نوع مقاله : پژوهشی- فارسی

نویسندگان

1 دانشجوی دکتری گروه میکروبیولوژی، پردیس علوم و تحقیقات فارس، دانشگاه آزاد اسلامی، فارس، ایران، 2-گروه میکروبیولوژی، واحد شیراز، دانشگاه آزاد اسلامی، شیراز، ایران

2 استادیار گروه میکروبیولوژی، دانشکدۀ علوم پایه، واحد تهران شمال، دانشگاه آزاد اسلامی، تهران، ایران

3 دانشیار گروه میکروبیولوژی، دانشکده علوم پایه، واحد ساوه، دانشگاه آزاد اسلامی، ساوه، ایران

10.22108/bjm.2020.123026.1300

چکیده

مقدمه: کلبسیلا پنومونیه یک پاتوژن فرصت‌طلب انسانی است. تشکیل بیوفیلم، یکی از خواص مهم این باکتری است که به ایجاد فنوتیپ‌هایی با مقاومت دارویی چندگانه منجر می‌شود. در سال‌های اخیر، فناوری نانوذرات (NP) یکی از زمینه‌های مهم در طیف گسترده‌ای از مطالعات بوده است. در این مطالعه، اثرات نانوذرات زیستی و شیمیایی بر تشکیل بیوفیلم و مقاومت آنتی‌بیوتیکی کلبسیلا پنومونیه بررسی شد.
مواد و روش‏‏ها: درمجموع، 340 نمونه از بیماران در بیمارستان‌های مختلف شهر تهران جمع‌آوری شد. کلنی‌ها برای شناسایی باکتری‌ها براساس تکنیک‌های استاندارد بررسی شدند. در هر باکتری، وجود ژن‌های مهم بروز بیوفیلم در کلبسیلا پنومونیه با Multiplex PCR تشخیص داده و سطح بیان آنها با استفاده از PCR Real-time تجزیه و تحلیل شد. همچنین، اثر نانوذرات شیمیایی اکسید آهن بر تشکیل بیوفیلم و مقاومت آنتی‌بیوتیکی بررسی شد.
نتایج: 60 جدایه کلبسیلا پنومونیه براساس تکنیک‌های استاندارد شناسایی شدند. داده‌های ما نشان دادند هر دو نوع نانوذرات اکسید آهن اثر مهمی در مهار تشکیل بیوفیلم و مقاومت آنتی‌بیوتیکی این باکتری دارد (p <0.001). همچنین، ترکیب دارویی نانوذرات اکسید آهن و سیپروفلوکسازین در مقایسه با سایر ترکیبات به‌صورت معنی‌داری اثرات ضدمیکروبی دارد (p <0.001).
بحث و نتیجه‏گیری:تشکیل بیوفیلم و مقاومت آنتی‌بیوتیکی جدایه‌های کلبسیلا پنومونیه به‌طور مؤثر در واکنش به نانوذرات اکسید آهن مهار شدند. داده‌های ما در کنترل عفونت‌های مقاوم در برابر چندین دارو در بیماران بستری می‌توانند مفید باشند.

کلیدواژه‌ها

موضوعات

عنوان مقاله [English]

Investigating the Effects of Iron Oxide Nanoparticles on the Expression of Biofilm Production Genes and Antibiotic Resistance in Klebsiella pneumoniae Strains

نویسندگان [English]

  • Shirin Masoudian 1
  • Farzaneh Hosseini 2
  • Kumarss Amini 3

1 Department of Microbiology, Fars Science and Research Branch, Islamic Azad University, Fars, Iran, Department of Microbiology, Shiraz Branch, Islamic Azad University, Shiraz, Iran

2 Department of Microbiology, College of Bioscience, Tehran North Branch, Islamic Azad University, Tehran, Iran

3 Department of Microbiology, Faculty of Basic Science, Saveh Branch, Islamic Azad University, Saveh, Iran

چکیده [English]

