نوع مقاله : پژوهشی- فارسی

نویسندگان

1 کارشناس ارشد گروه میکروبیولوژی، دانشگاه آزاد اسلامی، واحد سیرجان، سیرجان، ایران

2 استادیار گروه میکروبیولوژی، دانشگاه آزاد اسلامی، واحد سیرجان، سیرجان، ایران

3 دانشیار گروه میکروبیولوژی، دانشکدۀ علوم پایه، دانشگاه آزاد اسلامی، واحد ساوه، ساوه، ایران

10.22108/bjm.2020.120339.1247

چکیده

چکیده
مقدمه: فولیک‌اسید یا ویتامین B9 از مهم‌ترین ویتامین‌های ضروری بدن است که نقش اساسی در انتقال گروه‌های یک‌کربنه و بسیاری از مسیرهای بیوشیمیایی دارد و کمبود آن موجب بروز بیماری‌های عصبی، کم‌خونی و مشکلات رشد در کودکان می‌شود. هدف مطالعۀ حاضر، جداسازی ژن رمز‌کنندۀ فولیک‌اسید از باسیل‌های خاک، توالی‌یابی آن و همسانه‌سازی این ژن در باکتری اشریشیا کلی بود تا بتوان گام مؤثری در راستای تولید صنعتی این ویتامین از سویه‌های بومی برداشت
مواد و روش‏‏ها: در مطالعۀ حاضر، 40 نمونه از عمق 10 تا 15 سانتی‌متری خاک مناطق مختلف اطراف شهر سیرجان نمونه‌برداری شدند. باکتری‌های باسیلوس با استفاده از محیط‌کشت Skim milkجداسازی و با روش‌های مولکولی و بیوشیمیایی شناسایی شدند. جدایه‌های دارای ژن FOLA به کمک روش مولکولی PCR مشخص شدند و ژن تکثیرشده در باکتری E. coliهمسانه‌سازی و توالی‌یابی شد؛ سپس بیان ژن به روش Real-time PCR بررسی و روابط فیلوژنتیکی آن مشخص شد.
نتایج: درنتیجۀ غربال‌گری نمونه‌های خاک ارسالی به آزمایشگاه، درمجموع 12 کلنی مشکوک به باسیل‌های گرم مثبت جداسازی شدند که بر اساس ویژگی‌های ریخت‌شناختی، میکروسکوپی و آزمون‌‌های بیوشیمیایی شناسایی‌ شدند و مشخص شد همۀ گونه‌ها ژن FOLA را دارند. همسانه‌سازی FOLA در یکی از گونه‌ها به‌طور موفقیت‌آمیز انجام و بیان ژن آن با Real-time PCRتأیید شد.
بحث و نتیجه‏گیری: در بررسی حاضر، ژن FOLA از باکتری باسیلوس هالوتولرانس جداشده از خاک‌های مناطق اطراف شهر سیرجان با موفقیت در وکتور بیانی PTG19-T همسانه‌سازی شد و بیان موفقیت‌آمیز ژن نشان داد می‌توان با گسترش این روش، گامی در راستای تولید صنعتی فولات برداشت.

کلیدواژه‌ها

عنوان مقاله [English]

Isolation and sequencing of Folic acid production gene from soil bacilli and its cloning in Escherichia coli

نویسندگان [English]

  • Keyvan Hadjghanbari 1
  • Nooshin Khandan dezfully 2
  • Kumarss Amini 3

1 Master Student, Department of Microbiology, Sirjan Branch, Islamic Azad University, Sirjan, Iran

2 Faculty Member, Department of Microbiology, Sirjan Branch, Islamic Azad University, Sirjan, Iran.

3 Department of Microbiology, School of Basic Sciences, Saveh Branch, Islamic Azad University, Saveh, Iran.

چکیده [English]

Introduction: Folic acid or vitamin B9 is one of the most essential vitamins, which plays a key role in the transport of carbon and many biochemical pathways and its deficiency can lead to neurological diseases, anemia and developmental problems in children. The present study aimed to take a step towards producing this vitamin from native strains by isolating and sequencing the folic acid production gene from soil isolated bacillus and cloning it in Escherichia coli.
Materials and Methods: In this study, 40 samples were collected from 5-10 cm depth from different areas around Sirjan city. Bacillus bacteria were isolated by molecular and biochemical methods. By PCR method, bacteria with FOLA gene were identified and the amplified gene was cloned into E. coli and sequenced. Gene expression was then evaluated by Real time PCR and its phylogenetic relationships were determined.
Results: As a result of screening of 40 soil samples sent to the laboratory, a total of 12 suspected colonies were isolated from Gram-positive bacilli which were identified based on morphological, microscopic and biochemical characteristics and all species were identified as having FOLA gene. FOLA cloning was performed successfully and confirmed its gene expression.
Conclusion: In the present study, the FOLA gene from Bacillus Halotolerance isolated from the soils of the surrounding areas of Sirjan was successfully cloned into PTG19-T expression vector and its successful expression showed that it could be expanded by this method for industrial production of Folate.

