proliferatum and F. subglutinans. European Journal of Plant Pathology 2004; 110(5-6): 495-502.

(26) Bluhm BM., Cousin MA., Woloshuk CP. Multiplex real-time PCR detection of fumonisins producing and trichothecene producing groups of Fusarium species. Journal of Food Protection 2004; 67(3):536-543.

(27) Reis TA., Oliveira TD., Baquiao AC., Goncalves SS., Zorzete P., Correa B. Mycobiota and mycotoxins in Brazil nut samples from different states of the Brazilian Amazon region. International journal of food microbiology 2012; 159(2):61-68.

(28) Ivic D., Kovacevik B., Vasilj V., Idzakovic N. Occurrence of potentially toxigenic Fusarium verticillioides and low fumonisin B1 content on barley grain in Bosnia and Herzegovina. Journal of Applied Botany and Food Quality 2001; 84(2):121-124.

(29) Mateo JJ., Jiménez M. Trichothecenes and fumonisins produced in autoclaved tiger nuts by strains of Fusarium sporotrichioides and Fusarium moniliforme. Food microbiology 2000; 17(2): 167-176. doi: 10.1006/fmic.1999.0301.