Introduction: Klebsiella pneumoniae is a human opportunistic pathogen. Biofilm formation is one of the important properties of this bacteria that leads to the development of multidrug-resistant phenotypes. In recent years, Nanoparticle Technology (NP) has been an important field in a wide range of studies. In this study, the effects of chemical nanoparticles on biofilm formation and antibiotic resistance of Klebsiella pneumoniae were investigated.
Materials and methods: Overall, 340 samples from patients were collected from different hospitals in Tehran. Colonies were tested to identify bacteria based on standard techniques. In each bacterium, the presence of important biofilm formation genes in Klebsiella pneumoniae was detected by Multiplex PCR and their expression levels were analyzed using the Real-time PCR method. The effect of chemical nanoparticles of iron oxide on biofilm formation and antibiotic resistance was also investigated.
Results: Sixty isolates of Klebsiella pneumoniae were identified based on standard techniques. The results showed that both types of iron oxide nanoparticles had a significant effect on inhibiting the formation of biofilm and antibiotic resistance of this bacterium (p <0.001). In addition, the combination of iron oxide nanoparticles and ciprofloxacin had significant antimicrobial effects compared to other compounds (p <0.001).
Discussion and conclusion: The formation of biofilm and the antibiotic resistance of Klebsiella pneumoniae isolates were effectively inhibited in response to iron oxide nanoparticles. The results could be useful in controlling multiple drug-resistant infections in hospitalized patients.

کلیدواژه‌ها [English]

  • Klebsiella pneumoniae
  • Nanoparticles
  • Biofilm

مقدمه

کلبسیلا پنومونیه[1] یک باکتری گرم منفی، متعلق به خانوادة انتروباکتریاسه است که به‌عنوان پاتوژن فرصت‌طلب انسانی باعث عفونت‌های شدید مانند عفونت دستگاه ادراری، مننژیت، پنومونی و سپتی‌سمی، به‌ویژه در بیماران بستری می‌شود (1، 2). به‌طور طبیعی نرخ بیماری‌زایی مرتبط با این باکتری کم است؛ اما توانایی تشکیل بیوفیلم و تجمع باکتری‌ها، به بروز مقاومت آن به چندین آنتی‌بیوتیک منجر می‌شود که یک عامل مهم بیماری‌زا برای باکتری تلقی می‌شود (3). یک بیوفیلم شامل چندین باکتری است که در سطح کلنیزه می‌شوند و با یکدیگر و با ماتریکس خارج سلولی تماس دارند و از پروتئین‌ها، اسیدهای نوکلئیک، کربوهیدرات‌ها و سایر ماکرومولکول‌ها تشکیل شده است (4). تنظیم ژنی تولید بیوفیلم بر عهدة دسته‌ای از ژن‌های مهم است. ژن mrkD پروتئین ساختاری فیمبریه را کد می‌کند و در شروع اتصال باکتری به کاتتر برای تشکیل بیوفیلم مهم است (1، 3، 5). ژن‌های treC و sugE با تنظیم پلی‌ساکارید کپسول که در شکل‌گیری بیوفیلم ضروری‌اند، بر تشکیل بیوفیلم اثر می‌گذارند (6). سلول‌های باکتریایی با استفاده از مولکول‌های سیگنالینگ (پیام‌رسان) شیمیایی که به‌عنوان کروم سنسینگ شناخته می‌شوند، با یکدیگر ارتباط برقرار می‌کنند و در فنوتیپ‌های باکتریایی مانند تشکیل بیوفیلم اهمیت دارند. ژن LuxS یکی از ژن‌های مهم در فرایند کروم سنسینگ و تشکیل بیوفیلم است (7). در سال‌های اخیر، فناوری نانوذرات ([2]NP) یکی از زمینه‌های مهم در طیف گسترده‌ای از مطالعات بوده است. در مطالعات میکروبیولوژیکی، نانوذرات عملکرد‌های جالبی در مهار میکروارگانیسم‌های مختلف بیماری‌زا داشته‌اند. یکی از خصوصیات مهم نانوذرات، نسبت سطح به حجم‌شان است که به آنها اجازة برقراری ارتباط با ذرات دیگر را می‌دهد (8، 9). به نظر می‌رسد ماهیت سمی و شیمیایی فلزات با این مکانیسم‌ها تغییر یافته و به ایجاد نانوذرات با خصوصیات مختلف فیزیکی، حرارتی، شیمیایی، مغناطیسی، اپتیکال و الکتریکی منجر شده است (10، 11). نانوذرات فلزی مانند نقره و طلا از نانوذرات مهمی‌اند که می‌توانند برای هر دو باکتری گرم مثبت و گرم منفی خواص ضدباکتری داشته باشند (12، 13). امروزه علاوه بر روش‌های شیمیایی، روش‌های زیستی برای تولید نانوذرات فلزی به‌عنوان روش‌های سبز غیرسمی توسعه یافته‌اند. انواع مختلف نانوذرات فلزی با خواص ویژه توسط بسیاری از باکتری‌ها، گیاهان و قارچ‌ها می‌توانند ساخته شوند (14-16). اکسیدهای آهن نوعی از اکسیدهای فلزی‌اند که در سیستم‌های ذخیرة انرژی، تحریک سلول‌ها، کاتالیزورها و حامل‌های دارویی مفیدند (17-19). مگنتیت (Fe3O4) یکی از نانوذرات اکسید آهن است که توسط باکتری‌های مغناطیسی تولید می‌شود (20، 21). سویه‌های باسیلوس سرئوس[3] و باسیلوس سوبتیلیس[4] نیز نانوذرات مغناطیسی را در مقادیر زیاد تولید می‌کنند (22، 23).

