بررسی اثر غلظت‌های مختلف سنگ اورانیوم روی بیان ژن cyc2 در باکتری جهش‌یافته Acidithiobacillus sp. FJ2

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 استادیار بیوشیمی بالینی، پژوهشکده مواد و سوخت هسته ای، پژوهشگاه علوم و فنون هسته‌ای، سازمان انرژی اتمی، تهران، ایران

2 دانشجوی دکتری بیوشیمی، دانشگاه پیام نور، واحد تهران شرق، ایران

3 استاد بیوشیمی، گروه زیست‌شناسی، دانشکده علوم پایه، دانشگاه پیام نور، تهران، ایران

چکیده

مقدمه: فرآیند بیولیچینگ اورانیوم با استفاده از باکتری Acidithiobacillus sp. FJ2انجام می‌شود. این باکتری، آهن را از طریق زنجیره انتقال الکترون اکسید می‌کند و محصولات ژن cyc2، از مهم‌ترین اجزای این زنجیره و دخیل در فرایند اکسیداسیون آهن هستند.
مواد و روش‏‏ها: در پژوهش حاضر، بیان ژن cyc2 در باکتری Acidithiobacillus sp. FJ2جهش‌یافته با اشعهUV (60، 120 و 180 ثانیه) در حضور غلظت‌های مختلف سنگ معدن اورانیوم بررسی شد. به این منظور، باکتری‌های جهش‌یافته و وحشی در محیط‌کشت اختصاصی و در حضور غلظت‌های مختلف سنگ معدن اورانیوم کشت شدند. میزان استخراج اورانیوم، تغییرات اسیدیته (pH) و فعالیت اکسیداسیون و احیای (Eh) آنها در توالی‌های 24 ساعته اندازه‌گیری شد. زمانی که بازده استخراج اورانیوم به 100 درصد رسید، بیان ژن cyc2 باکتری جهش‌یافته و وحشی با روش Real-time PCR بررسی شد.
نتایج: نتایج آزمایش‌ها نشان دادند که با افزایش میزان غلظت سنگ، سرعت استخراج اورانیوم و فعالیت اکسیداسیونی باکتری کاهش می‌یابد. همچنین، بیان ژن cyc2 در حضور سنگ معدن اورانیوم نسبت به نمونه عاری از سنگ معدن افزایش می‌یابد و با افزایش بیشتر غلظت سنگ، به علت سمیت فلز سنگین اورانیوم، روند کاهشی نشان می‌دهد.
بحث و نتیجه‏گیری: نتایج پژوهش حاضر نشان می‌دهند که ایجاد جهش در باکتری مدنظر، تأثیر مثبتی بر فرآیند بیولیچینگ اورانیوم و نقش مهمی در فرآیند بیولیچینگ غلظت‌های زیاد سنگ معدن اورانیوم دارد. به علاوه، با افزایش چگالی پالپ به علت سمیت اورانیوم، روند کاهشی در فرآیند استخراج اورانیوم مشاهده می‌شود که نقش مهم این عامل بر فرآیند بیولیچینگ اورانیوم را نشان می‌دهد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Evaluation the effect of uranium ore concentrations on the cyc2 gene expression in the mutated Acidithiobacillus sp. FJ2

نویسندگان [English]

  • Faezeh Fatemi 1
  • Malus Sheydaie 2
  • Reza Haji Hosseini 3
1 Assistant professor Clinical Biochemistry, Materials and Nuclear Fuel Research School, Nuclear Science and Technology Research Institute, Tehran, Iran
2 PhD. Student of Biochemistry, Faculty of Science, Payame Noor Univercity, Tehran, Iran
3 Professor of Biochemistry, Biology Departments, Faculty of Science, Payame Noor Univercity, Tehran, Iran
چکیده [English]

Introduction: The uranium bioleaching process is performed using Acidithiobacillus ferrooxidans. This bacterium is capable of iron oxidation by an electron transport chain. One of the most important components of this chain is the cyc2 gene product that involved in the oxidation process of iron.
Materials and methods: Evaluation of UV mutated (60, 120 and 180s) Acidithiobacillus sp. FJ2 cyc2gene in the presence of uranium ore concentrations, has been implemented in this project. For this purpose, the original and mutated bacteria were cultivated in the presence of uranium ore concentrations (5, 10, 15, 25 and 50%). Uranium extraction, variation of pH and Eh values were measured at 24 h intervals. Then, when the uranium extraction yield reached to 100%, gene expressions of cyc2 original and mutatedAcidithiobacillus sp. FJ2 were analyzed using Real-time PCR method.
Results: The results of the experiments showed that, with increasing pulp density, the uranium extraction rate and oxidation activity of bacteria were reduced. In addition, the result of cyc2 gene expression showed that the target gene expression increases in the presence of uranium ore compared to sample with absence of uranium ore, andwith further increase of pulp density, due to the toxicity of uranium, shows a decreasing trend.
Discussion and conclusion: The results of this study indicated that the mutation in the bacterium has a positive effect on the uranium bioleaching process, which can play an important role in the process of uranium bioleaching at high concentrations. In addition, with increasing pulp density due to uranium toxicity, there is a decreasing trend in the process of uranium extraction, which indicates the important role of this factor in the uranium bioleaching process.

کلیدواژه‌ها [English]

  • Acidithiobacillus sp. FJ2
  • cyc2
  • Pulp density
  • Uranium Bioleaching

مقدمه

بخش عمده‌ای از معادن فلز جهان از سنگ‌های متفاوتی تشکیل شده و یافتن روشی مقرون‌به‌صرفه و دارای کمترین آثار مخرب بر محیط‌زیست برای استخراج سنگ‌ها همواره مدنظر پژوهشگران و سیاستمداران کشورهای مختلف بوده است. بیولیچینگ (Bioleaching)، روش زیستی استفاده از ریزموجودات برای استخراج فلزها از سنگ معدن‌ آنهاست (1). اگرچه تاکنون سویه‌های مختلف باکتریایی فرآیند بیولیچینگ و به‌ویژه بیولیچینگ اورانیوم را به‌طور گسترده‌ای در سراسر جهان انجام داده‌اند، در ایران کمتر بررسی شده است.