کلیدواژه‌ها [English]

  • Cloning
  • Bacillus
  • Folate

مقدمه

باسیلوس‌ها، باکتری‌های گرم مثبت، هوازی اجباری یا بی‌هوازی اختیاری، کاتالاز مثبت و میله‌ای‌شکلند که در شرایط خاصی اسپور تولید می‌کنند. این موجودات معمولاً به‌شکل ساپروفیت در آب و خاک دیده می‌شوند و امروزه به‌علت داشتن توان تولید پروتئین‌ها، ویتامین‌ها و آنزیم‌های مختلف اهمیت دارند؛ به‌طوری‌که ارزش تولید این محصولات به‌واسطۀ باکتری‌ها به میلیاردها دلار می‌رسد. باکتری‌های یادشده منبع تولید آنتی‌بیوتیک‌ها، طعم‌دهنده‌ها (مانند نوکلئوزیدهای پورینی) و سورفکتانت‌ها نیز به شمار می‌آیند (1-3).

فولیک‌اسید که با عنوان ویتامین B9 شناخته می‌شود، از مهم‌ترین ویتامین‌های ضروری بدن است که نقشی اساسی در انتقال گروه‌های یک‌کربنه و بسیاری از مسیرهای بیوشیمیایی ایفا می‌کند. مطالعه‌های مختلف نقش فولات را در فرایند سوخت‌وساز، تولید نوکلئیک‌اسیدها، خون‌سازی و تکوین اعصاب محیطی اثبات کرده‌اند (4-6). کمبود فولات در کشورهای درحال توسعه و مناطق مشخصی از کشورهای توسعه‌یافته مسئلۀ مهمی است که ممکن است پیامدهای درخور توجهی برای سلامتی به همراه داشته باشد. فولات در کارایی همانندسازی، ترمیم و متیلاسیون DNA مؤثر است و به‌همین‌علت، مقادیر بسیار کم فولات با افزایش خطر بروز حمله‌های قلبی و سکته‌های مغزی پیوند خورده است و موجب اختلال رشد، کم‌خونی ماکروسیتیک، اسهال، نوروپاتی محیطی و نقص‌های لولۀ عصبی در جنین می‌شود (7 و 8)؛ همچنین ممکن است سبب ایجاد بسیاری از بیماری‌ها و اختلال‌ها ازجمله نقص‌های لولۀ عصبی و کم‌خونی مگالوبلاستیک شود. در پژوهش‌های اخیر، ارتباط بین وضعیت فقر فولات و اختلال‌های پیش‌روندۀ عصبی ازجمله بیماری آلزایمر، سکتۀ مغزی و چندین نوع سرطان (سرطان خون، رودۀ بزرگ، پستان، لوزالمعده، دهانۀ رحم و نایژه) و خطر زیاد ابتلا به بیماری‌های قلبی و عروقی گزارش شده است؛ همچنین پژوهش‌های اپیدمیولوژیک اثبات کرده‌‌اند افزایش مصرف مکمل‌های حاوی فولات احتمال بروز سکتۀ قلبی، سرطان، کم‌خونی و آلزایمر را به‌طور درخور توجهی کاهش می‌دهد (9 و 10).

ازآنجاکه تنها گیاهان و ریزموجودات می‌توانند فولات تولید کنند، رژیم غذایی تنها منبع این ویتامین برای انسان است. سبزی‌های برگ‌سبز، میوه‌های خاص ازجمله مرکبات و توت‌فرنگی، جگر، تخم‌مرغ، مخمر و همچنین آبجو، ماست و سایر فراورده‌های تخمیری سرشار از فولاتهستند؛ همچنین ریزموجودات اصلاح‌شده ازنظر ژنتیکی می‌توانند برای زیست‌غنی‌سازی فراورده‌های تخمیری استفاده شوند (11).

در مطالعه‌های مختلف، ریزموجودات بسیاری ازجمله باسیلوس سوبتیلیس[1] (12)، لاکتوباسیل کازئی[2] (13)، دروزوفیلا ملانوگاستر[3] (14)، کلورلا ولگاریس[4] (15)، لاکتوکوکوس[5] (16) و لاکتوباسیلوس[6] (17) معرفی شده‌اند که توانایی تولید فولیک‌اسید را دارند. در باسیلوس‌ها و در اوپرون اصلی فولیک، سه ژن FOLK، FOLAو sulبه‌ترتیب آنزیم‌‌های پیروفسفوکیناز، دی‌هیدرونئوپترین‌آلدولاز و دی‌هیدروپتروئات‌سنتاز را کد می‌کنند که مهم‌ترین آنزیم‌ها در مسیر تولید پیش‌سازهای مسیر سنتر فولات هستند. در باسیلوس‌ها، ژن FOLA آنزیم 21 آمینواسیدی دی‌هیدرونئوپترین‌آلدولاز را کد می‌کند و وجودنداشتن آن در ژنوم باکتری موجب ناتوانی ریزموجود در تولید فولات می‌شود (18).