مطالعة حاضر بر آن بوده است تا اثرات نانوذرات اکسید آهن را بر تشکیل بیوفیلم جدایه‌های کلبسیلا پنومونیه در نمونه‌های بالینی مختلف تعیین کند.

 

مواد و روش‌‌ها

جداسازی و شناسایی باکتری‌های کشت‌شده: درمجموع، 340 نمونة بالینی از بیماران در بیمارستان‌های مختلف تهران جمع‌آوری شد. نمونه‌های بالینی شامل سواب زخم، ادرار، خلط و خون، با سیستم انتقالی کری - بلیر به محیط کشت منتقل شدند. شناسایی باکتری‌ها براساس تکنیک‌های استاندارد انجام شد (24، 25). رنگ‌آمیزی گرم، آزمون‌های کاتالاز، اکسیداز، حرکت، اندول و اوره‌آز، استفاده از سیترات، آزمایش‌های بیوشیمیایی در محیط اکسیداسیون و تخمیر (محیط OF) و اکسیداسیون گلوکز در محیط کشت کریگلر آیرون آگار (کیولب، کانادا) Krigler Iron Agar (KIA) برای شناسایی کلنی‌های باکتری استفاده شدند. سپس توالی 16srRNA کلنی‌های جداشده بررسی شد.

آزمایش حساسیت ضدمیکروبی: جدایه‌های کلبسیلا پنومونیه برای حساسیت ضدمیکروبی با استفاده از روش انتشار دیسک (تکنیک کربی - بایر) بررسی شدند. برای آزمایش حساسیت از دیسک‌های ضدمیکروبی (پادتن طب، ایران) شامل سیپروفلوکساسین (5 میلی‌گرم)، ایمی‌پنم (10 میکروگرم)، جنتامایسین (10 میکروگرم)، آمیکاسین (30 میکروگرم) و سفتریاکسون (30 میکروگرم) استفاده شد.

تعیین MIC نانوذرات اکسید آهن: نانوذرات اکسید آهن با اندازة 40 نانومتری به‌صورت تجاری (مرک، آمریکا) تهیه شدند و تصویر SEM آنها تهیه شد (شکل 1). برای شناسایی حداقل غلظت‌های مهارکننده (MICs)، روش میکروتیتر پلیت براساس روش استاندارد پیشنهادی توسط کمیتة استانداردهای آزمایشگاه‌های بالینی (CLSI) استفاده شد. تکنیک انتشار دیسک برای به دست آوردن بهترین غلظت نانوذره برای آزمایش MIC انجام شد و نتایج به‌صورت هالة عدم رشد با استفاده از نانوذرة آماده‌شده نشان داده شدند. تمام چاهک‌ها در پلیت میکروتیتر با 100 میلی‌لیتر محیط کشت مولر هینتون براث استریل پر شدند. رقت سریالی نانوذره در پلیت میکروتیتر، تهیه (به چاهک اول 100 میکرولیتر از نانوذره با غلظت 2048 میکروگرم در میلی‌لیتر اضافه شد) و سپس 100 میکرولیتر از سوسپانسیون میکروبی با غلظت نیم مک فارلند به هر چاهک اضافه شد. پلیت میکروتیتر در دمای 37 درجة سانتی‌گراد به مدت 24 ساعت انکوبه شد. MIC به‌عنوان حداقل غلظت نانوذرات تعریف شد که از رشد ارگانیسم‌ها (کلبسیلا پنومونیه) در محیط کشت ممانعت می‌کند.