یکی از دغدغه‌های اساسی درباره بیولیچینگ اورانیوم، انجام اقداماتی مانند فراهم‌کردن شرایط محیطی و زیستی مطلوب برای باکتری و نیز بررسی سازوکار باکتری مربوطه برای بهبود، تسریع و افزایش استخراج اورانیوم است. تاکنون، اقدامات وسیعی در سراسر جهان در زمینه تغییرات ژنومی باکتری‌ها و دستکاری و مهندسی ژنتیک آنها انجام و نتایج خوبی حاصل شده‌ است. همچنین، پژوهش‌های درخور توجهی درباره این دسته باکتری‌ها ازجمله Acidithiobacillusو شرایط بهینه فعالیت آنها انجام و ویژگی‌های ژنتیکی و بیوشیمیایی آنها در حد مطلوبی تعیین شده است. این اقدامات روی سویه‌های مختلف و از جنبه‌های گوناگونی نظیر تغییر در بیان ژن، ایجاد جهشجهش، بیوانفورماتیک و شناسایی ژن‌های مؤثر انجام شده‌اند (2) و موضوع جالب توجه، بهینه‌سازی استخراج اورانیوم با استفاده از این روش‌هاست.

ژن cyc2 در باکتری‌ Acidithiobacillus، مسئول اکسیداسیون آهن در غشای خارجی است و پتانسیل احیای این سیتوکروم بیشتر از سایر اعضای خانواده سیتوکروم‌های c است. این پروتئین، اکسیداسیون آهن و احیای اکسیژن را هم‌زمان انجام می‌دهد و نوعی متالوپروتئین با عناصر فلزی در ساختار خود است. مطالعه‌ها نشان داده‌اند که پروتئین Cyc2 جداسازی‌شده از باکتری، الکترون‌ها را از Fe(II) به مولکول O2 موجود در نمونه انتقال می‌دهد و هنگامی که Fe(II) به‌عنوان دهنده ‌الکترون استفاده شود، هر میلی‌گرم از کمپلکس پروتئینی Cyc2 حدود 212 واحد اکسیژن را احیا می‌کند (3).

با توجه به اهمیت پروتئین Cyc2 در فرآیند بیولیچینگ، بررسی این پروتئین در باکتریAcidithiobacillusدر غلظت‌های مختلف سنگ معدن از اهداف اصلی افزایش بازده بیولیچینگ است (2). تأثیر غلظت‌های مختلف بر بیان ژن cyc2 ضروری است زیرا کاهش اکسیداسیون آهن توسط باکتری یکی از علت‌های کاهش فعالیت باکتری در غلظت‌های زیاد سنگ است. از آنجا که پروتئین Cyc2 نقش مؤثری در اکسیداسیون آهن دارد، احتمالاً افزایش غلظت سنگ بر بیان ژن این پروتئین تأثیر نامطلوبی می‌گذارد و در نتیجه، بررسی عملکرد این پروتئین در غلظت‌های مختلف سنگ معدن ضرورت ویژه‌ای دارد. با توجه به مطالب یادشده، تاکنون اقدام عملی درباره یافتن روش‌هایی انجام نشده است که موجب تسریع و افزایش بازده استخراج اورانیوم در غلظت‌های زیاد سنگ معدن می‎شوند. در مطالعه حاضر برای رسیدن به این هدف، بیان ژن یادشده در فرآیند بیولیچینگ اورانیوم در شرایط جهش با استفاده از اشعه UV در غلظت‌های مختلف سنگ معدن بررسی شد.

 

مواد و روش‌ها

کشت باکتری Acidithiobacillus sp. FJ2: برای تهیه مایه تلقیح، ابتدا محیط‌کشت اختصاصیAcidithiobacillus sp. FJ2 (محیط‌کشت 9K) تهیه شد که شامل 3 گرم بر لیتر (NH4)2SO4، 5/0 گرم بر لیتر K2HPO4، 5/0 گرم بر لیتر MgSO4.7H2O، 1/0 گرم بر لیتر KCl، 01/0 گرم بر لیتر Ca(NO3)2.4H2O و 20 گرم بر لیتر FeSO4.7H2O بود. پس از آماده‌سازی محیط‌کشت، اسیدیته آن با سولفوریک‌اسید 10 نرمال و سود 10 نرمال و دستگاه pHمتر (Metrohm 827)روی 2 تنظیم شد. سپس، به میزان 10 درصد از باکتری به‌عنوان مایه تلقیح اضافه و به مدت 48 ساعت در دمای 30 درجه سانتی‌گراد با دور همزن rpm180 انکوبه شد (4 و 5).

جهش باکتری: برای ایجاد جهش در باکتری مدنظر، باکتری در فاز لگاریتمی (108×1 سلول/میلی‌لیتر) برداشته و با استفاده از سانتریفیوژ با دور rpm4000 به مدت 20 دقیقه جمع‌آوری شد. سپس، رسوب باکتری سه بار با آب اسیدی شسته و در نهایت، در محیط‌کشت فاقد منبع آهن حل شد. در ادامه، 10 میلی‌لیتر باکتری‌های آماده‌سازی‌شده در چهار پلیت ریخته و فاصله بین پلیت‌ها و منبع نور UV، 30 سانتی‌متر تنظیم شد. نمونه‌ها به مدت صفر، 60، 120 و 180 ثانیه در معرض نور UV با قدرت 30 وات و طول موج 254 نانومتر قرار داده شدند. پس از جهش، برای حفظ تغییر ایجادشده و بازسازی‌نشدن ژنوم باکتری، نمونه ها به مدت 12 ساعت در تاریکی و دمای 4 درجه سانتی‌گراد نگهداری شدند (6). سپس نمونه‌ها در محیط‌کشت 9k و شرایط بهینه رشد، کشت و برای آزمایش‌های بیولیچینگ اورانیوم استفاده شدند.

.سازگارکردن باکتری Acidithiobacillus sp. FJ2.جهش‌یافته و وحشی با غلظت‌های متفاوت پودر سنگ معدن اورانیوم:برای بررسی اثر غلظت اورانیوم بر بیان ژن مدنظر، باکتریAcidithiobacillus sp. FJ2(7) جهش‌یافته و وحشی با درصدهای مختلف پودر سنگ معدن اورانیوم کشت داده شدند. به این منظور، از غلظت‌های متفاوت پودر سنگ اورانیوم برابر 5، 10، 15، 25 و 50 درصد برای بررسی تأثیر روی بیان ژن باکتری‌ها استفاده شد. چهار ارلن محیط‌کشت 9K آماده و به آنها 5 درصد پودر سنگ معدن اورانیوم و 10 درصد از باکتری‌های جهش‌یافته و وحشی اضافه شد. سپس، نمونه‌ها در دمای 150 درجه سانتی‌گراد و دور همزن rpm150 انکوبه شدند. زمانی که میزان استخراج اورانیوم نمونه‌ها به 100 درصد رسید، از باکتری‌های سازگار‌شده با 5 درصد پودر سنگ معدن اورانیوم به‌عنوان مایه تلقیح برای غلظت 10 درصد و به همین ترتیب برای غلظت‌‌های بیشتر استفاده شد. در نمونه شاهد منفی مطالعه حاضر، به‌جای مایه تلقیح از مخلوط متانول- فرمالدهید به نسبت 9:1 استفاده شد. در مطالعه حاضر، از پودر سنگ اورانیوم آنومالی (II) ساغند، از توابع استان یزد (جدول 1) با ابعاد سنگ d80=106µm استفاده شد (8).

