Investigating Diversity and Spatial Distribution of Endophytic Fungi in Hazelnut (Corylus avellana) in its Different Habitats of Iran

Document Type : Original Article- English

Authors

1 Departement of Plant Pathology, Faculty of Agricultere and Natural resources, Zabol University

2 Departement of Plant Production, Faculty of Agricultere and Natural resources, Gonbad Kavous University

Abstract

Introduction: Endophytes are a large and diverse group of microorganisms living in the plants’ tissues and/or organs without causing any symptoms. Endophytes play an important role in plant protection against biotic and abiotic stress. The aim of the present study was to isolate and identify endophytic fungi in Corylus avellana L. and evaluate the possible effects of different tissues and geographical conditions on their communities.
Materials and Methods: Plant sampling of healthy tissues (leaf, stem, and root) of the hazelnut plants was carried out in Golestan, Mazandaran, Guilan, Ardabil, Zanjan, and Qazvin provinces in north and northwest of Iran. Following surface sterilization, endophytic fungi were isolated using standard culturing techniques and identified based on morphological characteristics. Representatives of each taxon were subjected to molecular identification based on ITS ‐rDNA, LSU, TEF1, and β-tubulin sequences. Data were analyzed using diversity indices and correspondence analysis (CA).
Results: In total, 791 endophytic fungal isolates were isolated from healthy leaves (39%), stems (35.65%), and roots (25.16%). The isolates were classified into 24 fungal species belonging to seven orders in four fungal classes, including Dothideomycetes (Capnodiales and Pleosporales), Sordariomycetes (Diaporthales and Hypocreales) Eurotiomycetes (Eurotiales and Chaetothyriales), and Agaricomycetes (Polyporales). Ascomycota and Basidiomycota represented 96.2% and 3.8% of the isolates, respectively. The stem and root showed the highest and lowest total colonization frequency and diversity indices of endophytic fungi respectively. Also, the diversity indices of endophytes in Guilan were higher than those in other studied provinces.
Discussion and conclusion: The frequency and diversity of fungal endophytes in C. avellana are under the influence of factors such as geographical conditions, biodiversity, and tissue type. Different plant tissues, multiple sites, and related ecological indicators have helped define how maximum biodiversity may be found in a fungal endophyte population in a given plant species.

Keywords

Main Subjects


Introduction

Endophytes are microorganisms associated with living plant tissues with no obvious signs of being present and appear to cause no damage to their host plants (1, 2). The most common endophytes are fungi (usually Ascomycete and to a lesser extent Basidiomycete and Zygomycete) as well as bacteria and actinomycetes (3). They are found in almost all plant organs (roots, stems, leaves, flowers, fruits, and seeds) (4). After decades of research on fungal endophytes, it is now clear that they are diversely distributed throughout the plant taxonomic groups and in all ecological conditions (5).

In recent years, endophytic microorganisms have attracted much attention for a variety of reasons, including plant protection from pests, pathogens, and even herbivorses, as well as their potential to produce bioactive compounds (6). Currently, endophytes are considered as a source of naturally occurring and biologically active compounds with great potential in the production of valuable medicinal compounds such as Taxol, which has been shown to possess antifungal and anti-cancer properties (7, 8, 9). Some studies have been carried out on endophytes biodiversity, classification, host environment, and their effects on the host well-being (8, 10, 11). Also, it has been shown that a variety of factors such as ecological and environmental conditions, sampling season, type, and age of infected tissues are effective in the colonization of a plant by endophytic fungi (12, 13). On the other hand, although a unique and diverse assemblage of biologically active secondary metabolites was produced by different endophytic species, their spectrum of metabolites changes with changes in environment, geography, host, and tissue type (14). Therefore, to obtain the maximum benefits from this excellent natural resource, it is necessary to study endophytic communities in different plants (5).

Hazelnut (C. avellana) used to be cultivated for its nutritional aspects. But, it is now being considered for its phytochemical content (15). Indeed, some valuable drugs such as taxol, have been reported from some endophytes isolated from hazelnut (16). This deciduous plant is native to Europe and western Asia (17). Iran is the seventh-largest producer of hazelnuts in the world (18) and its main cultivation area is in the northern and northwest provinces of Golestan, Mazandaran, Guilan, Ardabil, Zanjan, and Qazvin (19).

In the present study, our first aim is to isolate, identify, and classify endophytic fungi from leaf, stem, and root of hazelnuts from different geographical regions using morphological and molecular methods. The second goal is to investigate the possible effects of environmental and geographical changes as well as the type of plant organ on the rate of C. avellana colonization by the endophytes. Since the information available about the biodiversity of C. avellana endophytes is scarce, this study can provide valuable information about their biodiversity and shed light on important determining factors in their distribution under different geographical and environmental conditions.

 

Materials and Methods

Study Sites and Plant Sampling: C. avellana samples were collected from natural habitats and gardens in six north and northwest provinces of Iran (Golestan, Mazandaran, Guilan, Ardabil, Zanjan, and Qazvin) from April to June 2017 (Table 1; Figure 1). Similar sampling with a Z-shaped sampling pattern was performed to collect healthy leaves, stems, and roots randomly from 9 trees at each site (five samples of leaves, stems, and roots per tree). Samples were collected from 6- to 8-year-old trees with a height of 2 to 4 meters. In total, three regions represented each province, and 18 trees from each region were selected (a total of 324 trees). The samples were sealed in polyethylene bags and transferred to the Central Laboratory of Gonbad Kavous University, and stored at 4 °C to be analyzed later.