 

 

شکل 1- عکسبرداری میکروسکوپ الکترونی روبشی از نمونة نانوذرات مغناطیسی آهن Fe3O4 خریداری‌شده در مقیاس 100 نانومتر

 

تشخیص بیوفیلم: جدایه‌های کلبسیلا پنومونیه به مدت 24 ساعت در دمای 37 درجة سانتی‌گراد در محیط کشت تریپتیک سوی براث (TSB) (کیولب، کانادا) رشد کردند. کلنی‌ها برای تشکیل غلظت 5/0 مک‌فارلند رقیق شدند. بعد از آن، 20 میکرولیتر از سوسپانسیون باکتری به چاهک‌های میکروپلیت 96 خانة پلی‌استیرنی اضافه شد که قبلاً 180 میکرولیتر TSB داشتند و سپس به مدت 24 ساعت در دمای 37 درجة سانتی‌گراد انکوبه شد. چاهک‌ها با محلول بافر فسفات (PBS) سه بار شسته شدند تا سلول‌های متصل‌نشده حذف شوند و سپس در حالت معکوس خشک و با متانول تثبیت شدند. کریستال ویوله 1/0 درصد (CV) به مدت 5 دقیقه برای رنگ‌آمیزی پلیت‌ها استفاده شد. بعد از آن، چاهک‌ها یک بار دیگر شسته و خشک شدند. به‌منظور سنجش میزان رنگ متصل‌شده که نمایان‌کنندة میزان بیوفیلم بود، 200 میلی‌لیتر اسید استیک گلاسیال 33 درصد به هر چاهک اضافه شد. جذب نوری (OD) در محدودة 630 نانومتر با دستگاه الایزا (BioTek, USA) با 3 تکرار اندازه‌گیری شد. ODc به‌عنوان سه انحراف معیار بیشتر از میانگین OD کنترل منفی تعیین شد. چهار گروه برای طبقه‌بندی نتایج در نظر گرفته شدند؛ ازجمله باکتری‌های متصل‌نشده (OD ≤ ODc)، باکتری‌های با اتصال ضعیف (ODc

بررسی ژنتیکی: DNA با استفاده از کیت (پیشگامان، ایران) و با توجه به دستورالعمل شرکت سازنده استخراج شد. ژن‌های هدف با PCR چندگانه تکثیر شدند. پرایمرها با نرم‌افزارGene Runner  طراحی شدند (جدول 1). PCR چندگانه با استفاده از مستر میکس (آمپلیکون، دانمارک) و دستگاه PCR (Bio-Rad، آمریکا) انجام شد. مخلوط واکنش شامل 5/12 میکرولیتر محلول کاری X2، 4 میکرولیتر  DNA الگو، 6/1 میکرولیتر پرایمر و 1/2 میکرولیتر آب، به حجم کلی 25 میکرولیتر رسانده شد. شرایط دمایی PCR به شرح زیر تنظیم شد: 95 درجة سانتی‌گراد به مدت 3 دقیقه (مرحلة تقلیب اولیه)، 35 چرخه به‌صورت 95 درجة سانتی‌گراد برای 30 ثانیه (مرحلة تقلیب)، 58 درجة سانتی‌گراد برای 40 ثانیه (مرحلة اتصال پرایمرها)، 72 درجة سانتی‌گراد برای 60 ثانیه (مرحلة طویل‌سازی) و سپس 72 درجة سانتی‌گراد به مدت 5 دقیقه (مرحلة طویل‌سازی نهایی). الکتروفورز روی ژل آگارز 1 درصد برای تشخیص تکثیر ژن در نمونه‌ها، انجام و تصویر با دستگاه UV ترانس‌لومیناتور (آمریکا) گرفته شد.

پروتکل استخراج RNA و سنتز DNA مکمل (cDNA): برای استخراج RNA از کیت استخراج RNA سینا پیور با توجه به دستورالعمل شرکت سازنده استفاده شد. خلوص RNA استخراج‌شده نیز با دستگاه نانودراپ (2000c ,Thermo Fisher Scientific, USA)، ارزیابی و درنهایت، cDNA با استفاده از کیت 2-Steps RT-PCR (ویوانتیس- مالزی) طبق دستورالعمل‌های تولیدکننده ساخته شد.

 

 

جدول 1- توالی پرایمرهای رفت و برگشت استفاده‌شده در PCR و real-time PCR

نام پرایمر

فوروارد (’3- ’5)

ریورس (’3- ’5)

طول محصول (bp)