سپس در توالی‌های 24 ساعته، میزان 10 میلی‌لیتر از لیچ‌لیکور (Leach liquor) برای بررسی میزان اسیدیته (pH)، فعالیت اکسیداسیون و احیای باکتری (Eh) و میزان اورانیوم محلول برداشته و این میزان با آب مقطر (pH=2) جبران و اسیدیته محیط روی 2 تنظیم شد. زمانی که میزان استخراج اورانیوم در هر غلظت سنگ به 100 درصد رسید، باکتری از محیط دارای غلظت سنگ کمتر به محیط حاوی غلظت سنگ بیشتر منتقل شد.

 

جدول 1- ویژگی‌های شیمیایی سنگ آنومالی (II) با استفاده از آنالیز XRF

MgO (اکسیدمنیزیم)

Al2O3(اکسیدآلومینیوم)

) SiO2دی‌اکسید‌سیلیکون)

Fe2O3(اکسیدآهن‌فریک)

U (اورانیوم)

19.03 wt %

1.49 wt %

24.83 wt %

49.67wt%

465 ppm

 

در این مرحله، محیط‌کشت 9K در حجم مشخصی تهیه و با 10 درصد از باکتری‌های جمع‌آوری‌شده از غلظت سنگ کمتر توسط سانتریفیوژ با دور g×2422=rpm4500 در زمان 30 دقیقه، تلقیح و در دمای 35 درجه سانتی‌گراد با دور rpm150 انکوبه شد. میزان اسیدیته، فعالیت اکسیداسیون و احیای باکتری و میزان اورانیوم محلول موجود در نمونه در توالی‌های 24 ساعته اندازه‌گیری و اسیدیته محیط روی 2 تنظیم شد (9).

جمع‌آوری نمونه‌ها: بررسی‌های مولکولی در پی سازگارسازی باکتری‌های جهش‌یافته و وحشی به غلظت بیشتری از باکتری نیاز دارند. بنابراین، زمانی که استخراج اورانیوم در هر غلظت سنگ به 100 درصد رسید، باکتری با استفاده از سانتریفیوژ با دور g×2422=rpm4500 در زمان 30 دقیقه جمع‌آوری و برای مرحله استخراج RNA استفاده شد.

استخراج RNA:در مطالعه حاضر، برای استخراج RNA از کیت تجاری استخراج RNA شرکت Thermo Scientific (آمریکا) استفاده شد.

حذف DNA ژنومی از RNA استخراج‌شده: برای حذف DNA از RNA استخراجشده، میزان 6 میکرولیتر RNA با 15/0 میکرولیتر آنزیم DNase و 1 میکرولیتر بافر 10X شرکت Thermo Scientific (آمریکا) که حاوی MgCl2 است، مخلوط و سپس با آب مقطر عاری از Nuclease به حجم 10 میکرولیتر رسانده شد (10). محلول حاصل به مدت 30 دقیقه در دمای 37 درجه سانتی‌گراد انکوبه شد. سپس، 10 دقیقه در دمای 65 درجه سانتی‌گراد انکوبه و محلول حاصل برای مرحله بعد (ساخت cDNA) استفاده شد. پیش از انجام مرحله بعد، برای یکسان‌بودن غلظت RNA مصرفی در ساخت cDNA، غلظت RNA موجود در نمونه‌های تیمارشده با Dnase توسط دستگاه نانودراپ (NanoDrop 2000) خوانده و میزان معینی از RNA برای ساخت تمام cDNAها استفاده شد.

سنتز cDNA: در این مرحله از کیت تجاری شرکت Thermo Scientific (آمریکا) برای ساخت cDNA از RNAهای استخراج‌شده استفاده شد.

واکنش زنجیره‌ای پلیمراز: برای تأیید ساخت cDNA، واکنش زنجیره‌ای پلیمراز (PCR) برای ژن مدنظر انجام شد. میزان و غلظت مواد استفاده‌شده برای 25 میکرولیتر واکنش PCR به این شرح است: 5/2 میکرولیتر بافر 10X، 57/0 میکرولیتر MgCl2، 5/0 میکرولیتر dNTP، 1 میکرولیتر پرایمر مستقیم، 1 میکرولیتر پرایمر معکوس، 3/0 میکرولیتر آنزیم Taq DNA polymerase، 50 نانوگرم DNA الگو و آب عاری از نوکلئاز. تمام مواد مصرفی برای تهیه مخلوط واکنش تولید شرکت Bioflux ژاپن هستند.

برای انجام واکنش PCR و Real time PCR از پرایمرهای اختصاصی ژنcyc2و بخشی از ژن 16S rRNA باکتری اسیدیتیوباسیلوس استفاده شد. ژن 16S rRNA در مطالعه حاضر به‌عنوان شاهد داخلی در نظر گرفته شد، زیرا میزان بیان این ژن به‌عنوان ژن شاهد داخلی (Housekeeping Gene)، در شرایط مختلف یکسان است و به‌عنوان ژن استاندارد برای مقایسه با بیان سایر ژن‌ها استفاده می‌شود (10). جدول 2، ویژگی‌های پرایمرهای مورد استفاده‌شده را نشان می‌دهد.

 

جدول2- توالی پرایمرهای استفاده‌شده

نام ژن

(5′–3′) توالی

cyc2 (F)

cyc2 (R)

CCGCCAGAGTAGGTCAAATGC

AACTCTAATGCGGGTGCTTCTC

16S rRNA (F)

16S rRNA (R)

CCTACGGGAGGCAGCAGCGG

TGCTTCTTCTTGGATTCACG

F: آغازگر (پرایمر) مستقیم، R: آغازگر (پرایمر) معکوس

 چرخه حرارتی برای باکتری بررسی‌شده با استفاده از جفت پرایمر طراحی‌‌شده عبارت است از: دناتوراسیون اولیه در دمای 95 درجه سانتی‌گراد به مدت 5 دقیقه؛ چرخه تکثیر شامل 35 چرخه تکرارشونده با دمای دناتوراسیون 95 درجه سانتی‌گراد به مدت 20 ثانیه، دمای اتصال 60 درجه سانتی‌گراد به مدت 20 ثانیه و دمای سنتز 72 درجه سانتی‌گراد به مدت 20 ثانیه؛ نگهداری نمونه‌ها به مدت 5 دقیقه در دمای 72 درجه سانتی‌گراد برای تکمیل نهایی ساختار DNAهای تکثیرشده. در نهایت، محصول با روش ژل الکتروفورز تأیید شد.