امروزه، غنی‌سازی مواد غذایی از طریق افزودن مواد ریزمغذی مانند روی، ویتامین D، کلسیم و سایر ویتامین‌ها به غذاها و شیر ازجمله روش‌های تأییدشدۀ سازمان بهداشت جهانی برای جبران کمبود این مواد در افراد است(19 و 20). کشک یکی از فراورده‌های فرعی شیر است که به روش سنتی از جوشاندن، تغلیظ یا خشک‌کردن دوغی که پس‌از کره‌گیری باقی می‌ماند یا از ماست بدون چربی تهیه می‌شود و تمام خواص شیر کامل را دارد و حاوی کلسیم، چربی، پتاسیم، پروتئین و ویتامین نیاسین است. پیشگیری از بروز یا پیشرفت بیماری پوکی استخوان مهم‌ترین مصرف درمانی کشک است(21-23). ازآنجاکه لبنیات و شیر منبع اصلی ویتامین‌های گروه B به شمار می‌آیند، مطالعۀ حاضر به جداسازی ژن تولید فولیک‌اسید از باسیل‌های خاک، توالی‌یابی آن و درنهایت، همسانه‌سازی این ژن در باکتری اشریشیا کلی[7]می‌پردازد تا گامی برای افزودن سویه‌های بومی پروبیوتیک تولیدکنندۀ فولات به این مواد غذایی بردارد.

 

مواد و روش‌ها

جداسازی باکتری‌ها: در پژوهش حاضر، تعداد 40 نمونه از عمق 10 تا 15 سانتی‌متری خاک مناطق مختلف حاشیۀ شهر سیرجان (کرمان) و باغ‌های اطراف جمع‌آوری و در شرایط استریل به آزمایشگاه منتقل شدند. به‌منظور جداسازی باکتری‌های دارای فعالیت پروتئولیتیک، رقت سریالی 1-10 تا 6-10 از نمونه‌های خاک تهیه شد. در زمینۀ کشت نمونه‌های خاک، به‌منظور کاهش تعداد شکل‌های رویشی و با هدف جداسازی سویه‌های باسیلوس از خاک هواخشک استفاده شد.

مقدار 2/0 میلی‌لیتر از تمام رقت‌های تهیه‌شده برای هر نمونۀ خاک در سطح محیط تریپتیک‌سوی‌آگار ریخته شد و با پخش‌کنندۀ شیشه‌ای به‌طور یکنواخت در تمام سطح محیط پخش شد؛ سپس نمونه‌ها به‌مدت 72 ساعت در شرایط هوازی و دمای 30 درجۀ سانتی‌گراد گرمخانه‌گذاری و درنهایت، ازنظر رشدکردن یا رشدنکردن و کلنی‌های مشکوک به باسیلوس بررسی شدند.

از محتویات لوله‌ها به‌طور جداگانه در محیط‌کشت اختصاصی skim milk (Merck, Germany) حاوی 50گرم شیرخشک بدون چربی، 5 گرم کازئین، 5/2 گرم عصارۀ مخمر، 1 گرم گلوکز و 5/12 گرم آگار در هر لیتر کشت داده شد و به‌مدت 48 ساعت در دمای 37 درجۀ سانتی‌گراد گرمخانه‌گذاری شد؛ سپس شناسایی دقیق‌تر باکتری‌های باسیلوس دارای فعالیت پروتئولیتیک به روش‌های بیوشیمیایی ازجمله آزمون‌های اوره، کاتالاز، حرکت، MR-VP و رنگ‌آمیزی گرم ادامه یافت و درنهایت پس‌از تأیید باکتری باسیلوس بر اساس ویژگی‌های ظاهری کلنی، ویژگی‌های میکروسکوپی و آزمون‌های بیوشیمیایی، شناسایی مولکولی بر اساس بررسی واکنش زنجیره‌ای پلیمراز (PCR) توالی 16S rDNA برای تأیید نهایی گونۀ باسیلوس انجام شد.

شناسایی مولکولی: روش‌های مولکولی برای تمایز باسیلوس‌های دارای ژن رمزکنندۀ فولات (FOLA) استفاده شدند. استخراج DNA با استفاده از کیت اختصاصی (Cinna Gen, Iran) و با‌توجه‌به دستورعمل سازنده انجام شد. پس‌از تأیید کیفیت به روش الکتروفورز و با دستگاه نانودراپ (Eppendorf, Germany)، آغازگرهای اختصاصی ژن FOLA با نرم‌افزار Gene runner طراحی و در سایت NCBI بلاست شدند تا اختصاصیت آنها تأیید شود. جدول 1، آغازگرهای استفاده‌شده در مطالعۀ حاضر را نشان می‌دهد. واکنش زنجیره‌ای پلیمراز (PCR) برای هر واکنش شامل 10 میکرولیتر PCR Master Mix 2x  (Cinna Gen, Iran)، 1 میکرولیتر از هرکدام از آغازگرها با غلظت 10 پیکومول‌بر‌میکرولیتر، 4 میکرولیتر از DNA الگو (150 نانوگرم) و 4 میکرولیتر آب مقطر در حجم نهایی 20 میکرولیتر بود. مراحل دمایی واکنش PCR به شرح زیر انجام شد: ابتدا مرحلۀ دناتوراسیون اولیه در دمای 95 درجۀ سانتی‌گراد به‌مدت 5 دقیقه، 35 چرخه شامل دناتوراسیون در 95 درجۀ سانتی‌گراد به‌مدت 30 ثانیه، مرحلۀ اتصال آغازگر در دمای 56 درجۀ سانتی‌گراد به‌مدت 30 ثانیه و مرحلۀ تکثیر در دمای 72 درجۀ سانتی‌گراد به‌مدت 1 دقیقه و پس‌از 35 چرخه، مرحلۀ تکثیر نهایی در دمای 72 درجۀ سانتی‌گراد به‌مدت 10 دقیقه. محصولات PCR در حضور شاهد مثبت و منفی در ژل آگارز 5/1 درصد الکتروفورز و پس‌از رنگ‌آمیزی با اریتروژل به کمک دستگاه ژل‌داک، عکس‌برداری شدند.