MrkD

ACACCACCAACTATTCCCTCG

ATGGAACCCACATCGACATTC

229

TreC

GTATCGTGCTGGATATGGTGC

TCACGGTAATCGCTGATGCTG

856

SugE

TGGTTCCCAGCGTTATCACCA

TCACGATACAGACAAGGCTGG

198

LuxS

ACTTACACCATGCACTCGCTG

CAGTTCGTCGTTGCTGTTGATG

90

16S rRNA

AGAGTTTGATCCTGGCTCAG

AAGGAGGTGATCCAGCCGCA

-


اندازه‌گیری سطح بیان ژن luxS: برای تجزیه و تحلیل سطح رونویسی ژن luxS، real-time PCR با استفاده از محلول کاری X2 سایبر گرین، های راکس (امپلیکون - دانمارک) و دستگاه real-time PCR (Applied Biosystems, Foster City, USA) انجام شد. مخلوط واکنش حاوی 10 میکرولیتر محلول کاریX 2، 1 میکرولیتر cDNA، 2 میکرولیتر پرایمر (1 میکرولیتر از هر پرایمر) و 7 میکرولیتر آب عاری از RNase به حجم کل 20 میکرولیتر بود. شرایط real-time PCR به این صورت تنظیم شد: 95 درجة سانتی‌گراد به مدت 10 دقیقه (مرحلة تقلیب اولیه)، 40 چرخه 95 درجة سانتی‌گراد برای 20 ثانیه (مرحلة تقلیب)، 56 درجة سانتی‌گراد برای 30 ثانیه (مرحلة اتصال پرایمرها) و 72 درجة سانتی‌گراد به مدت 30 ثانیه (مرحلة طویل‌سازی). برای اندازه‌گیری سطح بیان ژن luxS، از روش CT مقایسه‌ای استفاده شد (26). سطح رونویسی ژن 16SrRNA به‌عنوان ژن خانه‌دار برای نرمال‌کردن سطوح کمی نسبی ژن luxS در نظر گرفته شد.

تجزیه و تحلیل آماری: برای تجزیه و تحلیل داده‌ها از نرم‌افزار SPSS و برای ترسیم از برنامة GraphPad Prism نسخة 7، استفاده و 05/0>p به‌عنوان سطح معنادار آماری تعریف شد.

 

نتایج

.جداسازی کلبسیلا پنومونیه و آزمایش حساسیت ضدمیکروبی: در این پژوهش از میان 340 نمونه،60 سویه (33 سویه از زنان و 27 سویه از مردان) کلبسیلا پنومونیه از منابع مختلف بالینی جداسازی شدند. نمونه‌ها شامل ادرار (57 درصد)، خلط (21 درصد)، زخم (13 درصد) و خون (9 درصد) بودند. باکتری‌های جداشده کمترین مقاومت را به جنتامایسین (33/23 درصد) و بیشترین مقاومت را به سفتریاکسون (33/48 درصد) نشان دادند. جزئیات مقاومت در برابر تمام داروها در شکل 2 نشان داده شده است.

.بررسی حضور ژن‌های مؤثر در تشکیل بیوفیلم و ارتباط آنها با مقاومت آنتی‌بیوتیکی: حدود 66/96 درصد جدایه‌های کلبسیلا پنومونیه، ژن‌های mrkD و treC را دارند و به‌دنبال آن 95 درصد و 90 درصد از جدایه‌ها به‌ترتیب ژن‌هایluxS  و sugE را داشتند. داده‌ها نشان دادند حضور ژن luxS در جدایه‌های کلبسیلا پنومونیه فقط با مقاومت جنتامایسین رابطة معنی‌داری داشت (p<0.01). همچنین، بین این ژن‌ها و تشکیل بیوفیلم رابطة معنی‌داری دیده نشد. قطعات مشاهده‌شده روی ژل آگارز در شکل 3 نشان داده شده‌اند.

 

 

شکل 2- مقاومت آنتی‌بیوتیکی در کلبسیلا پنومونیه

 

شکل 3- قطعات PCR روی ژل آگارز. ستون 1: لدر 100 جفت‌بازی، ستون + کنترل مثبت (Template control)، ستون no taq control: ستون no template control، ستون‌های 1 تا 4 نمونه‌ها.

 


آزمایش حساسیت نانوذرات: با توجه به روش انتشار دیسک، بهترین هاله مهار کلبسیلا پنومونیه در برابر نانوذرات شیمیایی اکسید آهن (08/11 میلی‌متر) با غلظت 256 میکروگرم در میلی‌لیتر بود (جدول 2). MIC نانوذرات شیمیایی اکسید آهن برای جدایه‌های کلبسیلا پنومونیه بر طبق پروتکل CLSI تفسیر شد. MIC به‌دست‌آمده شامل 28/80 ± 29/136 برای نانوذرات شیمیایی اکسید آهن بود.

 

تأثیر نانوذرات بر تشکیل بیوفیلم کلبسیلا پنومونیه: باکتری‌ها براساس توانایی تشکیل بیوفیلم توسط کلبسیلا پنومونیه به 4 دسته تقسیم شدند: قوی (67/26 درصد)، متوسط (40 درصد)، ضعیف (15 درصد) و عدم تشکیل بیوفیلم (13/18 درصد). جدایه‌های تشکیل‌دهندة بیوفیلم با نانوذرات شیمیایی اکسید آهن تحت‌تأثیر قرار گرفتند. تفاوت‌های چشمگیری در تشکیل بیوفیلم در این جدایه‌ها یافت شدند (جدول 3).