انجام واکنش Real time PCR: واکنش Real time PCR با استفاده از پرایمر اختصاصی و کیت مخصوص SYBER Ò Premix Ex Taq Ô II (TaKaRa، ژاپن) انجام شد. این کیت حاوی تمام مواد لازم برای انجام واکنش PCR (آنزیم Taq، بافر همراه با MgCl2 و dNTPs) و رنگ سایبرگرین (SYBR Green) است که به‌‌‌عنوان مستر میکس (Master mix) استفاده می‌شود. هر واکنش Real time PCR (حجم نهایی 10 میکرولیتر) حاوی 5 میکرولیتر مسترمیکس، 4/0 میکرولیتر پرایمرهای Forward و Reverse (جدول 2)، 5/0 میکرولیتر cDNA، 2/0 میکرولیتر رنگ ROX و 9/3 میکرولیتر آب عاری از Nuclease است. پس از مخلوط‌کردن مواد یادشده و برای اطمینان از درستی انجام واکنش، نمونه‌های حاوی ژن cyc2 و نمونه حاوی ژن شاهد داخلی (16S rRNA) در پلیت‌ها به‌شکل سه‌تایی ریخته شدند. برای اطمینان از نبود آلودگی و خطاهای حاصل از آن، سه شاهد منفی برای هر ژن در نظر گرفته شد که میزان الگوی مدنظر (cDNA) با آب مقطر جایگزین شده بود. در نهایت، از چرخه حرارتی یادشده در جدول 3 و برای محاسبه میزان تغییرات بیان ژن مدنظراز روش CTDD استفاده شد (11).

تحلیل آماری: تفاوت‌های بین داده‌ها با نرم‌افزار SPSS، Tukey و تحلیل واریانس ANOVA تعیین شدند. با استفاده از این نرم‌افزار، P-value داده‌ها محاسبه و P<0.05، تفاوت معنادار در نظر گرفته شد.

 

جدول 3- چرخه حرارتی واکنش Real-Time PCR

تعداد چرخه

زمان

دما

مرحله

1

²30

oC 95

1

40

²15

oC 95

2

²20

oC 60

²20

oC 72

1

²15

oC 95

3

²60

oC 60

²15

oC 95

 

نتایج

.میزان استخراج اورانیوم توسط باکتری جهش‌یافته و وحشی Acidithiobacillus sp. FJ2: نتایج فرآیند بیولیچینگ اورانیوم در حضور چگالی پالپ‌های مختلف سنگ معدن اورانیوم با استفاده از باکتری‌های جهش‌یافته و وحشی در جدول 4 مشاهده می‌شوند. مطابق نتایج، باکتری‌های Acidithiobacillus sp. FJ2جهش‌یافته و وحشیدر حضور چگالی پالپ‌های 5، 10، 15 و 25 درصد سنگ معدن اورانیوم، اورانیوم را به‌طور کامل (100 درصد) طی روزهای مختلف استخراج می‌کنند. به علاوه، نتایج نشان می‌دهند که باکتری جهش‌یافته با اشعه UV به مدت 180 ثانیه، بیشترین استخراج اورانیوم را در چگالی پالپ 50 درصد و در روز سیزدهم انجام می‌دهدکه تأثیر مثبت جهش را روی عملکرد باکتری Acidithiobacillus sp. FJ2 نشان می‌دهد.

مطابق جدول 4، هرچه میزان چگالی پالپ افزایش یابد، توانایی استخراج اورانیوم کاهش می‌یابد و زمان بیشتری برای استخراج کامل نیاز است (P<0.05)؛ به‌طوری که، باکتری در حضور چگالی پالپ 25 درصد و طی 8 روز، اورانیوم را به‌طور کامل استخراج می‌کند ولی این اتفاق در چگالی پالپ 5 درصد طی 5/3 روز رخ می‌دهد.

 

جدول 4- میزان استخراج اورانیوم در چگالی پالپ‌های مختلف با استفاده از باکتری‌های جهش‌یافته و وحشی

چگالی پالپ

5

10

15

25

50

 

روزهای استخراج اورانیوم– درصد استخراج اورانیوم

Control(وحشی)

100%-3.5

100%-4

100%-3

100%-8

94.62%-13

UV60  (جهش‌یافته)

100%-3.5

100%-3.5

100%-3

100%-8

92.47%-13

UV120   (جهش‌یافته)

100%-3.5

100%-3.5

100%-10

100%-8

92.04%-13

UV180 (جهش‌یافته)

100%-2

100%-3.5

100%-3

100%-11

96.34%-13

 پژوهش‌های مختلفی نشان داده‌اند که عوامل متعددی بر سرعت و کیفیت فرآیند فروشویی (بیولیچینگ) فلزها تأثیر می‌گذارند. برخی از این عوامل با توجه به محدوده عملکرد بهینه خود، باعث مهار یا بهبود بیولیچینگ می‌شوند و مواردی نظیر چگالی پالپ و اندازه ذره‌ها به فلز درگیر در فرآیند بیولیچینگ مربوط هستند و روی فعالیت باکتری تأثیر می‌گذارند (12). عناصر سنگین روی رشد ریزموجودات اثر مهاری شدیدی دارند و برای ریزموجودات مرگ‌آور هستند. این فلزها شامل توریوم (Th)، اورانیوم (U)، جیوه (Hg) و نقره (Ag) هستند که متابولیت‌های سلول را مهار می‌کنند و اثر سمی روی باکتری‌ها دارند (12). میزان مقاومت به فلزهای سنگین در هر گونه، به سویه باکتری بستگی دارد (13).