Fungal Isolation and Morphological Identification:  In order to isolate fungal endophytes from leaf, stem, and root tissues, 30 pieces (10 pieces from each organ) from each hazelnut tree were cultured according to Tan et al. (20). Before surface sterilization, the samples were washed thoroughly under running tap water to remove the remnant soil and debris. They were sequentially sterilized with 70% ethanol for 1 min followed by immersion in 3% Sodium hypochlorite (NaOCl) for 3-8 min (depending on the type of sample, 3 min for leaf, 5 min for the stem, and 8 min for root) and once again in 70% ethanol for 1 min. They were then rinsed several times in sterile distilled water and were dried on sterile filter paper (20). The sterilized plant fragments were cut into about 0.5 × 1 cm using a sterile blade. Four segments of each sample were placed on Petri dishes containing potato dextrose agar (PDA; Merck, Darmstadt, Germany), malt extract agar (MEA; Merck, Darmstadt, Germany), and water agar. They were incubated at 25 °C for 2-4 weeks and were daily checked for any fungal growth. The number of individual fungal colonies emerged from different samples was recorded separately to calculate the fungal abundance and species diversity. The colonies were subcultured on fresh media to purify endophytic fungi and maintain them in PDA for further study. Morphological identification of isolates was performed according to the standard taxonomic keys based on the fungal colony morphology, characteristics of the hyphae, spores, and reproductive structures (21-24).

 

 

Table 1- Geographical Coordinates, Altitude, and Mean Annual Rainfall of the C. avellana  Sampling Locations in Iran

Location

Geographic coordinates

Altitude (m)

Mean annual rainfall(mm)

N

E

Golestan

1

Minoudasht- Sasang

37°04'05.1 "

55°22'49.3 "

589

720

2

Minoodasht- Takht

37°08'54.7"

55°26'42.6"

728

712

3

Kalaleh- Maraveh Tapeh

37 38'41.24''

55 56'32.73''

1006

360

Mazandaran

1

Tonekabon- Dohezar

36° 37' 50.016"

50° 44'40.16 "

906

1500

2

Royan- Lazir

36°24'22.3"

51°55'47.2"

930

655

3

Behshahr- Hezar Jarib

36°35'58.9"

53°55'55.4"

1260

670

Guilan

1

Siahkal- Pirkooh

36°49'44.6 "

50°00'50.3 "

1256

1302

2

Siahkal- Deylaman

36°53'19.2"

49°54'26.7"

1434

620

3

Roudsar- Rahim Abad

36°45'02.4"

50°15'06.7"

1375

1508

Ardabil

1

Fandoqloo forest- 1

38°24'6.82 "

48°32'44.71 "

1460

290

2

Fandoqloo forest- 2

38°24'7.79 "

48°33'47.13 "

1507

290

3

Fandoqloo forest- 3

38°25'4.45 "

48°33'57.63 "

1589

290

Zanjan

1

Tarom- 1

36°39'13.4"

48°28'57.2"

1607

268

2

Tarom- 2

36°39'09.8"

48°30'26.9 "

1618

268

3

Tarom- 3

36° 39'08.2 "

48°29'31.0 "

1619

268

Qazvin

1

Almot- Ekojan

36°37'31.8 "

50°08'30.9 "

1520

530

2

Almot- Hir

36°35'44.4 "

50°15'28.5 "

1700

515

3

Almot- Via

36°37'20.3 "

50°16'36.4 "

1813

550

 

 

Fig. 1- Map of the six sampling site of C. avellana in Iran. GOL: Golestan. Mz: Mazandaran. Gi: Guilan. Zn: Zanjan. Ar: Ardabil. Qz: Qazvin.

DNA Extraction and Molecular Identification: For molecular identification, at least one isolate was selected as a representative of each morphotype and was grown in 200 mL potato dextrose broth (PDB) in a shaker incubator (WiseCube WIS-10R) at 110 rpm and 25 °C for 7 days. The mycelium was harvested and washed with distilled water, freeze-dried, and the genomic DNA was extracted by the Cetyl Trimethyl Ammonium Bromide (CTAB) method as described by Zhang et al. (25).

The extracted DNA was subjected to the Polymerase Chain Reaction (PCR) using four molecular markers: ITS (Internal transcribed spacer), LSU (partial large subunit nrDNA), TEF1 (Translation elongation factor), and TUB (β-tubulin) (Table 2). PCR was performed for PCR mixture (as shown in Table 3) using a T100™ thermal cycler (Bio-Rad, USA) with the initial denaturation at 94 °C for 5 min, followed by 40 cycles of denaturation at 94 °C for 30 s, annealing at 58 °C for 20 s, extension at 72 °C for 45 s, and a final extension at 72 °C for 10 min. The PCR products were analyzed electrophoretically in 1% (w/v) agarose gels stained with gel red (Biotium®) and visualized with a UV light (UVP MultiDoc-ItTM, Analytik Jena, Germany). The purified products were sent to the Microsynth AG genome center (Balgach, Swiss) for sequencing by the Sanger Sequencing Method.

Analysis of the Data: The resulting DNA sequences were trimmed and edited by MEGA 5.0 software. They were analyzed by the nBlast search tool on the NCBI database (https://blast.ncbi.nlm.nih.gov/Blast.cgi). All the sequences were deposited in the NCBI's GenBank database, and an Accession Number was obtained for each sequence.

The Colonization Frequency (CF) was calculated as the number of fragments from which one or more endophytic fungi were isolated, and divided by the total number of incubated fragments (30). The diversity of endophytic fungi isolated from six hazelnut growing provinces as well as three plant organs (leaf, stem, and root) were evaluated using the Shannon–Weiner Index [H′ = −Σ (Pi × lnPi) (Pi = ni/N)], Simpson's index [D = 1 −Σ Pi2], Pielou’s Evenness Index [E = H′/ln(S)], Margalef richness index [R = (S − 1)/lnN], and Jaccard similarity index [Jc = C/(A+ B ̶ C)]. Here, pi is the proportion of individuals that species i contributes to the total; ni represents the numbers of individuals; N represents the total number of individuals; S indicates the total number of species (31); C is the number of species shared by these three tissues; A and B are the total number of species isolated from any of the three tissues (32). Also, the diversity index was calculated for each location and organ type using primer software (https://primer.software.informer.com/6.0/). Correspondence Analysis (CA) was used to study the ecological interrelationships between the fungal species and different tissue types and also between the fungal species and Sampling areas (PAST software) (33).