همسانه‌سازی ژن فولات: روش Cloning TA، روش نسبتاً جدیدی است که بسیار ساده‌تر و مطمئن‌تر از روش‌های قدیمی همسانه‌سازی ژن در باکتری یا پلاسمید عمل می‌کند و نیازی به استفاده از آنزیم‌های محدوداثر وجود ندارد. در مطالعۀ حاضر، کیت PCR TA-Cloning (Cinna Gen, Iran) برای همسانه‌سازی سریع‌تر و مؤثرتر محصول PCR استفاده شد. با‌توجه‌به دستورعمل کیت همسانه‌سازی، محصول PCR به‌دست‌آمده با 1 میکرولیتر آنزیم T4 Ligase، 1 میکرولیتر بافر، 2 میکرولیتر وکتور خطی pTG19-T، 5/1 میکرولیتر محصول PCR و 5/4 میکرولیتر آب مقطر استریل مخلوط شد و سپس به‌مدت یک ساعت در 22 درجۀ سانتی‌گراد قرار داده شد تا ژن هدف به وکتور متصل شود. در مرحلۀ بعد، وکتور به میزبانEscherichia coli XL-1 blue (تهیه‌شده از دانشگاه تهران) منتقل و در محیط‌کشت LB مایع بدون آنتی‌بیوتیک به‌مدت 1 ساعت در 37 درجۀ سانتی‌گراد کشت داده شد. باکتری منتقل‌شده در پلیت حاوی LBآگار حاوی 100 میلی‌گرم‌بر‌میلی‌لیتر آمپی‌سیلین، 200 میلی‌گرم‌بر‌میلی‌لیتر IPTG (Isopropylthio-β-D-galactoside) و 20 میلی‌گرم‌بر‌میلی‌لیتر X-Gal (5-bromo-4-chloro-3-indolyl-a-D-galactoside). کشت و به‌مدت 12 ساعت در دمای 37 درجۀ سانتی‌گراد گرمخانه‌گذاری شد. همسانه‌سازی ژنی با غربال‌گری کلنی‌های سفید (حاوی ژن نوترکیب) و کلنی‌های آبی با لیگاسیون ناموفق و ژن غیرنوترکیب تأیید و توالی یادشده برای توالی‌یابی به آزمایشگاه پاسارگاد فرستاده شد تا با ارسال به شرکت Bioneer کرۀ جنوبی تعیین توالی شود.

 

 

جدول 1- آغازگرهای استفاده‌شده در مطالعۀ حاضر

اندازۀ باند (جفت باز)

توالی آغازگرها

آغازگر

144

CTGGCTGGTGTTGGTAGAACAG

FOLA-F

AGGCCCCGAGGACAAGTT

FOLA-R

1500

AGAGTTTGATCCTGGCTCAG

16s-F

AAGGAGGTGATCCAGCCGCA

16s-R

F=forward primer, R=reverse primer


.تعیین میزان بیان ژن FOLA در باکتری میزبان: به‌منظور بررسی میزان بیان ژن FOLA به روش Real-time PCR، باکتری نوترکیب گرمخانه‌گذاری شد تا روند بیان ژن طی شود؛ پس‌از 15 ساعت گرمخانه‌گذاری، استخراج RNA با استفاده از کیت اختصاصی (Cinna Gen, Iran) و باتوجه‌‌به دستورعمل آن انجام شد و پس‌از تأیید کیفیت RNA استخراج‌شده با دستگاه نانودراپ، سنتز cDNA با استفاده از آنزیم Reverse AMV (غلظتµl/unit  25) و کیت اختصاصی آن (Roche, Germany) انجام شد. واکنش زنجیره‌ای پلیمراز در حجم 20 میکرولیتر با استفاده از کیت شرکت Genet bio CAT. NO: Q1469، کرۀ جنوبی به شرح زیر انجام و 10 میکرولیتر Prime Qmaster mix (2x) with syber green، 5 میکرولیتر Depc water، 1 میکرولیتر آغازگر رفت، 1 میکرولیتر آغازگر برگشت، 1 میکرولیتر Rox dyeو2 میکرولیتر cDNA استفاده شد. تکثیر قطعه‌های مدنظر در دستگاه Corbet (Corbet, Australia) با برنامۀ دناتوراسیون اولیه در 95 درجۀ سانتی‌گراد به‌مدت 1 دقیقه، تکثیر در 95 درجۀ سانتی‌گراد به‌مدت 30 ثانیه، 59 درجۀ سانتی‌گراد به‌مدت 40 ثانیه و 72 درجۀ سانتی‌گراد به‌مدت 60 ثانیه در 35 چرخه انجام شد. ژن خانگی بتااکتین برای شاهد درونی آزمون استفاده شد.