از علت‌های دیگری که میزان استخراج اورانیوم در چگالی پالپ‌های کم، نرخ زیادی دارد و سریع‌تر انجام می‌‍‌شود، این است که اکسیژن یکی از اساسی‌ترین مواد مغذی برای رشد باکتری‌هاست و با افزایش چگالی پالپ، میزان اکسیژن کاهش می‌یابد. در چگالی پالپ‌های کم، میزان انتقال جرمی اکسیژن بین تولید و مصرف آن متعادل است، در حالی که در چگالی پالپ‌های زیاد، نرخ اکسیژن لازم با میزان اکسیژن تولیدشده طی فرآیند انتقال آن بین گاز و مایع کمتر است (14 و 15). با توجه به نتایج استخراج اورانیوم در مطالعه حاضر، روند استخراج با افزایش چگالی پالپ کاهش درخور توجهی دارد و همان‌گونه که بیان شد، جهش روی فرآیند استخراج اورانیوم اثرگذار است. یکی از مطالعه‌های یینگبو و همکاران نشان می‌دهد که پرتو UV به جهش مشهودی در باکتری Acidithiobacillus منجر می‌شود و فعالیت زیستی و قابلیت بیولیچینگ آن را افزایش می‌دهد (16) که تأییدی بر نتایج مطالعه حاضر است.

.میزان تغییرات Eh در حضور چگالی پالپ‌های مختلف و باکتری‌های جهش‌یافته و وحشی:مطابق جدول 5،‌ میزان پتانسیل اکسیداسیون و احیا در تمام نمونه‌ها با گذشت زمان افزایش معناداری داشته است (P<0.05). این نتایج کاملاً مشابه نتایج پژوهش‌های Ahmadi در سال 2012 هستند که روند فعالیت باکتری و فرآیند بیولیچینگ را نشان می‌دهند؛ در نمونه‌ای که 180 ثانیه UV به آن تابیده شده و در حضور چگالی پالپ 5 درصد، پتانسیل اکسیداسیون و احیا پس از چهار روز از 369 میلی‌ولت به 590 میلی‌ولت افزایش یافته است (P<0.05)، در حالی که پتانسیل اکسیداسیون و احیای باکتری وحشی در همین زمان فقط به 567 میلی‌ولت رسیده است. در تمام نمونه‌ها، کمترین میزان پتانسیل اکسیداسیون و احیا در نمونه شاهد منفی فاقد باکتری مشاهده شد.

مهم‌ترین عامل استخراج اورانیوم در بیولیچینگ، یون فریک حاصل از اکسیداسیون یون فرو توسط باکتری است. بنابراین، افزایش فعالیت اکسیداسیون و احیا نقش تعیین‌کننده‌ای در استخراج اورانیوم دارد و یکی از مهم‌ترین فعالیت‌های باکتری در فرآیند بیولیچینگ اورانیوم، فرآیند اکسیداسیون آهن و تبدیل آهن فرو به آهن فریک است. آهن فریک تولیدشده در این مرحله، عامل اصلی اکسیدکننده کانی‌های سولفیدی است (15). با توجه به مطالب یادشده، آهن نقش بسیار کلیدی در فرایند بیولیچینگ اورانیوم بازی می‌کند و نسبت میزان آهن فرو به آهن فریک در افزایش پتانسیل اکسیداسیون و احیا بسیار مؤثر است و نقش مهمی دارد. گفتنی است که میزان پتانسیل اکسیداسیون و احیای مشاهده‌شده در نمونه شاهد منفی، به اکسیداسیون جزئی آهن فرو (ناشی از تماس با اکسیژن موجود در هوا) مربوط است (17).

آهن فریک و سولفوریک‌اسید برای استحصال اورانیوم طی فرآیند بیولیچینگ ضروری هستند. آهن فریک، عامل اکسیدکننده‌ مؤثر اورانیوم چهارظرفیتی است و اگر در شرایط اسیدی به سنگ معدن اضافه ‌شود، اورانیوم را بهشکل محلول یا ششظرفیتی تبدیل می‌‌کند. غلظت آهن فریک طی اکسیداسیون اورانیوم کاهش می‌یابد و توسط باکتری‌های اکسیدکننده آهن و اسیددوست مانند باکتری Acidithiobacillus دوباره تولید می‌شود، هرچند این بازیابی به علت تشکیل رسوب ژاروسیت به‌کندی انجام می‌شود. بسیاری از سنگ معدن‌هایی که دارای اورانیوم هستند، پیریت نیز دارند (18). در بیولیچینگ اورانیوم، باکتری‌ها مستقیم به سنگ معدن اورانیوم حمله نمی‌کنند، بلکه این ریزموجودات پیریت و آهن فرو را اکسید می‌کنند و باعث تولید آهن فریک (واکنش 1) می‌شوند. سپس، آهن فریک به‌راحتی به اورانیومی (IV) حمله می‌کند که به‌شکل ترکیب با مواد معدنی است (واکنش 2) و آن را به اورانیوم (VI) محلول در سولفوریک‌اسید رقیق تبدیل می‌کند (19).

 

جدول 5- میزان تغییرات پتانسیل اکسیداسیون و احیا Eh)) در چگالی پالپ‌های مختلف در حضور باکتری جهش‌یافته و وحشی که واحد آن میلی‌ولت است.

10٪

چگالی پالپ

13

12

10

8

6

4

2

0

13

12

10

8

6

4

2

0

روزها

 

 

 

 

 

371

369

294

 

 

 

 

 

378

322

299

Negative

 

 

 

 

 

563

568

350

 

 

 

 

 

567

563

360

Control

 

 

 

 

 

566

574

354

 

 

 

 

 

503

554

329

UV60

 

 

 

 

 

570

569

352

 

 

 

 

 

573

564

355

UV120

 

 

 

 

 

556

560

339

 

 

 

 

 

590

574

369

UV180

25٪

15٪

چگالی پالپ

13

12

10

8

6

4

2

0

13

12

10

8

6

4

2

0

روزها

 

384

389

385

380

380

352

304

 

 

389

391

376

369

309

206

Negative

 

497

556

574

425

414

382

364

 

 

 

 

 

554

555

340

Control

 

620

614

584

545

416

378

355

 

 

 

 

 

552

555

340

UV60

 

588

570

576

444

415

381

344

 

 

607

564

386

376

353

330

UV120

 

556

549

570

435

415

387

359

 

 

 

 

 

542

544

361

UV180

 

50٪

چگالی پالپ

13

12

10

8

6

4

2

0

روزها

396

389

386

388

381

345

331

301

Negative

489

566

514

414

402

375

269

360

Control

550

578

537

549

395

357

287

359

UV60

514

552

518

454

395

326

285

353

UV120

520

556

511

403

397

358

287

371

UV180

 

4FeSO4+O2+2H2SO4         2Fe2(SO4)3+2H2O                     (واکنش 1)

UO2+Fe2(SO4)3+2H2SO4             UO2(SO4) 3+2FeSO4+4H+   (واکنش 2)

 

آهن فریک از اکسیداسیون پیریت تولید می‌شود که بیشتر همراه سنگ معدن اورانیوم است و یا طی بیولیچینگ اضافه می‌شود. آهن فریک در اسیدیته اسیدی محلول است و به‌عنوان اکسیدکننده قوی سبب اکسیدشدن بیشتر کانی‌ها می‌شود. در محلول اسیدی فاقد باکتری، مقدار آهن فرو ثابت می‌ماند و سرعت بیولیچینگ غیرمستقیم که به واسطه آهن فریک انجام می‌شود، آهسته است. پژوهشگران اظهار داشتند که در فرآیند بیولیچینگ، چگالی پالپ تأثیر بسیار زیادی بر فعالیت باکتری‌ها دارد، به این شکل که هرچه چگالی پالپ افزایش یابد، فعالیت باکتری‌ها کاهش می‌یابد (2) و بنابراین، تأخیر در افزایش فعالیت اکسیداسیون و احیا در چگالی پالپ‌های زیاد توضیح داده می‌شود.