 

 

Table 2- Primers Used for Generic Amplification and Sequencing

Locus

Primer

Primer sequence 5'–3':

Orientation

Reference

ITS

ITS5

GGAAGTAAAAGTCGTAACAAGG

Forward

(26)

ITS4

TCCTCCGCTTATTGATATGC

Reverse

(26)

LSU

LROR

CC CGC TGA ACT TAA GC

Forward

(27)

LR5

TCCTGAGGGAAACTTCG

Reverse

(27)

TEF-1α

EF1-983F

GCCYGGHCAYCGTGAYTTYAT

Forward

(28)

Efgr

GCAATGTGGGCRGTRTGRCARTC

Reverse

(28)

β-tubulin

T1

AACATGCGTGAGATTGTAAGT

Forward

(29)

β-Sandy-R

GCRCGNGGVACRTACTTGTT

Reverse

(29)

 

Table 3- Materials for DNA Amplification using PCR

Components

Concentration

Amount (μl)

Master mix red (Ampliqon)

2X

12.5

Reverse primers

10 pmol/μl

1

Forward Primer

10 pmol/μl

1

DNA diluted

0.75-0.5 ng

2

Sterile distilled water

 

8.5

the Final content

 

25 μl

 

Results

A total of 791 endophytic fungal isolates were recovered from 9720 leaf, stem, and root fragments. They were assigned to 24 species or morphological types. Their accession numbers and other complementary information are presented in Table 4. Most of the isolates were grouped in phylum Ascomycota, subphylum Pezizomycotina, in three classes of Dothideomycetes, Sordariomycetes, and Eurotiomycetes, and only one belongs to subphylum Agaricomycotina of the phylum Basidiomycota (Agaricomycetes). Overall, the class Dothideomycetes represented by the orders of Pleosporales (8 species) and Capnodiales (4 species); the class Sordariomycetes represented by the orders of Hypocreales (5 species) and Diaporthales (2 species); class Eurotiomycetes represented by order Eurotiales (Three species), and the class Agaricomycetes represented by the order Polyporales (one species) (Table 4).

 

 

Table 4- Endophyte Isolate Accession Numbers and Other Supplementary Information of the Endophytic Fungi Associated with C. avellana in Six Provinces of Iran

Isolate ID

(Accession no.)

Endophytic Fungi

Tissue

Order /Phylum/Class

ITS identity

(%)

Dominance

of fungi

GOLB4

(MN963671)

Epicoccum nigrum

Leaf

Pleosporales/ Ascomycota/ Dothideomycetes

100

10.75

GOLB6

(MN963672)

Nothophoma quercina

Leaf

Pleosporales/ Ascomycota/ Dothideomycetes

100

2.66

GOLS20

(MN963673)

Neocucurbitaria unguis

Stem

Pleosporales/ Ascomycota/ Dothideomycetes

100

2.91

GOLR5

(MN963674)

Alternaria alternata

Root

Pleosporales/ Ascomycota/ Dothideomycetes

100

14.03

GOLR6

(MN963675)

Paraphaeosphaeria sporulosa

Root

Pleosporales/ Ascomycota/ Dothideomycetes

100

0.75

MZB3

(MN963676)

Purpureocillium lilacinum

Leaf

Hypocreales/ Ascomycota/ Sordariomycetes

100

2.79

MZB12

(MN963694)

Fusarium sp.

Leaf

Hypocreales/ Ascomycota/ Sordariomycetes

99

2.41

MZR1

(MN963677)

Fusarium proliferatum

Root

Hypocreales/ Ascomycota/ Sordariomycetes

100

4.56

GIB1

(MN963678)

Diaporthe sp.

Leaf

Diaporthales/ Ascomycota/ Sordariomycetes

100

2.53

GIS2

(MN963679)

Cladosporium tenuissimum

Stem

Capnodiales/ Ascomycota/ Dothideomycetes

100

3.29

GIS3

(MN963680)

Pyrenochaetopsis sp.

Stem

Pleosporales/ Ascomycota/ Dothideomycetes

100

2.53

GIR2

(MN963681)

Exophiala sp.

Root

Chaetothyriales/ Ascomycota/ Eurotiomycetes

100

3.92

ZNB7

(MN963682)

Fusarium fujikuroi

Leaf

Hypocreales/ Ascomycota/ Sordariomycetes

100

8.09

ZNB8

(MN963683)

Fusarium equiseti

Leaf

Hypocreales/ Ascomycota/ Sordariomycetes

100

8.09

ZNS2

(MN963684)

Bjerkandera adusta

Stem

Polyporales/ Basidiomycota/ Agaricomycetes

100

1.39

ZNR4

(MN963685)

Penicillium chrysogenum

Root

Eurotiales/ Ascomycota/

Eurotiomycetes

100

4.30

ARB5

(MN963689)

Angustimassarina sp.

Leaf

Pleosporales/ Ascomycota/ Dothideomycetes

100

2.41

ARB6

(MN963686)

Gnomoniopsis idaeicola

Leaf

Diaporthales/ Ascomycota/ Sordariomycetes

99

3.03

ARB21

(MN963687)

Cercospora sp.

Leaf

Capnodiales/ Ascomycota/ Dothideomycetes

100

2.53

ARS4

(MN963690)

Pleosporales sp.