 

جدول 2- هاله عدم رشد کلبسیلا پنومونیه

(P)

هاله عدم رشد (میلی‌متر)

انحراف معیار ± میانگین

نمونه (ترکیب نانوذرات و سیپروفلوکساسین)

** 001/0>

46576/5 ± 3/19

55555/5 ± 6833/20

سیپروفلوکساسین

غلظت 256 نانوذرة شیمیایی+ سیپروفلوکساسین

** 001/0>

55555/5 ± 6833/20

86135/1 ± 0893/11

غلظت 256 نانوذرة شیمیایی+ سیپروفلوکساسین

غلظت 256 نانوذرة شیمیایی

** 001/0>

86135/1 ± 0893/11

46576/5 ± 3/19

غلظت 256 نانوذرة شیمیایی

سیپروفلوکساسین

غلظت برحسب میکروگرم بر میلی‌لیتر است.

(**) معنی‌دار در سطح 01/0 است.

جدول 3- درصد تشکیل بیوفیلم در حضور نانوذرة شیمیایی با غلظت‌های متفاوت

توانایی تشکیل بیوفیلم

بدون نانو

g/mlµ 64

غلظت

g/mlµ 128

 

غلظت

g/mlµ 256

 

عدم اتصال

% 33/18

% 30

% 65

% 66/86

ضعیف

% 15

% 33/38

% 35

% 34/13

متوسط

% 40

% 67/31

-

-

قوی

% 67/26

-

-

-

 


.اثر نانوذرات بر سطح بیان ژن luxS در کلبسیلا پنومونیه: برای ارزیابی سطح بیان ژن luxS، یک جدایه با مقاومت بالای آنتی‌بیوتیکی و تشکیل بیوفیلم قوی انتخاب شد. مشخص شد سطح بیان ژن luxS با نانوذرات اکسید آهن 77/18 درصد کاهش یافته است که ازنظر آماری معنی‌دار تلقی می‌شود (p<0.001) (شکل 4).

 

 

 

شکل 4- نتایج Real–Time PCR برای ژن luxS در ایزولة کلبسیلا پنومونیه تشکیل‌دهندة بیوفیلم در حالت‌های تیمارشده (treat) و تیمارنشده (non treat) با نانوذرات اکسید آهن زیستی. ژن 16srRNA به‌عنوان ژن House-keeping استفاده شده است.

 


بحث

کلبسیلا پنومونیه یک پاتوژن فرصت‌طلب انسانی است که عفونت شدید در بیماران بستری‌شده ایجاد می‌کند و تهدید جهانی در سیستم مراقبت بهداشتی در نظر گرفته می‌شود (1، 2). یک مطالعة قبلی نشان داده است مرگ‌ومیر ناشی از عفونت کلبسیلا پنومونیه حدود 50 درصد در بیماران آلوده است و عمدتاً به‌علت افزایش فنوتیپ‌های مقاومت چند دارویی به‌عنوان یک مسئله مهم در سیستم‌های مراقبت‌های بهداشتی تلقی می‌شود (27).

پس از افزایش پدیدة مقاومت چند دارویی در باکتری‌های مختلف، خصوصیات آنتی‌باکتریال نانوذرات فلزی یکی از مهم‌ترین زمینه‌های مطالعات میکروبیولوژی شده است. نانوذرة اکسید آهن یکی از نانوذرات فلزی است که به‌علت تولید رادیکال‌های اکسیژن، خواص آنتی‌بیوتیکی دارد که به شکستن رشتة DNA، دپلیمریزه‌شدن پلی‌ساکارید، غیرفعال‌شدن آنزیم‌ها و پراکسیداسیون لیپید منجر می‌شود (28).