Yingbo و همکاران (2011) نشان دادند که سرعت اکسیداسیون آهن فرو در باکتری جهش‌یافته 18 ساعت کمتر از زمان مربوط به باکتری وحشی در شرایط بیولیچینگ مشابه است و اثبات کردند که پس از گذشت 30 روز، استخراج مس توسط باکتری جهش‌یافته در مقایسه با باکتری وحشی، 17 درصد افزایش یافته است. به‌طور کلی نتایج آزمایش‌های آنها نشان دادند که آثار باکتری جهش‌یافته پس از پرتوتابی UV بهتر از باکتری‌های وحشی و همچنین بسیار بهتر از لیچینگ شیمیایی هستند (16) که تأییدی بر نتایج مطالعه حاضر است.

.میزان تغییرات اسیدیته در حضور چگالی پالپ‌‌های مختلف در باکتری جهش‌یافته و وحشی: جدول 6، تغییرات اسیدیته را در باکتری‌های جهش‌یافته و وحشی در حضور چگالی پالپ‌های مختلف سنگ معدن اورانیوم نشان می‌دهد. نتایج نشان می‌دهند که در همه نمونه‌ها بجز نمونه شاهد منفی، میزان اسیدیته در روزهای ابتدایی روند افزایشی و پس از آن، روند کاهشی داشته است (P<0.05) که بیشتر به دلیل فعالیت اکسیداسیونی آهن و سولفور توسط باکتری است. گفتنی است که افزایش اولیه اسیدیته به علت واکنش‌های شیمیایی مصرف‌کننده اسید است (20). Meruane و Vargas (2003)، پژوهش مشابهی درباره تغییرات اسیدیته در فرآیند بیولیچینگ اورانیوم با استفاده از باکتری Acidithiobacillus انجام دادند و به نتایج کاملاً مشابهی با نتایج پژوهش حاضر رسیدند که تأییدی بر درستی انجام این آزمایش‌هاست. مطابق جدول 6، کمترین میزان اسیدیته در چگالی پالپ 50 درصد در نمونه‌ای که 180 ثانیه به آن UV تابیده شد و در روز دهم با توجه به بیشترین فعالیت باکتری و در نتیجه تولید سولفوریک‌اسید بیشتر مشاهده شد.

 

جدول 6- میزان تغییرات اسیدیته (pH) در چگالی پالپ‌های مختلف در حضور باکتری جهش‌یافته و وحشی

10٪

چگالی پالپ

13

12

10

8

6

4

2

0

13

12

10

8

6

4

2

0

روزها

 

 

 

 

 

03/2

3/2

2

 

 

 

 

 

2

06/2

2

Negative

 

 

 

 

 

88/1

76/1

2

 

 

 

 

 

94/1

84/1

2

Control

 

 

 

 

 

86/1

79/1

2

 

 

 

 

 

86/1

77/1

2

UV60

 

 

 

 

 

86/1

82/1

2

 

 

 

 

 

92/1

79/1

2

UV120

 

 

 

 

 

83/1

75/1

2

 

 

 

 

 

94/1

82/1

2

UV180

25٪

15٪

چگالی پالپ

13

12

10

8

6

4

2

0

13

12

10

8

6

4

2

0

روزها

 

01/2

01/2

01/2

2

06/2

56/2

2

 

 

01/2

01/2

19/2

16/2

66/2

2

Negative

 

93/1

92/1

95/1

03/2

1/2

61/2

2

 

 

 

 

 

9/1

72/1

2

Control

 

89/1

9/1

95/1

79/1

1/2

59/2

2

 

 

 

 

 

93/1

81/1

2

UV60

 

95/1

94/1

99/1

07/2

09/2

66/2

2

 

 

84/1

68/1

2/2

01/2

47/2

2

UV120

 

97/1

96/1

89/1

08/2

12/2

61/2

2

 

 

 

 

 

92/1

76/1

2

UV180

 

50٪

چگالی پالپ

13

12

10

8

6

4

2

0

روزها

11/2

12/2

2

08/2

02/2

42/2

56/2

2

Negative

72/1

06/2

88/1

03/2

13/2

39/2

02/3

2

Control

95/1

08/2

78/1

85/1

12/2

4/2

02/3

2

UV60

2

04/2

77/1

94/1

12/2

69/2

09/3

2

UV120

03/2

03/2

72/1

99/1

11/2

35/2

96/2

2

UV180

 

در کشت باکتری، اسیدیته یکی از عوامل مهم و تأثیرگذار بر رشد باکتری و اکسیداسیون آهن فرو است (21). مطابق تغییرات اسیدیته در بخش نتایج، در حضور چگالی پالپ‌های مختلف سنگ معدن اورانیوم، اسیدیته محیط در روزهای ابتدایی روند افزایشی و با گذشت زمان، روند کاهشی نشان می‌دهد. در مطالعه‌های پیشین نشان داده شده است که در مراحل اولیه بیولیچینگ، اکسیداسیون آهن فرو، مهم‌ترین واکنشی است که باکتری در آن دخیل است (واکنش 3).

Fe2++1/4O2+‏H‏+         Fe3+‏+‏1/2H2O (واکنش 3)

 

این واکنش، مصرف‌کننده H+ است و از این رو، باعث افزایش اسیدیته محیط در مراحل اولیه می‌شود. به بیان دیگر، افزایش اسیدیته در حضور باکتری Acidithiobacillus درگیر واکنش‌هایی است که مصرف‌کننده اسید هستند. با پیشرفت زمان بیولیچینگ، Fe3+ به Fe2+ اکسیده و باعث تشکیل‌شدن H+ و کاهش تدریجی اسیدیته محیط در مراحل بعدی بیولیچینگ می‌شود (21 و 22).