Stem

Pleosporales/ Ascomycota/ Dothideomycetes

99

2.80

ARR2

(MN963688)

Cladosporium sphaerospermum

Root

Capnodiales/ Ascomycota/ Dothideomycetes

98

3.42

QZS1

(MN963691)

Cladosporium herbarum

Stem

Capnodiales/ Ascomycota/ Dothideomycetes

100

2.15

QZR4

(MN963692)

Penicillium citrinum

Root

Eurotiales/ Ascomycota/

Eurotiomycetes

100

5.05

QZR10

(MN963693)

Talaromyces amestolkiae

Root

Eurotiales/ Ascomycota/

Eurotiomycetes

100

3.67

 

Distribution in Tissues: During individual leaf, stem, and root sample analysis, significant fluctuations were recorded in the recovery of endophytic fungi (Table 5). The leaf samples harbored 310 fungal isolates, followed by root (282 isolates), and stem (199 isolates). Among the organs examined in the current study, the CF of the leaf was higher than other organs (Table 5). Of all the identified taxa, Fusarium, Alternaria, Epicoccum, Penicillium, and Cladosporium were the most dominant genera, and Fusarium had the highest CF, followed by Alternaria, Epicoccum, Penicillium, and Cladosporium, respectively (Figure 2). The data show that the diversity of endophytic fungi in C. avellana stem is higher than the leaf and root samples, and most of them belong to the phylum Ascomycota. The fungal community of stem appeared to be dominated by Epicoccum nigrum, Pyrenochaetopsis sp, Cladosporium tenuissimum, Alternaria alternate, and Pleosporales sp (Table 5). Furthermore, the richness of endophytic fungi in the stem (4.14) was higher than in other organs (Table 5). Root samples were mainly by A. alternate and Fusarium equiseti, also, the other dominant were Fusarium fujikuroi, Fusarium proliferatum, and Penicillium citrinum (Table 5). The endophytic population of leaf samples was dominated by E. nigrum, A. alternate, F. fujikuroi, and F. equiseti which occurred on more than 50% of the leaf segments.

 

 

Table 5- Number and Percentage of Colonized Segments of C. avellana according to Plant Tissues

Tissues

No. of samples

No. of endophytic fungi isolated

Endophyte species

CF%

Leaf

1620

310

21

9.41

Root

1620

282

23

8.61

Stem

1620

199

23

6.11

Total

4860

791

24

 

CF: Colonization frequency

Fig. 2- The colonization frequency (CF %) of each endophytic fungus genera from all C. avellana tissues and sampling location in Iran

Spatial Distribution: In terms of the number of endophyte isolates, sampling locations showed different results (Figure 3). The maximum number of isolates was found in samples of Golestan (149) followed by Guilan (138), Mazandaran (136), Zanjan (126), Qazvin (124), and Ardabil (118) (Table 6). Also, Endophytes of the Golestan location had the highest colonization rate (9.19), followed by Mazandaran, Guilan, Zanjan, Qazvin, and Ardabil, respectively (Table 6). Moreover, Alternaria, Epicoccum, Fusarium, Penicillium, and Cladosporium were the dominant genera, and they were found in the majority of sampling sites as well (Figure 3). In general, leaf and root samples from the Guilan location and stem samples from the Mazandaran location had the most diverse endophytic assemblage (Figures 3 b and c).

Table 6- The Numbers and Percentages of Colonized Segments of C. avellana according to Six Sampling Locations in Iran

Sampling location

No. of samples

No. of fungi isolated

Endophyte species

CF%

Golestan

810

149

23

18.39

Mazandaran

810

136

22

16.79

Guilan

810

138

23

17.03

Zanjan

810

126

17

15.55

Ardabil

810

118

21

14.56

Qazvin

810

124

21

15.30

Total

4860

791

24

 

 

Among all the sampling areas, endophytes from the Guilan location had the maximum Shannon–Wiener index (2.91) and Simpson’s index (0.95), while Zanjan had the least diversity indices (Table 7). In contrast, the stem had the highest diversity indices among the studied organs. The highest species richness and evenness of the endophytic fungi communities in tissues were observed in the stem (4.14 and 0.95), while in sampling sites, Guilan had the highest level of species richness (4.45) and Ardabil showed the highest species evenness (0.94). Maximum Jaccard similarity coefficients (Jc) were found between Guilan and Mazandaran locations, whereas it was the lowest between Zanjan and Qazvin (Figure 4).

Table 7- The Results of Species Diversity Indices for Collected Data According to Tissues and Locations from C. avellana in Iran

index

Tissue type

Locations

 

Root

Stem

Leaf

GOL

GI

MZ

ZN

AR

QZ

Species richness-margalef

3.877798

4.144478

3.494313

4.391

4.458

4.275

3.298

4.142

4.163

Shannon–Wiener

2.755025

2.992317

2.665741

2.815

2.915

2.717

2.499

2.868

2.797

Simpson's

0.923569

0.947884

0.90749

0.9272

0.951

0.9172

0.904

0.9428

0.936

pielou's evenness

0.878657

0.954337

0.875586

0.8979

0.9297

0.879

0.882

0.9419

0.918

GOL: Golestan; MZ: Mazandaran; GI: Guilan; ZN: Zanjan; AR: Ardabil; QZ: Qazvin

 

 

Ecological Associations: Correspondence analysis revealed a clear distinction between endophytic fungal communities obtained from tissues and different sampling areas (Figures 5 and 6). The analysis showed that some isolates have an affinity for a specific tissue or area. Moreover, in correspondence analysis, the isolates were categorized based on their abundance in each tissue or area. For example, Paraphaeosphaeria sporulosa was exclusively isolated from the root in the Golestan location (Figures 3, 5, and 6). Cladosporium herbarum was categorized more frequently from the Qazvin location (Figures 3 and 5).