رسم درخت فیلوژنتیکی: نتایج توالی‌یابی توالی‌های به‌دست‌آمده با نرم‌افزار Bio Edit بررسی شدند و پس‌از اطمینان‌ از درستی توالی‌هـای بـه‌دسـت‌آمـده، رشتة واحدی (از'5 به '3) از دو رشتۀ توالی‌یابی‌شدة مسـتقیم و معکـوس با نـرم‌فـزارDNA Baser  مرتب شد. تـوالی‌‌هـای حاصـل بـا جدایه‌های ثبت‌شده در NCBI مقایسه شـدند، هـر تـوالی بـه‌طـور جداگانـه با نـرم‌افـزار Blast n در بانـک ژن جسـتجو شـد و توالی‌های حاصل از  Blastبا نرم‌‌افزار Clustal W هم‌ردیـف شدند. تجزیه‌و‌تحلیل فیلوژنتیکی با برنامۀ MEGA7 انجام شد.

 

نتایج

نتایج جداسازی باکتری: درنتیجۀ غربال‌گری 40 نمونه خاک ارسال‌شده به آزمایشگاه، درمجموع تعداد 12 کلنی مشکوک به باسیل‌های گرم مثبت جداسازی شد که بر اساس ویژگی‌های ریخت‌شناختی، میکروسکوپی و آزمون‌های بیوشیمیایی با عنوان باسیلوس شناسایی شدند. در مطالعۀ حاضر بر اساس روش‌های تشخیصی عنوان‌شده در کتاب Bergey، باسیل‌های گرم مثبت که آزمون‌های MR-VP، سیمون‌سیترات، کاتالاز و TSI آنها مثبت و آزمون‌های احیای نیترات، ایندول، اوره‌آز و اکسیداز منفی آنها منفی بود، برای تمایز مولکولی انتخاب شدند.

.نتیجۀ آزمون PCR به‌منظور شناسایی باکتری‌های دارای ژن هدف: واکنش PCR برای ژن FOLA با آغازگرهای یادشده در جدول 1 انجام شد و نتایج در شکل 1 دیده می‌شوند. تمام 12 سویه باسیلوس جداشده ژن FOLA را داشتند (شکل 1). به‌منظور شناسایی مولکولی جنسباسیلوس حامل ژن FOLA از آغازگرهای عمومی 16S استفاده شد (شکل 2).

 

 

شکل 1- نتیجۀ آزمون PCR به‌منظور شناسایی ژن فولات

 

شکل 2- نتیجۀ آزمون PCR با آغازگرهای عمومی 16S rDNA به‌منظور تعیین هویت مولکولی جنس باسیلوس

 

نتایج همسانه‌سازی ژن فولات: پس‌از همسانه‌سازی سویۀ حامل ژن فولات در فرایند انتخاب کلنی (آبی/سفید)، سویه‌های همسانه‌سازی‌‌شده جداسازی شدند. طبق اصول کیت، چنانچه ژن هدف وارد وکتور شده باشد، ژن Lac z تخریب می‌شود، باکتری نمی‌تواند از X-gal استفاده کند و کلنی‌های سفید در محیط‌کشت تشکیل می‌شوند؛ بنابراین کلنی‌‌های سفید، باکتری‌های با DNA نوترکیب و کلنی‌های آبی، همسانه‌سازی ناموفق در نظر گرفته می‌شوند.

به‌منظور تأیید نتایج همسانه‌سازی، DNA از کلنی‌های مشکوک استخراج و ورود ژن‌هایفولات به باکتری Escherichia coliXL-1 blueبا آزمون PCRو توالی‌یابی محصول PCR تأیید شد (شکل 3) و درنهایت، محصول PCR برای توالی‌یابی به شرکت Bioneer ارسال و BLAST شد (شکل 4)؛ همچنین بیان ژن یادشده به‌طور موفقیت‌آمیز با Real-time PCR سنجش و مشخص شد فولات در باکتری میزبان بیان شده است (شکل 5).

 

 

شکل 3- تأیید همسانه‌سازی به کمک PCR با آغازگرهای M13 وکتور

 

 

 

شکل 4- نتایج توالی‌یابی ژن فولات

 

شکل 5- نتایج بیان ژن فولات در باکتری هدف؛ بیان ژن 16S rDNA شاهد در نظر گرفته شده است. رنگ‌های فیروزه‌ای و آبی نشان‌دهندۀ بیان ژن شاهد به‌ترتیب در باکتری‌های E. Coliهمسانه‌سازی‌نشده و همسانه‌سازی‌شده‌اند، رنگ سبز نشان‌دهندۀ بیان ژن هدف همسانه‌سازی‌شده در E. Coli و رنگ زرد نشان‌دهندۀ بیان ژن هدف در E. Coli بدون همسانه‌سازی‌شدن است. no template control=NTC

 


نتایج درخت فیلوژنتیکی: پس‌از توالی‌یابی، بررسی ارتباط فیلوژنتیکی به روش پیوند هم‌جوار (NJ) انجام شد و نتایج آن نشـان دادند گونه‌های باسیلوس سابتیلیس و باسیلوس هالوتولرانس[8] در یک خوشه قرار می‌گیرند که بیان‌کنندۀ رابطۀ خویشاوندی نزدیک آنها با یکدیگر است (شکل 6). داده‌ها نشان دادند باکتری دارای ژن هدف در مطالعۀ حاضر، باسیلوس هالوتولرانس AH38 است.