نتایج واکنش PCR: برای اطمینان از درستی روند استخراج RNA و رونوشت‌برداری معکوس (ساخت cDNA)، واکنش PCR با پرایمرهای اختصاصی ژن‌های cyc2و16S rRNA انجام شد و محصولات آن روی ژل آگارز 1 درصد بارگذاری شدند. واکنش PCRبرای تمام cDNAهای ساخته‌شده از هر چگالی پالپ انجام شد و نتایج آن در شکل 1 دیده می‌شوند. با توجه به شکل 1، روند استخراج RNA و ساخت cDNAدر هر چگالی پالپ به‌درستی انجام شده و هیچ باند غیراختصاصی مشاهده نشده که نشانه عملکرد دقیق پرایمرها است.

شکل 1- نمونه‌ای از بارگذاری محصولات واکنش PCR از cDNAهای ساخته‌شده در باکتری وحشی از هر چگالی پالپ (5، 10، 15، 25 و 50 درصد) با استفاده از پرایمر ژن cyc2 برای اطمینان از درستی استخراج RNA و ساخت cDNA

 

.بررسی بیان ژن cyc2 در باکتری Acidithiobacillus sp. FJ2.جهش‌یافته و وحشی در حضور چگالی پالپ‌های مختلف سنگ اورانیوم: پس از انجام هر واکنش Real-Time PCR و برای اطمینان از تکثیرنشدن غیراختصاصی، منحنی ذوب با دستگاه رسم و ثبت شد. منحنی دارای تک قله در Tm اختصاصی مربوط به هر ژن، تکثیر کاملاً اختصاصی همان ژن را نشان داد و تمام نمونه‌ها، پس از انجام هر واکنش از نظر منحنی ذوب بررسی شدند. شکل 2، نمونه‌ای از منحنی ذوب ژن‌های مدنظر است.

  

شکل 2- منحنی ذوب استخراج‌شده از واکنش Real-Time PCR ژن cyc2

شکل 3، بیان ژن cyc2 باکتری Acidithiobacillus sp. FJ2 را در حضور غلظت‌های مختلف سنگ معدن اورانیوم نشان می‌دهد. همان‌گونه که نتایج نشان می‌دهند، بیشترین میزان بیان ژن در چگالی پالپ 25 درصد و کمترین میزان بیان ژن در چگالی پالپ 50 درصد مشاهده شده است(P<0.05).

نتایج بیان این ژن نشان می‌دهند که در فرآیندهای ابتدایی بیولیچینگ که با درصد سنگ کمتری آغاز می‌شوند، باکتری، سعی در تطبیق خود با محیط دارد و بیان ژن لازم برای اکسیداسیون آهن زیاد می‌شود و با افزایش چگالی پالپ، افزایش بیشتری مشاهده می‌شود. با پیشرفت فرآیند و افزایش بیشتر سنگ اورانیوم در محیط، بیان ژن‌های دخیل در اکسیداسیون آهن بر اثر مواجه‌شدن با عوامل تنشی بیشتر از حد آستانه تحمل باکتری، روند کاهشی نشان می‌دهد که این تغییرات کاهشی در نتایج استخراج اورانیوم مشهود هستند.

  

شکل 3- میزان بیان ژن cyc2 در حضور چگالی پالپ‌های مختلف و باکتری جهش‌یافته و وحشی.

RQ: تعیین مقدار نسبی (Relative Quantification)

 

طی فرایند اکسیداسیون آهن، cyc2، الکترون‌ها را مستقیم از آهن فرو می‌پذیرد و با جایگاهی که در غشای خارجی دارد، نخستین مرحله اکسیداسیون آهن فرو را انجام می‌دهد (23). تصور می‌شود که این پروتئین، یک سوپر کمپلکس تنفسی تشکیل می‌دهد که غشاهای داخلی و خارجی را فرا می‌گیرد و الکترون‌ها را از آهن (یا پیریت) به اکسیژن منتقل می‌کند (3 و 24). بر اساس مطالعه‌های ژنتیکی و متابولیکی مشخص شده است که الکترون‌های حاصل از اکسایش آهن فرو از راه cyc2 به راستی‌سیانین (Rusticyanin) منتقل می‌شوند و از آنجا، برخی مسیر سرازیری (Downhill) الکترون را از راه سیتوکروم cyc1 به سیتوکروم‌اکسیداز aa3 و برخی نیز مسیر سربالایی (Uphill) الکترون را طی می‌کنند؛ در این مسیر، دهنده عمومی الکترون (NADH) توسط جریان معکوس الکترون از طریق سیتوکرومcycA1 (نخستین گیرنده سربالایی) به کمپلکس bc1 و سپس به منبع یوبی‌کینون و در نهایت NADدهیدروژناز تولید می‌شود (1).

از سوی دیگر، افزایش بیان این ژن در حضور سنگ معدن اورانیوم، سازوکاری برای تولید NADH از طریق انتقال الکترون از Fe(II) به NAD(P) است که باکتری را قادر به مواجهه با عوامل تنش‌زای اکسیداتیو می‌کند، زیرا NADH برای مبارزه با عوامل تنشی مانند اورانیوم ضروری است (25).

Duncan و Bruynesteyn مشاهده کردند که فعالیت اسیدیتیوباسیلوس فرواکسیدانس در معادن اورانیوم در غلظت 12 گرم بر لیتر اورانیوم (U3O8) است، در حالی که Ebner و Schwartz مقدار اورانیوم را 75/0کیلوگرم بر متر مکعب گزارش کرده‌اند. Tuovinen و Kelly اظهار داشتند که سمیت اورانیوم باعث ضعیف‌شدن پیوند بین سطوح و سلول‌ها و در نتیجه باعث کاهش CO2 و اکسیداسیون یون فرو می‌شود؛ همچنین، بیان کردند که غلظت‌های اورانیوم زیاد 3-10-4-10´5 مول بر دسی‌متر مکعب برای اسیدیتیوباسیلوس فرواکسیدانس سمی هستند (26). نتایج این مطالعه نیز نشان می‌دهند که سمیت اورانیوم بر فعالیت این باکتری آثار منفی دارد و جهش باعث بهبود روند فرآیند بیولیچینگ اورانیوم می‌شود.