 

 

Fig. 3- Distribution of endophytic fungi in tissues according to sampling location and based on the species presence or absence data; a. GOL: Golestan; b. MZ: Mazandaran; c. GI: Guilan; d. ZN: Zanjan; e. AR: Ardabil; f. QZ: Qazvin

 

 

Fig. 4- Analysis of the similarity degree using Jaccard method (32) among six provinces based on endophytic communities isolated from C. avellana tissues

 

 

Fig. 5- Component analysis (CA) of fungal endophytes isolated from different tissues of C. avellana

 

Fig. 6- Component analysis (CA) of the influence of different location on the isolated endophyte species from C. avellana

 

 

Discussion

According to the results of the present study, a variety of endophytic fungi colonize various organs of the hazelnut trees. All of the 791 isolates were morphologically and molecularly classified into 24 species, most of the isolates belonged to the phylum Ascomycetes (Table 4). Indeed, in most studies, Ascomycetes are reported as endophytic fungi and also as endophytic mycobiota of other woody plants (34, 35). Basidiomycetes’ endophytes have only been reported in a limited number of studies (36).

The results obtained for fungal frequency and diversity index in hazelnut tissues show that fungal frequency in leaves is higher than other tissues, which is consistent with Kharwar et al.’s study (37). They found that leaves harbored the maximum colonization of endophytic fungi greater than stem. Although the fungal frequency in the stem is lower, fungal diversity in the stem is higher than the leaf and root (Table 4). It appears that the fungal richness in stems of woody plants is higher than other organs. Tissues with a longer lifespan are more exposed to endophyte inoculation, and thus, have the greatest fungal richness in plant life history (38). Of course, the stem and bark of woody plants have a longer lifespan and are exposed to air, rain, and dust throughout the year. As a result, stem structures and substrates can affect fungal infections and increase their colonization frequency and species richness (39, 40). Conversely, leaf lifespan (even in evergreen trees) is not so long and doesn’t last as long as stem and root (41). Since C. avellana is a deciduous plant and its leaves have short durability, it can explain lower species diversity and species richness in leaf endophytes. In addition, the distribution and frequency of endophytic fungi may be affected by differences in the chemical content (terpenoids, phenols, and tannins) of tissues and organs (42). However, certain fungal taxa are able to utilize certain organs and survive in a particular tissue (43), for example, CA showed increased occurrence and frequency of certain species in specific tissues. Previous studies in other plants have also indicated the tissue-specificity of endophytes (36, 44, 45). In the present study, Paraphaeosphaeria sporulosa was isolated only from the root, whereas, some species colonized more than one tissue type (i.e. Pyrenochaetopsis sp. and Bjerkandera adusta only in stems and roots). Angustimassarina sp. occurred only in leaves and stems (Figures 1a and 5). Other studies also have shown similar results about the distribution of endophytic fungi exclusively in one or more tissues and sites (46, 47, 48).

Changes in the assemblage of endophytes present in a single host plant at different study locations include a relatively persistent group of fungal species characterized by several dominant species (42, 49), which is also supported by this study. Alternaria alternata, Epicoccum nigrum, Fusarium equiseti, and Fusarium fujikuroi were recorded as the most dominant species with different frequencies in various hazelnut tissues in each sampling location (Figure 3), which is in agreement with another report on Brassica napus endophytes (50) and medicinal plants (51). For example, A. alternata was the predominant species in the leaves and roots at the Mazandaran location as well as the main species in the roots and stems at the Golestan site. F. equiseti was the predominant endophyte in leaves and roots at the Zanjan location. However, at the Qazvin, Golestan, and Mazandaran sites, it was the main species only in roots. E. nigrum was also the predominant species in leaves, stems, and roots at Mazandaran, and in leaves at the Golestan location. Such endophyte distribution indicates the influence of tissue type in harboring fungi (2, 52), as well as the ability of some endophytes to move from one part of the host to another (53). The presence or absence of some endophytic fungi in certain tree tissues may indicate the endophytes priority for the colonization of host tissues during the establishment of their symbiosis (54).

Different geographical and climatic conditions also affect the colonization of plant tissues by endophytic fungal communities (55, 56). The geographical heterogeneity of fungal communities has been explained by dispersion limitations, host domain range, the evolution of regional adaptability, and environmental selection (56, 57). The findings of this study also indicate the influence of geographical factors on the distribution of endophytic fungi in hazelnut trees. It appears that the greater abundance and diversity of C. avellana endophytic fungi in the northern regions of Iran (Golestan, Mazandaran, and Guilan) is the result of their favorable geographical location and suitable climatic conditions. As reviewed by Vacher et al. (58), Fitt et al. (59), and Sadeghi et al. (60), rainfalls mainly contributed to shaping the endophytic community. Rainfalls might be important for fungal spore’s dispersion and colonization of endophytes and also high humidity help fungal spore germination. In this regard, the results of the present study are consistent with the results of the above studies.

In addition, the moderate annual temperature may allow the fungi to survive longer and thus, increase their success rate in colonizing plant tissues (41). Therefore, the highest abundance and richness of fungi observed could be due to the high temperature or rainfall observed during these areas. In contrast, endophytes isolated from the northwestern regions of Iran (Zanjan, Ardabil, and Qazvin) have less species richness and diversity (Table 7). These areas are highly cold and icy during some seasons, which can affect the colonization rate of hazelnut tissues by endophytic fungi. Hence, the climate can affect the richness of endophytic species in different regions (61). Researchers believe that the widest biodiversity of endophytes occurs in tropical and temperate regions (62, 63, 64). Also, the results of the present study indicated that the microbial abundance decreased with the altitude (Tables 1 and 6) which is stated in previous studies on endophytes of other psychrophilic (65, 66) and Mediterranean plants (67).

The effects of geographical factors also improved the composition of endophytes in plant tissues, provided that the sampling areas are distant or geographically different. This result was in agreement with previous studies in which climatic factors influence the endophytic community in organs (61, 68, 69). This result was predictable because fungi might be subjected to different selection pressures at different ecological sites, which can lead to the selection of a very specific fungal population in each location (12). The total isolates of hazelnuts at six sampling locations were compared by the Jaccard similarity index (Jc) (Figure 4). As seen, the highest observed overlap in C. avellana communities is in Golestan, Mazandaran, and Guilan sampling locations. This finding is logical because these locations share more similar ecological features than the rest of the sampling locations. It can be concluded that the environmental conditions and type of tissues (examined in this study) and other factors such as seasonality, sampled plant/tissue, age, and phenological stage examined in other studies (13, 69, 70) may affect these relationships.

