جداسازی باکتری Lactobacillus plantarum از پنیر سیاه مزگی و تعیین ویژگی‏ های پروبیوتیکی آن

Introduction

Probiotics are microbial food supplements that have a beneficial effect on the host by influencing the composition and/or metabolic activity of intestinal microflora (1). Many beneficial effects of these microorganisms including anti-inflammatory properties, modulation of host's immune responses, reduction of lactose intolerance as well as inhibition of pathogenic bacteria have been described (2 & 3). A suitable probiotic strain must tolerate acidic pH of stomach and bile salts of intestinal tract and be able to adhere to mucosal surfaces (4).

Two genera Lactobacillus and Bifidobacterium, commonly present in dairy products are regarded as the major representative member of Lactic Acid Bacteria (LAB) and the most important probiotics (5). Traditional yogurts and cheese have been considered as good sources of LAB and ideal vehicles to deliver probiotic bacteria to human gastroinstestinal tract (6). Lotfi et al. (7) isolated 31 LAB from traditional cheese and yogurt from Heris and Sarab (East Azerbaijan, Iran) which belong to genus Lactobacillus and Enterococcus. In addition, Ghobadi Dana et al. (8) isolated a large number of LAB from traditional dairy products made from cow, sheep and goat milk and characterized their phylogenic relationship. Moreover, Islami et al. (9) isolated six Enterococci species from traditional cheese from Kaleibar (East Azerbaijan, Iran).

Siahmezgi cheese is a traditional dairy product which is produced using milk from domestic goats and sheep in highlands of Guilan province, Iran. The probiotic potential of LAB isolated from Siahmezgi cheese has never been investigated. Thus, aim of the present study was to isolate LAB from Siahmezgi cheese and to investigate their probiotic potential. In addition, inhibitory activity of the isolates against E. coli O₁₅₇and Salmonella typhimurium has also been studied.

Materials and methods

.Sample collection and isolation of LAB: Samples were collected aseptically from ten different sites located at villages (that traditionally produce Sihmezgi cheese), province of Guilan, Iran, stored at 4°C and transferred immediately to the laboratory. The samples were mixed and homogenized in 0.85% sterile NaCl solution (1:10 w/v) on a shaker (600 rpm) for ten minutes. Homogenized samples were diluted serially and cultured on MRS agar (Merck GmbH, Germany). After incubation at 37°C for 48 h, the Gram positive, Catalase negative, non motile bacterial isolates were purified using streak culture technique and stored at 4°C.

Acid and bile tolerance: Tolerance to acid was determined according to the method described earlier (10), as the following: isolated strains were grown in MRS broth at 37ºC for 24-48 h, and sub-cultured in fresh MRS broth adjusted to pH 2.0 and 3.0 with hydrochloric acid (3.0 mol/L). The initial bacterial concentration was adjusted to 10⁹cfu/mL and the survival rate was determined after incubation for 60 and 120 min at pH 2.0 and pH 3.0 which reflects the time spent by food in the stomach (11). Survival rate was determined using plating on MRS agar and calculating viable counts at different intervals.

Bile tolerance test was conducted using the method described by Gilliland et al. (12). Overnight cultures of the isolated strains with initial concentration of 10⁹cfu/mL were inoculated into MRS broth containing 0.5, 1.0 and 2.0 % (w/v) bile (Sigma-Aldrich). Survival rate of the isolates were measured following 24 h incubation at 37°C using the method described for acid tolerance assay.

.Resistance to Lysozyme, Pepsin and Pancreatin: In order to evaluate resistance of Lb2 and Lb3 strains to Lysozyme, fresh bacterial cultures were pelleted by centrifugation, washed twice with PBS and re-suspended in 2 mL of Ringer solution (Sigma-Aldrich) to reach a final concentration of 10⁹cfu/mL. In order to simulate in vivo dilution by saliva, the bacterial suspensions were inoculated in a sterile electrolyte solution (0.22 g/L CaCl₂, 6.2 g/L NaCl, 2.2 g/L KCl, 1.2 g/L NaHCO₃) in the presence of 100 mg/L of Lysozyme (Sigma-Aldrich). Bacterial suspensions without Lysozyme were also included as controls. Samples were incubated at 37°C and microbial survival rates were calculated as percentage of the cfu/mL after 0.5 and 2 h compared to the cfu/mL at time 0 (13).