 

بحث و نتیجه‌گیری

نتایج مطالعه حاضر نشان می‌دهند که جهش و چگالی پالپ اورانیوم، دو عامل مؤثر بر تغییرات بیان ژن cyc2 هستند. همچنین، ایجاد جهش در باکتری مدنظر، تأثیر مثبتی بر فرآیند بیولیچینگ اورانیوم و نقش مهمی در فرآیند بیولیچینگ غلظت‌های زیاد سنگ معدن اورانیوم دارد. از سوی دیگر، با افزایش چگالی پالپ به علت سمیت اورانیوم، روند کاهشی در فرایند استخراج اورانیوم مشاهده می‌شود که حاکی از نقش مهم این عامل در فرآیند بیولیچینگ اورانیوم است و با افزایش میزان غلظت سنگ، سرعت استخراج اورانیوم و فعالیت اکسیداسیونی باکتری کاهش می‌یابد و باکتری برای استخراج کامل اورانیوم به مدت زمان بیشتری نیاز دارد.

(1)              Valdes J., Pedroso I., Quatrini R., Holmes DS. Comparative genome analysis of acidithiobacillus ferrooxidans, A. thiooxidans and A. caldus: Insights into their metabolism and  ecophysiology. Hydrometallurgy 2008; 94: 180-184.
(2)              Xin B., Jiang W., Li X., Zhang K., Liu C., Wang R., Wang Y. Analysis of reasons for decline of bioleaching efficiency of spent Zn–MN batteries at high pulp densities and exploration measure for improving performance. Bioresource Technology 2012; 112: 186-192.
(3)              Castelle C., Guiral M., Malarte G., Ledgham F., Levoy G., Brugna M. A new Fe-oxidizing/O2 -reducing super complex spanning both inner and outer membranes, isolated from the extreme acidophile Acidithiobacillus ferrooxidans. Journal of biochemistry 2008; 283(38): 25803-25811.
(4)              Chen P., Yan L., Wang Q., Li Y., Li H. Surface alteration of realgar (As4S4) by Acidithiobacillus ferrooxidans.International microbiology 2012; 15: 9-15.
(5)              Zhang Y., Qin W., Wang J., Zhen S., Yang C., Zhang J., et al. Bioleaching of chalcopyrite by pure and mixed culture. Transactions of Nonferrous Metals Society of China 2008; 18: 1491-1496.
(6)              Yuan X.,  Xie X., Fan F., Zhu W., Liu N., Liu J. Effects of mutation on a new strain Leptospirillum ferriphilum YXW and bioleaching of gold ore. Transactions of Nonferous Metals Society of China 2013; 23: 2751-2758.
(7)              Jahani S., Fatemi F., Firoz-e-zare MA., Zolfaghari MR. Isolation and characterization of Acidithiobacillus ferrooxidans strain FJS from Ramsar, Iran. Electronic Journal of Biology 2015; 11(4): 138-146.
(8)              Russian federation ministry of atomic energy. Report of processing technology developed for uranium ores from Saghand deposit Islamic Republic of Iran. 1996.
(9)              Abhilash S., Mehta KD., Kumar V., Pandey BD., PandeyVM. Dissolution of uranium from silicate-apatite ore by Acidithiobacillus ferrooxidans. Hydrometallurgy 2009; 95: 70-75.
(10)          Huizhou Q., Hong C., Jingqun A., Hongbo Z., Xinhua C. Identification of differentially expressed genes in Sulfobacillus sp. TPY grown on either elemental sulphur or Fe2+. J. Gen. Appl. Microbiol 2012; 56: 389-397.
(11)          Yarzabal A., appia C. Regulation of the expression of the Acidithiobacillus ferrooxidans rus operon encoding two cytochromes c, a cytochrome oxidase and rusticyanin. Microbiology 2004; 150: 2113-2123.
 
(12)          Brandl H. Microbial leaching of metals. Wiley-VCH 2008; 8.
(13)          Sand W., Gehrke T., Hallmann R., Schippers A. Sulfur chemistry, biofilm, and the (in) direct attack mechanism-critical evaluation of bacterial leaching. Applied Microbiology and Biotechnology 1995; 43: 961-966.
(14)          Moon-Sung C., Kyung-Suk C., Dong-Su K., Hee-Wook R. Bioleaching of uranium from low grade black schists by Acidithiobacillus ferrooxidans. World Journal of Microbiology & Biotechnology 2005; 21: 377-380.
(15)          Boon M., Heijnen JJ. Gas-liquid mass transfer phenomena in biooxidation experiments of sulphide minerals: a review of literature data. Hydrometallurgy 1998; 48: 187-204.
(16)          Yingbo D., Hai L., Han W., Xiaolan M., Kaibin F., Hongwei W. Effects of ultraviolet irradiation on bacteria mutation and bioleaching of low-grade copper tailings. Minerals engineering 2011; 24: 870-875.
(17)          Ahmadi A. Influence of Ferric and Ferrous Iron on Chemical and Bacterial Leaching of Copper Flotation Concentrates. International Journal of Nonferrous Metallurgy 2012; 1: 42-48.
(18)          Keith-Roach MJ., Livens FR. Interactions of microorganisms with radionuclides. 1st ed. Elsevier Science ; 2002.
(19)          Sapsford DJ., Bowell RJ., Geroni JN., Penman KM., Dey M. Factors influencing the release rate of uranium, thorium, yttrium and rare earth elements from a low grade ore. Minerals engineering 2012; 39: 165-172.
(20)          Sandstorm A., Petersson S. Bioleaching of a complex sulphide ore with moderate thermophilic and extreme thermophilic microorganism. Hydrometallurgy 1997; 46(1-2): 181-190.
(21)          Meruane G., Vargas T. Bacterial oxidation of ferrous iron by Acidithiobacillus ferrooxidans in the pH range 2.5–7.0. Hydrometallurgy 2003; 71(1-2): 149-158.
(22)          Dong Y., Lin H., Wang H., Mo X., Fu K., Wen H. Effects of ultraviolet irradiation on bacteria mutation and bioleaching of low-grade copper tailings. Minerals Engineering 2011; 24: 870-875.
(23)          Yarzabal A., Brasseur G., Ratouchniak j., lund k., lemesle-meunier d. The high-molecular-weight cytochrome c Cyc2 of Acidithiobacillus ferrooxidans is an outer membrane protein. Journal of Bacteriology 2002; 184: 313-317.
(24)          Appia-Ayme C., Guiliani N., Ratouchniak J., Bonnefoy V. Characterization of an operon encoding two c-type cytochromes, an aa3-type cytochrome oxidase and rusticyanin in Thiobacillus ferrooxidans ATCC 33020. Appl Environ Microbiol 1999; 65: 4781–4787.
(25)          Dekker L., Arsene-Ploetze F., Santini JM. Comparative proteomics of Acidithiobacillus ferrooxidans grown in the presence and absence of uranium. Research in Microbiology 2016; 167: 234-239.
(26)          Rossi G. Biohydrometallurgy. Hamburg: McGraw-Hill; 1990.