However, in the present study, the role of endophytes in the production of secondary metabolites and increasing the resistance of hazelnuts to cold stress has not been investigated. But, it is suggested that endophytes can perform or modulate various essential functions in plants directly affecting growth, development, and tolerance to different biotic and/or abiotic conditions (71, 72). In extreme environments which impose severe limitations for growth, the establishment of functional symbioses with microorganisms can play a fundamental role in the adaptation of plants to environmental stress events due to a greater accumulation of solutes, reduced foliar conductance, decreased transpiration, or the formation of thicker cuticles (73, 74, 75, 76). Many endophytes can also produce secondary metabolites, which offer protection against different phytopathogens and/or herbivores including insects (36). In summary, endophytes confer strong fitness to their host plants and this may affect the adaption of plants to different climates.

The overall findings of the present study showed that fungal endophytes densely inhabit C. avellana tissues and that spatial structure tends to influence the species composition. It was also shown that hazelnut endophytic communities include a diverse range of fungi. Since this is the first work on the diversity and distribution of hazelnut-related fungal endophytes under diverse environmental and geographical conditions, further research is needed to identify the functional and ecological significance of these endophytes. It is also essential to understand the role of endophytic fungi in a broader perspective about the production of secondary metabolites, biochemical control agents, and response to environmental conditions in the host micro-ecosystem.

Acknowledgement

The authors of the study are thankful to Mr. Hosseini, the expert of the Central Laboratory, Gonbad Kavous Agricultural University for all laboratory assistance. We are grateful to Golestan province Natural Resources Department, Maraveh Tappeh area Agricultural Service Center, Minoodasht Agricultural Jihad, Tonekabon Agricultural Jihad, Dohezar area Agricultural Service Center, Guilan province Agricultural Jihad, Qazvin Research Center, Ardabil Agricultural Jihad and Zanjan Research Center and Agricultural Jihad for their cooperation with sampling. This article is an excerpt from the PhD dissertation of Zabol University, Iran.