Resistant of the isolated strains to Pepsin and Panceratin was also evaluated using the method described, previously (14). Briefly, fresh bacterial culture was harvested (6000 g, 10 min, 4°C), washed in Phosphate Buffer Saline (PBS) solution and re-suspended in PBS solution pH 2, containing 3 mg/mL Pepsin (Sigma) and PBS solution pH 8, containing 1 mg/mL Panceratin (Sigma) with the initial concentration of 10⁹cfu/mL. After incubation at 37°C for 1 and 3 h with Pepsin, and 1 and 4 h with Panceratin, reflecting the time spent by food in the stomach and small intestine, respectively (11), the survival rate of the strains was determined.

.Antibiotic susceptibility and hemolytic activity: Susceptibility of the isolated strains to the antibiotics commonly used by human was evaluated according to the method described previously (5). Briefly, the cultures were overlaid on Muller-Hinton agar plate and antibiotic discs were placed on it and incubated 24 h at 37°C. The assay was performed in triplicates and mean diameter of inhibition zones around antibiotic discs were recorded. The susceptibility was expressed in terms of resistance (R), intermediate susceptibility (I), and susceptibility (S) based on data from the National Committee for Clinical Laboratory Standards (NCCLS).

In order to evaluate hemolytic activity of the isolates, fresh bacterial cultures were plated on Blood Agar plate containing 5% v/v human blood. The plates were examined for signs of β- hemolysis (clear zones around colonies), α- hemolysis (green-hued zones around colonies) or γ- hemolysis (no zones around colonies) following 24-48 h incubation at 37°C (15).

β- Galactosidase activity: β- Galactosidase activity of the isolates was determined using the method described by Meira et al. (16) with minor modifications. Briefly, the isolates were cultivated in lactose-MRS broth. The cells were washed and incubated with o-nitrophenyl-β-D-galactopyranoside (ONPG; Sigma) at 37°C for 15 min. Then, absorbance values were measured at both 420 and 560 nm and β- galactosidase activity was calculated and expressed as Miller units using the following formula: where, A1 was the absorbance just before assay and A2 was the cell density of the reaction mixture.

β- Gal activity= 1000 × [(A₄₂₀ - 1.75 × A2₅₆₀] ∕ (15min× 1 mL × A1₅₆₀)

.Antimicrobial activity against Gram negative pathogens: Antimicrobial activity of the isolated strains against E. coli O₁₅₇ and S. enterica serovar Typhimurium ATCC 14028 (hereafter refereed ad S. typhimurium) was investigated using the method described, previously (10 & 17). Microbial pathogens were provided by the Iranian Research Organization for Science and Technology (IROST), Tehran, Iran. A fresh culture of the isolated bacterium, grown in MRS broth, was centrifuged (6000 g, 10 min, 4°C) and the resulting supernatant was adjusted to pH 6.5 with NaOH (1 M) in order to rule out acid inhibition. The supernatant was used to determine antibacterial activity of the isolated strain against E. coli O₁₅₇ and S. typhiurium using well diffusion assay. This assay was performed in triplicates and mean diameter of inhibition halos were measured.

.Biochemical and molecular identification of the isolated strain: Based on the results of the assays described above, only one strain (isolate Lb₃) was identified using physiological and biochemical tests according to Bergey’s Manual of Systematic Bacteriology (18). These included the study of growth at different temperatures (10, 37, 45 and 55ºC) and NaCl concentrations (2.5, 6.5 and 10 and 18%), determination of fermentation type, triple sugar utilization test, citrate utilization test as well as sugar utilization test. In order to confirm the result from biochemical characterization, 16S rRNA sequencing was performed. Briefly, Total DNA from isolated strain was extracted using Bioneer genomic extraction kit according to the manufacturer's manual. Then, 16S rRNA gene was amplified using the Hal F (5' AGAGTTTGATCCTGGCTCAG 3') and Lac R (5' AAGGTTACCTCACCGACTTC 3') primers (7). The thermal cycler was programmed as follows: 10 min at 94ºC; 30 cycles of 1 min at 94ºC, 1 min at 57ºC, 1 min at 72ºC and 5 min at 72ºC. The PCR product was sequenced for 16S rRNA (GATC Biotech, Germany) and the sequence was submitted to Gen Bank (NCBI).