 

 

 

شکل 6- درخت فیلوژنی رسم‌شده بر اساس توالی ژن 16S rDNA؛ علامت Sample1 در ابتدای درخت نشان‌دهندۀ نزدیکی باکتری جداسازی‌شده به باسیلوس هالوتولرانس است.


بحث و نتیجه‌گیری

فولات نوعی ویتامین ضروری برای بدن است که کمبود آن به بروز بیماری‌‌هایی نظیر کم‌خونی شدید، سرطان و آسیب‌های جبران‌ناپذیر عصبی منجر می‌شود. باتوجه‌به مزیت‌‌‌های تولید پروتئین‌‌های ضروری از طریق عوامل باکتریایی، جداسازی آنزیم‌های راهبردی در صنایع دارویی و غذایی از مهم‌ترین زمینه‌های پژوهشی دانشمندان طی سال‌های اخیر بوده است (24 و 25). بررسی‌ها نشان می‌دهند تولید گستردۀ فولیک‌اسید به‌طور تجاری برای غنی‌سازی آن در مواد غذایی ازجمله لبنیات مفید است (26). این آنزیم را می‌تواناز منابع محدودی ازجمله باسیلوس‌ها استخراج کرد؛ بنابراین، نیاز به تکثیر ژن این ویتامین از منابع باکتریایی تولیدکنندۀ آن اهمیت ویژه‌ای دارد. مطالعۀ حاضر بر آن بود تا با جداسازی ژن FOLA از باسیلوس‌های خاک و همسانه‌سازی آن در باکتری میزبان اشریشیا کلی، گامی در راستای صنعتی‌سازی این فرایند با مطالعه روی سویه‌های بومی ایران بردارد که به‌طور موفقیت‌آمیز انجام شد و نتایج بیان ژن هدف آن را تأیید کردند.

جستجوی شباهت توالی ژن 16S rDNA سویۀ مدنظر در پایگاه داده‌ای اطلاعات (NCBI) نشان داد سویۀ جداسازی‌شده در مطالعۀ حاضر شباهت زیادی به گونۀ باسیلوس هالوتولرانس (با شمارۀ دسترسی MH040966) دارد. بررسی ژنی نشان داد ژن FOLA در 12 سویه باسیلوس جداشده وجود دارد.

Ahire و همکاران در مطالعه‌ای (2013) به بررسی تولید فولات در لاکتوباسیلوس هلوتیکوس پرداختند و درنتیجه، مشتق 5 متیل‌ تتراهیدروفولات تولید شد؛ همچنین مشخص شد فولات تولیدی دارای آثار آنتی‌بیوتیکی روی باکتری‌های استرپتوکوکوس پیوژنز[ix]، استافیلوکوکوس اورئوس[x]و سالمونلا[xi] است (27). Gangadharan و همکاران در مطالعۀ مشابهی به بررسی امکان تولید فولات در لاکتوکوس لاکتیس[xii] سویۀ کرموریس[xiii] پرداختند و مطالعۀ آنها در راستای هدف پژوهش حاضر و به‌منظور تولید فولات برای غنی‌سازی شیر خوراکی بود؛ در این مطالعه، مقادیر 187 نانوگرم‌بر‌‌میلی‌لیتر فولات دکونژوگه از 5 لیتر بیوراکتور جداسازی شد که عدد درخور توجهی نیست (17). در مطالعه‌ای که Taghiabadi و همکاران در سال 2018 انجام دادند، تولید گلوتامیک‌‌اسید و فولیک‌اسید در پروبیوتیک‌های هوازی و بی‌هوازی بررسی شد؛ در این مطالعه، گلوتامیک‌اسید موجود در ریزموجودات با کروماتوگرافی لایۀ نازک بررسی و میزان فولیک‌اسید با کیت فولات اندازه‌گیری شد. هرکدام از باکتری‌ها نیز از نظر کمّی و کیفی با دستگاه کروماتوگرافی مایع با فشار زیاد اندازه‌‌گیری شدند و میزان فولات در باکتری بیفیدوباکتریوم[xiv]، 315 میلی‌گرم‌برمیلی‌لیتر تعیین شد (18) که عدد مناسبی در محیط آزمایشگاهی نسبت به سایر مطالعه‌ها به شمار می‌آید. در مقایسه با سویه‌‌های سایر مناطق جهان می‌توان به مطالعۀ Leblanc و همکاراش (28) اشاره کرد که در آن، تولید فولات از باکتری‌های لاکتوباسیلوس پلانتاروم[xv] و لاکتوباسیلوس اسیدوفیلوس[xvi] به‌‌‌ترتیب برابر با 45 و 1 میکروگرم‌بر‌لیتر گزارش شده است؛ این مقایسه نشان می‌دهد سویه‌های بومی ایران ظرفیت زیادی برای تولید فولیک‌اسید دارند.