(1) Zabalgogeazcoa. Fungal endophytes and their interactions with plant pathogens. Spanish Journal of agricultural research 2008; 6: 138-146.
(2) Douanla-Meli C., Langer E., Mouafo F. T. Fungal endophyte diversity and community patterns in healthy and yellowing leaves of Citrus limon. Journal of Fungal Ecology 2013; 6 (3): 212-22.
(3) Jones E. G., Stanley S. J., Pinruan U. Marine endophyte sources of new chemical natural products: a review. Botanica marina 2008; 51 (3): 163-70.
(4) Strobel G. The emergence of endophytic microbes and their biological promise. Journal of Fungi 2018; 4 (2): 57.
(5) Singh D. K., Sharma V. K., Kumar J., Mishra A., Verma S. K., Sieber T. N., Kharwar R. N. Diversity of endophytic mycobiota of tropical tree Tectona grandis Linn. f.: Spatiotemporal and tissue type effects. Journal of Scientific reports 2017; 7 (1): 1-4.
(6) Strobel G. The emergence of endophytic microbes and their biological promise. Journal of Fungi 2018; 4 (2): 57.
(7) Gangadevi V., Muthumary J. Preliminary studies on cytotoxic effect of fungal taxol on cancer cell lines. African Journal of Biotechnology 2007; 6 (12): 1382-86.
(8) Khan R., Shahzad S., Choudhary M. I., Khan S. A., Ahmad A. Communities of endophytic fungi in medicinal plant Withania somnifera. Pakistan journal of botany 2010 Jan; 42(2): 1281-7.
(9) Zafari D., Leylaiee S., Tajick M. A. Isolation and identification of vinblastine from the fungus of Chaetomium globosum Cr95 isolated from Catharanthus roseus plant. Biological Journal of Microorganism 2020; 8 (32).
(10) Ramesh V., Arivudainambi US., Rajendran A. The molecular phylogeny and taxonomy of endophytic fungal species from the leaves of Vitex negundo L. Studies in Fungi 2017; 2 (1): 26-38.
(11) Nicoletti R. Endophytic fungi of citrus plants. Agriculture 2019; 9(12): 247.
(12) Campisano A., Albanese D., Yousaf S., Pancher M., Donati C., Pertot I. Temperature drives the assembly of endophytic communities' seasonal succession. Journal of Environmental microbiology 2017; 19 (8): 3353-64.
(13) Verma V. C., Gond S. K., Kumar A., Kharwar R. N., Strobel G. The endophytic mycoflora of bark, leaf, and stem tissues of Azadirachta indica A. Juss (Neem) from Varanasi (India). Journal of Microbial Ecology 2007; 54 (1): 119-25.
 (14) Chutulo E. C., Chalannavar R. K. Endophytic mycoflora and their bioactive compounds from Azadirachta indica: A comprehensive review. Journal of Fungi 2018; 4 (2): 42.
(15) Gallego A., Malik S., Yousefzadi M., Makhzoum A., Tremouillaux-Guiller J., Bonfill M. Taxol from Corylus avellana: paving the way for a new source of this anti-cancer drug. Plant Cell, Tissue and Organ Culture (PCTOC) 2017; 129 (1): 1-6.
(16) Salehi M., Moieni A., Safaie N., Farhadi S. Elicitors derived from endophytic fungi Chaetomium globosum and Paraconiothyrium brasiliense enhance paclitaxel production in Corylus avellana cell suspension culture. Plant Cell, Tissue and Organ Culture (PCTOC) 2019; 136 (1): 161-71.
(17) Mehlenbacher S. A. Geographic distribution of incompatibility alleles in cultivars and selections of European hazelnut. Journal of the American Society for Horticultural Science 2014; 139 (2): 191-212.
(18) Firouzi S., Allahyari M. S., Hadizadeh F., Koundinya V. Factors affecting the development of hazelnut harvesting mechanization in Guilan Province of Iran. Journal of Nuts 2017; 8 (1): 10.
(19) Amini-Noori F., Ziarati P., Jafarpour A. Nutritive Value of Persian Hazelnut (Corylus avellana L.) Orchards. Journal of Pharmaceutical and Health Sciences 2016; 4 (1): 71-7.
(20) Tan X. M., Chen X. M., Wang C. L., Jin X. H., Cui J. L., Chen J., Guo S. X., Zhao L. F. Isolation and identification of endophytic fungi in roots of nine Holcoglossum plants (Orchidaceae) collected from Yunnan, Guangxi, and Hainan provinces of China. Current Microbiology 2012; 64 (2): 140-147.
(21) Barnett H. L, Hunter B. B. Illustrated genera of imperfect fungi. American Phytopathological Society (APS Press); 1998.
(22) Simmons E. G. Alternaria: an identification manual. Utrecht: CBS Fungal Biodiver- sity Centre; 2007.
(23) Bensch K., Braun U., Groenewald J. Z., Crous P. W. The genus Cladosporium. Journal of Studies in Mycology 2012; 72, 1-401.
(24) Visagie C. M., Houbraken J., Frisvad J. C., Hong S. B., Klaassen C. H., Perrone G., Seifert K. A., Varga J., Yaguchi T., Samson R. A. Identification and nomenclature of the genus Penicillium. Journal of Studies in mycology 2014; 78: 343-71.
(25) Vidal A., Parada R., Mendoza L., Cotoras M. Endophytic Fungi Isolated from Plants Growing in Central Andean Precordillera of Chile with Antifungal Activity against Botrytis cinerea. Journal of Fungi 2020; 6: 149.
(26) White T. J., Bruns T., Lee S. J., Taylor J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications 1990; 18 (1): 315-322.
(27) Vilgalys R., Hester M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 1990; 172: 4239-4246.
(28) Rehner S. A., Buckley E. A. Beauveria phylogeny inferred from nuclear ITS and EF1-α sequences: evidence for cryptic diversification and links to cordyceps teleomorphs. Mycologia 2005; 97: 84-98.
(29) O'Donnell K., Cigelnik E. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetics and Evolution 1997; 7: 103-107.
(30) Rather R. A., Srinivasan V., Anwar M. Seasonal deviation effects foliar endophyte assemblage and diversity in Asparagus racemosus and Hemidesmus indicus. BMC ecology 2018; 18 (1): 1-1.
(31) Gräfenhan T., Schroers H. J., Nirenberg H. I., Seifert K. A. An overview of the taxonomy, phylogeny, and typification of nectriaceous fungi in Cosmospora, Acremonium, Fusarium, Stilbella, and Volutella. Studies in Mycology 2011; 68: 79-113.
(32) Pereira E., Vázquez de Aldana B. R., San Emeterio L., Zabalgogeazcoa I. A survey of culturable fungal endophytes from Festuca rubra subsp. pruinosa, a grass from marine cliffs, reveals a core microbiome. Journal of Frontiers in microbiology 2019; 9: 3321.
(33) Juybari H. Z., Tajick Ghanbary M. A., Rahimian H., Karimi K., Arzanlou M. Seasonal, tissue and age influences on frequency and biodiversity of endophytic fungi of Citrus sinensis in Iran. Journal of Forest Pathology 2019; 49 (6): e12559.
(34) Sadeghi F., Samsampour D., Seyahooei M. A., Bagheri A., Soltani J. Diversity and spatiotemporal distribution of fungal endophytes associated with Citrus reticulata cv. Siyahoo. Current microbiology 2019; 76 (3): 279-89.
(35) Angelini P., Rubini A., Gigante D., Reale L., Pagiotti R., Venanzoni R. The endophytic fungal communities associated with the leaves and roots of the common reed (Phragmites australis) in Lake Trasimeno (Perugia, Italy) in declining and healthy stands. Journal of Fungal ecology 2012; 5 (6): 683-93.