در مطالعة حاضر، 60 جدایه کلبسیلا پنومونیه حاصل از نمونه‌های مختلف بالینی تجزیه و تحلیل شدند که از بیمارستان‌ها جمع‌آوری شده بودند. حدود 82 درصد از جدایه‌ها قادر به تشکیل بیوفیلم بودند. تمامی جدایه‌ها برای حضور ژن‌های مرتبط در تشکیل بیوفیلم بررسی شدند. تقریباً بیش از 90 درصد از جدایه‌های کلبسیلا پنومونیه این ژن‌ها را داشتند که برای تشکیل بیوفیلم مهم‌اند. همچنین، نانوذرات اکسید آهن سطح بیان ژن luxS را به‌عنوان یک ژن مهم در تشکیل بیوفیلم کلبسیلا پنومونیه به‌صورت معنی‌داری کاهش دادند. در مطالعة مشابهی ترابی و همکاران اثر ضدباکتریایی ترکیب نانوذرات MgO و Fe2O3 بر باکتری‌های اشریشیاکلی و استافیلوکوکو‌س اورئوس را در محیط مایع، ارزیابی و سپس اثر آنها را همزمان در آبمیوه‌‌های هویج، انار و سیب به‌صورت جداگانه به روش کلنی کانت بررسی کردند و نشان دادند اثر ترکیبی دو نانوذره باعث کاهش رشد هر دو باکتری می‌شود (9). اثر ترکیبی از نانوذرات اکسید آهن و اکسید منیزیم باعث تخریب غشای سلولی و سپس نشت محتویات داخل سلولی و درنهایت، مرگ سلول‌های باکتریایی می‌شود؛ این اثر، مکانیسم اصلی ضدباکتریایی این نانوذرات است (11-10). با توجه به سایر مطالعات (9-12) به نظر می‌رسد فعالیت ضد بیان ژن‌های دخیل در تشکیل بیوفیلم نوع دیگری از اثرات این نانوذرات در روند فعالیت‌های ضدباکتریایی آنها باشد. در مطالعات دیگر کاهش اندازه و به‌دنبال آن، افزایش سطح مخصوص به‌عنوان عامل افزایش تعداد گروه‌های فعال روی سطح ذرات، مهم‌ترین فاکتورهای مؤثر بر افزایش سمیت نانوذرات برشمرده شده‌اند. در مقایسه با سایر مطالعات (9، 22، 23) می‌توان نتیجه گرفت نانوذرات 40 نانومتری استفاده‌شده در این مطالعه از فعالیت ضدمیکروبی قوی برخوردارند.

داده‌های این مطالعه نشان دادند باوجود نیاز به بررسی‌های بیشتر دربارة سمیت سلولی این ذرات، نانوذرات اکسید آهن می‌توانند برای کنترل عفونت در بیماران بستری، طراحی روش‌های جدید درمان برای جلوگیری از عفونت و کلونیزه‌شدن کلبسیلا پنومونیه و همچنین مهار سویه‌های مقاوم به چند دارو مفید باشند.



[1]- Klebsiella pneumoniae

[2]- Nanoparticle

[3]- Bacillus cereus

[4]- Bacillus subtilis

(1) Allen BL, Gerlach GF, Clegg S. Nucleotide sequence and functions of mrk determinants necessary for expression of type 3 fimbriae in Klebsiella pneumoniae. Journal of bacteriology. 1991; 173 (2): 916-20.
(2) Williams P, Tomas J. The pathogenicity of Klebsiella pneumoniae. Rev Med Microbiol. 1990; 1: 196-204.
(3) Jagnow J, Clegg S. Klebsiella pneumoniae MrkD-mediated biofilm formation on extracellular matrix-and collagen-coated surfaces. Microbiology. 2003; 149 (9): 2397-405.
(4) Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms: a common cause of persistent infections. Science. 1999; 284 (5418): 1318-22.
(5) Jacobsen Sá, Stickler D, Mobley H, Shirtliff M. Complicated catheter-associated urinary tract infections due to Escherichia coli and Proteus mirabilis. Clinical microbiology reviews. 2008; 21 (1): 26-59.
 