نقش ژن FOLA در روند بیوسنتز THF-polyglutamate اثبات شده است، اما تاکنون مطالعه‌ای در زمینۀ همسانه‌سازی سایر ژن‌های دخیل در روند تولید فولات به روش TA-cloning انجام نشده است؛ این نکته می‌تواند نوآوری دیگر پژوهش حاضر در کنار استفاده از سویه‌های بومی در نظر گرفته شود. یافته‌ها نشان می‌دهند اغلب تولیدکنندگان فولات در سایر مناطق جهان از بین سویه‌های لاکتوباسیلوس جداسازی شده‌اند (29)؛ درحالی‌که مطالعۀ حاضر، خاصیت بیان ژن فولات را در باکتری‌های باسیلوس هالوتولرانس کشف کرد (29). در مطالعه‌های متعددی گزارش شده است اشریشیا کلی به‌شکل میزبان و به‌طور گسترده برای بیان پروتئین‌های نوترکیب در پژوهش‌ها و صنعت به کار می‌رود (30 و 31)، اما روش‌های همسانه‌‌سازی به‌‌کاررفته در آنها سنتی است. مطالعۀ حاضر در تأیید امکان بیان ژن FOLA در اشریشیا کلی نشان داد روش TA همسانه‌سازی، روش مناسبی برای همسانه‌سازی این ژن است.

 

نتیجه‌گیری

همسانه‌سازی ژن فولات و بیان آن در مطالعۀ حاضر به‌طور موفقیت‌آمیز انجام شد. داده‌های مطالعۀ حاضر نشان دادند باوجود محدودیت‌ها، استفاده از گونه‌های تولید‌کنندۀ فولات با تمرکز بیشتر روی سویه‌های بومی می‌تواند بستر جدیدی را برای صنعتی‌سازی تولید این ماده در ایران و کاهش واردات آن به‌طور پیش‌ساز داروها در نظر گرفته شود.



[1]- Bacillus subtilis

[2]- Lactobacillus casei

[3]- Drosophila melanogaster

[4]- Chlorella vulgaris

[5]- Lactococcus

[6]- Lactobacillus

[7]- Escherichia coli

[8]- Bacillus halotolerans

[ix]- Streptococcus pyogenes

[x]- Staphylococcus aureus

[xi]- Salmonella

[xii]- Lactococcus lactis

[xiii]- cremoris

[xiv]- Bifidobacterium

[xv]- Lactobacillus plantarum

[xvi]- Lactobacillus acidophilus

(1)              Li W., Jiang M., Zhao S., Liu H., Zhang X., Wilson J., et al. Folic acid inhibits amyloid β-peptide production through modulating DNA methyltransferase activity in N2a-APP cells. International Journal of Molecular Sciences 2015; 16(10): 25002-25013.
(2)              Berry RJ. Lack of historical evidence to support folic acid exacerbation of the neuropathy caused by vitamin B12 deficiency. The American Journal of Clinical Nutrition 2019; 110(3): 554-561.
(3)              Ferrer-Polonio E., Fernández-Navarro J., Alonso-Molina JL., Mendoza-Roca JA., Bes-Piá A., Amorós I. Towards a cleaner wastewater treatment: Influence of folic acid addition on sludge reduction and biomass characteristics. Journal of Cleaner Production 2019; 232: 858-866.
(4)              Ismail WRW., Rahman RA., Rahman NAA., Atil A., Nawi AM. The protective effect of maternal folic acid supplementation on childhood cancer: A systematic review and meta-analysis of case-control studies. Journal of Preventive Medicine and Public Health 2019; 52(4): 205.
(5)              Iglesias Vázquez L., Canals J., Arija V. Review and meta analysis found that prenatal folic acid was associated with a 58% reduction in autism but had no effect on mental and motor development. Acta Paediatrica 2019; 108(4): 600-610.
(6)              Wang Y., Jin Y., Wang Y., Li L., Liao Y., Zhang Y., et al. The effect of folic acid in patients with cardiovascular disease: A systematic review and meta-analysis. Medicine 2019; 98(37)
(7)              Ly L., Chan D., Aarabi M., Landry M., Behan NA., MacFarlane AJ., et al. Intergenerational impact of paternal lifetime exposures to both folic acid deficiency and supplementation on reproductive outcomes and imprinted gene methylation. MHR: Basic Science of Reproductive Medicine 2017; 23(7): 461-477.
(8)              Sun A., Chen HM., Cheng SJ., Wang YP., Chang JYF., Wu YC., et al. Significant association of deficiencies of hemoglobin, iron, vitamin B12, and folic acid and highhomocysteine level with recurrent aphthous stomatitis. Journal of Oral Pathology and Medicine 2015; 44(4): 300-305.
(9)              Chang JY-F., Wang Y-P., Wu Y-C., Cheng S-J., Chen H-M., Sun A. Hematinic deficiencies and anemia statuses in oral mucosal disease patients with folic acid deficiency. Journal of the Formosan Medical Association 2015; 114(9): 806-812.
 