Statistical analysis: Assays were conducted in triplicates and statistical analysis was performed using SPSS version 18. The comparisons of differences between the means of the treatments were tested by one way ANOVA and a P value of less than 0.05 was considered significant.

Results

.Isolation and identification of potent probiotic strain: Only six bacterial strains were isolated from Siahmezgi cheese which were selected for further studies based on the morphology, Gram staining, Catalase production and motility tests. Only two Gram positive, Catalase negative, non motile rods (isolates Lb₂ and Lb₃) were regarded as LAB and further characterized as potent probiotic strains and other isolates were discarded.

According to the results, only one strain (Lb₃) was found to display potentially probiotic characteristics. Identification of this strain using physiological, biochemical and molecular assays was performed. The growth was observed at 10, 37 and 45ºC but the strain did not tolerate 55 ºC. In addition, the culture grew well in the media containing 2.5, 6.5 and 10% salt but did not grow in the medium containing 18% NaCl. Table 1 displays the results from determination of fermentation type, triple sugar utilization test (TSI slant) and citrate utilization tests.

Table1- Some growth characteristics of the isolated LAB

Fig. 1- Tolerance of isolated strains to low pH a) Lb₂ and b) Lb₃

According to the results from biochemical assays, the isolate Lb₃ was tentatively identified as Lactobacillus plantarum. The isolate Lb₃ was subjected to 16S rRNA sequencing and the cultures were found to have 99% sequence similarity to L. plantarum CJLP55, confirming biochemical characterization assays.

Acid and bile tolerance: Acid tolerance assay showed that both Strains Lb₂ and Lb₃ tolerated pH 3 after 120 min with survival percentage of 58 and 80% respectively, but the strain Lb₃ displayed significantly higher tolerance to 120min exposure to pH 2 with survival rate of 65%, compared to strain Lb₂ with survival rate of 37%. Fig. 1 displays the results of acid tolerance of the bacterial isolates at pH 3.0 and 2.0 studied for a period of 60 and 120 min.

Bacterial isolates were treated with different concentrations of bile salts. According to the results, both strains showed decrease in viability by increasing bile concentration. The isolate Lb₂ showed only 55, 37 and 22% tolerance following exposure to 0.5, 1.0 and 2% bile concentrations, respectively. Conversely, isolate Lb₃ showed significantly higher tolerance to similar concentrations of bile with 73, 68 and 60% viability, respectively (Fig. 2).

.Resistance to condition simulating GI tract: The overall resistance of the isolates to Lysozyme was determined and expressed as survival rates. According to the result, the isolates Lb₂ and Lb₃ showed a high Lysozyme resistance with survival rates of 76 and 83% respectively, following 30 min exposure to 100 mg/L Lysozyme. Table 2 reports data of bacterial survival after treatment with Lysozyme for 30 and 120 min.

Our results revealed that the isolate Lb₂ was highly susceptible to Pepsin solution (pH 2.0) while, the solution had less effect on survival rate of isolate Lb₃. Isolate Lb₂ showed survival percentage of 49 and 33% after exposure to Pepsin solution after one and three hours, while strain Lb₃ had a moderate decrease in the number of survivors at similar condition with survival rate of 57 and 48% following one and three hours exposure to Pepsin solution. In contrast, exposure to Panceratin containing solution (pH 8.0) did not dramatically decrease survivors of both strains even after 4h incubation (Table 2).

Fig 2- Effect of bile concentration on survival rate of the isolated strains following 24h incubation

Table 2- Survival rate of isolated strains in simulated gastrointestinal condition

Table 3- Susceptibility of the isolated strains to different antibiotics

R: Resistance, I: Intermediate susceptibility, S: Susceptibility