(6) Wu MC, Lin TL, Hsieh PF, Yang HC, Wang JT. Isolation of genes involved in biofilm formation of a Klebsiella pneumoniae strain causing pyogenic liver abscess. PloS one. 2011; 6 (8): e23500.
(7) Zhu H, Liu HJ, Ning SJ, Gao YL. A luxS-dependent transcript profile of cell-to-cell communication in Klebsiella pneumoniae. Molecular bioSystems. 2011; 7 (11): 3164-8.
(8) Thakkar KN, Mhatre SS, Parikh RY. Biological synthesis of metallic nanoparticles. Nanomedicine : nanotechnology, biology, and medicine. 2010; 6 (2): 257-62.
(9) Torabi zarchi m, Mirhosseini M. Investigation of Combination Effect of Magnesium Oxide and Iron Oxide Nanoparticles on the Growth And Morphology of the Bacteria Staphylococcus Aureus and Escherichia Coli in Juice. The Journal of Shahid Sadoughi University of Medical Sciences. 2017; 24 (11): 924-37.
(10)           Durán N, Marcato PD, De Souza GI, Alves OL, Esposito E. Antibacterial effect of silver nanoparticles produced by fungal process on textile fabrics and their effluent treatment. Journal of biomedical nanotechnology. 2007; 3 (2): 203-8.
(11)           Husseiny MI, El-Aziz MA, Badr Y, Mahmoud MA. Biosynthesis of gold nanoparticles using Pseudomonas aeruginosa. Spectrochimica acta Part A, Molecular and biomolecular spectroscopy. 2007; 67 (3-4): 1003-6.
(12)           Guzmán MG, Dille J, Godet S. Synthesis of silver nanoparticles by chemical reduction method and their antibacterial activity. Int J Chem Biomol Eng. 2009; 2 (3): 104-11.
(13)           Lima E, Guerra R, Lara V, Guzmán A. Gold nanoparticles as efficient antimicrobial agents for Escherichia coli and Salmonella typhi. Chemistry Central Journal. 2013; 7 (1): 11.
(14)           Suresh K, Prabagaran S, Sengupta S, Shivaji S. Bacillus indicus sp. nov., an arsenic-resistant bacterium isolated from an aquifer in West Bengal, India. International journal of systematic and evolutionary microbiology. 2004; 54 (4): 1369-75.
(15)           Bhainsa KC, D'souza S. Extracellular biosynthesis of silver nanoparticles using the fungus Aspergillus fumigatus. Colloids and surfaces B: Biointerfaces. 2006; 47 (2): 160-4.
(16)           Song JY, Kim BS. Rapid biological synthesis of silver nanoparticles using plant leaf extracts. Bioprocess and biosystems engineering. 2009; 32 (1): 79.
(17)           Saif S, Tahir A, Chen Y. Green synthesis of iron nanoparticles and their environmental applications and implications. Nanomaterials. 2016; 6 (11): 209.
(18)           Yin T, Wu H, Zhang Q, Gao G, Shapter JG, Shen Y, et al. In vivo targeted therapy of gastric tumors via the mechanical rotation of a flower-like Fe 3 O 4@ Au nanoprobe under an alternating magnetic field. NPG Asia Materials. 2017; 9 (7): e408.
(19)           Zhang Q, Yin T, Xu R, Gao W, Zhao H, Shapter JG, et al. Large-scale immuno-magnetic cell sorting of T cells based on a self-designed high-throughput system for potential clinical application. Nanoscale. 2017; 9 (36): 13592-9.
(20)           Blakemore R. Magnetotactic bacteria. Science. 1975; 190 (4212): 377-9.
(21)           Zhang X, Yan S, Tyagi R, Surampalli R. Synthesis of nanoparticles by microorganisms and their application in enhancing microbiological reaction rates. Chemosphere. 2011; 82 (4): 489-94.
(22)           Fatemi M, Mollania N, Momeni-Moghaddam M, Sadeghifar F. Extracellular biosynthesis of magnetic iron oxide nanoparticles by Bacillus cereus strain HMH1: Characterization and in vitro cytotoxicity analysis on MCF-7 and 3T3 cell lines. Journal of biotechnology. 2018; 270: 1-11.
(23)           Sundaram PA, Augustine R, Kannan M. Extracellular biosynthesis of iron oxide nanoparticles by Bacillus subtilis strains isolated from rhizosphere soil. Biotechnology and bioprocess engineering. 2012; 17 (4): 835-40.
(24)           Nahar A, Anwar S, Saleh AA, Miah MRA. Isolation of Acinetobacter species and their antimicrobial resistance pattern in an Intensive Care Unit (ICU) of a tertiary care hospital in Dhaka, Bangladesh. Bangladesh Journal of Medical Microbiology. 2012; 6 (1): 3-6.
(25)           Nahar A, Anwar S, Miah MRA. Association of biofilm formation with antimicrobial resistance among the Acinetobacter species in a tertiary care hospital in Bangladesh. Journal of Medicine. 2013; 14 (1): 28-32.
(26)           Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C (T) method. Nat Protoc. 2008; 3 (6): 1101-8.
(27)           Borer A, Saidel-Odes L, Riesenberg K, Eskira S, Peled N, Nativ R, et al. Attributable mortality rate for carbapenem-resistant Klebsiella pneumoniae bacteremia. Infection control and hospital epidemiology. 2009; 30 (10): 972-6.
(28)           Mohanraj V, Chen Y. Nanoparticles-a review. Tropical journal of pharmaceutical research. 2006; 5 (1): 561-73.