(10)          Moll R., Davis B. Iron, vitamin B12 and folate. Medicine 2017; 45(4): 198-203.
(11)          Christensen KE., Mikael LG., Leung K-Y., Lévesque N., Deng L., Wu Q., et al. High folic acid consumption leads to pseudo-MTHFR deficiency, altered lipid metabolism, and liver injury in mice. The American Journal of Clinical Nutrition 2015; 101(3): 646-658.
(12)          Sauer U., Cameron DC., Bailey JE. Metabolic capacity of Bacillus subtilis for the production of purine nucleosides, riboflavin, andfolic acid. Biotechnology and Bioengineering 1998; 59(2): 227-238.
(13)          Bond TJ. Production of folinic acid from folic acid by Lactobacillus casei. Science (Washington) 1953; 117:563-564.
(14)          Blatch S., Meyer KW., Harrison JF. Effects of dietary folic acid level and symbiotic folateproduction on fitness and development in the fruit fly Drosophila melanogaster. Fly 2010; 4(4): 312-319.
(15)          Pratt R., Johnson E. Production of thiamine, riboflavin, folic acid, and biotin by Chlorella vulgaris and Chlorella pyrenoidosa. Journal of Pharmaceutical Sciences 1965; 54(6):871-874.
(16)          Ahire JJ., Patil KP., Chaudhari BL., Chincholkar SB. A potential probiotic culture ST2 produces siderophore 2, 3-dihydroxybenzoylserine under intestinal conditions. Food Chemistry 2011; 127(2): 387-393.
(17)          Gangadharan D., Nampoothiri KM. Folate production using Lactococcus lactis ssp cremoris with implications for fortification of skim milk and fruit juices. LWT-Food Science and Technology 2011; 44(9): 1859-1864.
(18)          Taghiabadi Z., Dehkordi MK., Emtiazi G. Glutamic acid and folic acid production in aerobicand anaerobic probiotics. Biological Journal of Microorganism 2018; 7(25): 127-136.
(19)          Joseph DB., Chandrashekar AS., Chu LF., Thomson JA., Vezina CM. A folic acid enriched diet attenuates prostate involution in response to androgen deprivation. The Prostate 2019; 79(2): 183-194.
(20)          Kancherla V., Averbach H., Oakley Jr GP. Nation wide failure of voluntary folic acid fortification of corn masa flour and tortillas with folic acid. Birth Defects Research 2019; 111(11): 672-675.
(21)          Pérez-Esteve É, Ruiz-Rico M, Fuentes A, Marcos MD, Sancenón F, Martínez-Máñez R, et al. Enrichment of stirred yogurts with folic acid encapsulated in pH-responsive mesoporous silica particles: Bioaccessibility modulation and physico-chemical characterization. LWT-Food Science and Technology 2016; 72: 351-360.
(22)          Altic L., McNulty H., Hoey L., McAnena L., Pentieva K. Validation of folate-enriched eggs as a functional food for improving folate intake in consumers. nutrients 2016; 8(12): 777.
(23)          Moreno J., Espinoza C., Simpson R., Petzold G., Nuñez H., Gianelli M. Application of ohmic heating/vacuum impregnation treatments and air drying to develop an apple snack enriched in folic acid. Innovative Food Science and Emerging Technologies 2016; 33: 381-386.
(24)          Keil KP., Abler LL., Altmann HM., Wang Z., Wang P., Ricke WA., et al. Impact of a folic acid-enriched diet on urinary tract function in mice treated with testosterone and estradiol. American Journal of Physiology-Renal Physiology 2015; 308(12): 1431-1443.
(25)          van Gool JD., Hirche H., Lax H., De Schaepdrijver L. Folic acid and primary prevention of neural tube defects: A review. Reproductive Toxicology 2018; 40: 73-84.
(26)          Grosse SD., Berry RJ., Tilford JM., Kucik JE., Waitzman NJ. Retrospective assessment of cost savings from prevention: folic acid fortification and spina bifida in the US. American Journal of Preventive Medicine 2016; 50(5): S74-S80.
(27)          LeBlanc JG., de Giori GS. وSmid EJ., Hugenholtz J., Sesma F. Folate production by lactic acid bacteria and other food-grade microorganisms In: Méndez-Vilas. editor. Communicating Current Research and Educational Topics and Trends in Applied Microbiology. Badajoz, Spain: Formatex Research Center; 2007: 329-339
(28)          Rossi M, Amaretti A, Raimondi S. Folate production by probiotic bacteria. Nutrients. 2011 Jan;3(1):118-34
(29)          Jahandar M., Nassiri M., Aslaminejad A., Tahmoorespour M., Haghparast A. Cloning of InvG gene from Salmonella Entericain the Expression Vector pET32a and Evaluation of its Expression in hosts BL21-DE3. Journal of Agricultural Biotechnology 2015; 14(3): 75-87.
(30)          Yuan Y., Nymoen DA., Dong HP., Bjørang O., Shih I-M., Low PS, et al. Expression of the folate receptor genes FOLR1 and FOLR3 differentiates ovarian carcinoma from breast carcinoma and malignant mesothelioma in serous effusions. Human Pathology 2009; 40(10): 1453-1460.