(36) Rivera-Orduña F. N., Suarez-Sanchez R. A., Flores-Bustamante Z. R., Gracida-Rodriguez J. N., Flores-Cotera L. B. Diversity of endophytic fungi of Taxus globosa (Mexican yew). Journal of Fungal Diversity 2011; 47 (1): 65-74.
(37) Kharwar R. N., Verma S. K., Mishra A., Gond S. K., Sharma V. K., Afreen T, Kumar A. Assessment of diversity, distribution and antibacterial activity of endophytic fungi isolated from a medicinal plant Adenocalymma alliaceum Miers. Symbiosis 2011; 55 (1): 39–46.
(38) Harrison J. G., Griffin E. A. The diversity and distribution of endophytes across biomes, plant phylogeny and host tissues: how far have we come and where do we go from here?. Journal of Environmental Microbiology; 2020.
(39) Sun X., Ding Q., Hyde K. D., Guo L. D. Community structure and preference of endophytic fungi of three woody plants in a mixed forest. Journal of Fungal Ecology 2012; 5 (5): 624-32.
(40) Golparyan F., Azizi A., Soltani J. Endophytes of Lippia citriodora (Syn. Aloysia triphylla) enhance its growth and antioxidant activity. European Journal of Plant Pathology 2018; 152 (3): 759-68.
(41) Gomes T, Pereira J. A, Benhadi J, Lino-Neto T, Baptista P. Endophytic and epiphytic phyllosphere fungal communities are shaped by different environmental factors in a Mediterranean ecosystem. Journal of Microbial ecology 2018; 76 (3): 668-79.
(42) Carroll G., Petrini O. Patterns of substrate utilization by some fungal endophytes from coniferous foliage. Mycologia 1983; 75 (1): 53-63.
(43) Photita W., Lumyong S., Lumyong P., Hyde K. D. Endophytic fungi of wild banana (Musa acuminata) at doi Suthep Pui National Park, Thailand. Mycological Research 2001; 105 (12): 1508-13.
(44) Kumar D. S., Hyde K. D. Biodiversity and tissue-recurrence of endophytic fungi in Tripterygium wilfordii. Journal of Fungal Diversity; 2004.
(45) Bills G. F, Polishook J. D. Recovery of endophytic fungi from Chamaecyparis thyroides. Sydowia 1992; 44 (1): 1-2.
(46) Johnston P. R., Johansen R. B., Williams A. F., Paula Wikie J., Park D. Patterns of fungal diversity in New Zealand Nothofagus forests. Journal of Fungal Biology 2012; 116 (3): 401-412.
(47) Pancher M., Ceol M., Corneo PE., Longa C. M., Yousaf S., Pertot I., Campisano A. Fungal endophytic communities in grapevines (Vitis vinifera L.) respond to crop management. Journal of Applied and environmental microbiology 2012; 78 (12): 4308-4317.
(48) Ek-Ramos M. J., Zhou W., Valencia C. U., Antwi J. B., Kalns L. L., Morgan G. D., Kerns D. L., Sword G. A. Spatial and temporal variation in fungal endophyte communities isolated from cultivated cotton (Gossypium hirsutum). PLoS One 2013; 8 (6): e66049.
(49) Wang Y., Guo LD. A comparative study of endophytic fungi in needles, bark, and xylem of Pinus tabulaeformis. Journal of Botany 2007; 85 (10): 911-917.
(50) Zhang Q., Zhang J., Yang L., Zhang L., Jiang D., Chen W., Li G. Diversity and biocontrol potential of endophytic fungi in Brassica napus. Journal of Biological Control 2014; 72: 98-108.
(51) Sun J., Guo L., Zang W., Ping W., Chi D. Diversity and ecological distribution of endophytic fungi associated with medicinal plants. Science in China Series C: Life Sciences 2008; 51 (8): 751-9.
(52) Mishra A., Gond S. K., Kumar A., Sharma V. K., Verma S. K., Kharwar R. N., Sieber T. N. Season and tissue type affect fungal endophyte communities of the Indian medicinal plant Tinospora cordifolia more strongly than geographic location. Journal of Microbial ecology 2012; 64 (2): 388-98.
(53) Bettucci L., Alonso R., Fernandez L. M. A comparative study of fungal populations in healthy and symptomatic twigs and seedlings of Eucalyptus globulus in Uruguay. SYDOWIA-HORN 1997; 49: 109-17.
(54) Johnson N. C., Angelard C., Sanders I. R., Kiers E. T. Predicting community and ecosystem outcomes of mycorrhizal responses to global change. Journal of Ecology letters 2013; 16: 140-53.
(55) Campisano A., Albanese D., Yousaf S., Pancher M., Donati C., Pertot I. Temperature drives the assembly of endophytic communities' seasonal succession. Journal of Environmental microbiology 2017; 19 (8): 3353-64.
(56) Lumbsch H. T., Buchanan P. K., May T. W., Mueller G. M. Phylogeography and biogeography of fungi. Journal of Mycological Research 2008; 112 (4): 423-424.
(57) Peay K. G., Bidartondo M. I., Arnold A. E. Not every fungus is everywhere: scaling to the biogeography of fungal–plant interactions across roots, shoots and ecosystems. The New Phytologist 2010; 185 (4): 878-882.
(58) Vacher C., Hampe A., Porté A. J., Sauer U, Compant S, Morris C. E. The phyllosphere: microbial jungle at the plant–climate interface. Annual review of ecology, evolution, and systematics 2016; 47: 1-24.
(59) Fitt B. D., McCartney H. A., Walklate P. J. The role of rain in dispersal of pathogen inoculum. Annual review of phytopathology 1989; 27 (1): 241-270.
(60) Sadeghi F., Samsampour D., Seyahooei M. A., Bagheri A., Soltani J. Diversity and spatiotemporal distribution of fungal endophytes associated with Citrus reticulata cv. Siyahoo. Journal of Current microbiology 2019; 76 (3): 279-89.
(61) Hyde K. D., Soytong K. The fungal endophyte dilemma. Fungal Diversity 2008; 33 (163): e173.
(62) Zimmerman N. B., Vitousek P. M. Fungal endophyte communities reflect environmental structuring across a Hawaiian landscape. Proceedings of the National Academy of Sciences 2012; 109 (32): 13022-7.
(63) Zheng Y. K., Qiao X. G., Miao C. P., Liu K., Chen Y. W., Xu L. H., Zhao L. X. Diversity, distribution and biotechnological potential of endophytic fungi. Annals of Microbiology 2016 Jun 1; 66(2): 529-42.
(64) Su Y. Y., Guo L. D., Hyde K. D. Response of endophytic fungi of Stipa grandis to experimental plant function group removal in Inner Mongolia steppe, China. Journal of Fungal Diversity 2010; 43 (1): 93-101.
(65) Margesin R., Miteva V. Diversity and ecology of psychrophilic microorganisms. Journal of Research in microbiology 2011; 162 (3): 346-61.
(66) Li H. Y., Shen M., Zhou Z. P., Li T., Wei Y. L., Lin L. B. Diversity and cold adaptation of endophytic fungi from five dominant plant species collected from the Baima Snow Mountain, Southwest China. Journal of Fungal Diversity 2012; 54 (1): 79-86.
(67) Moricca S., Ginetti B., Ragazzi A. Species-and organ-specificity in endophytes colonizing healthy and declining Mediterranean oaks. Phytopathologia Mediterranea 2012; 587-98.
(68) Sun X., Ding Q., Hyde K. D., Guo L. D. Community structure and preference of endophytic fungi of three woody plants in a mixed forest. Journal of Fungal ecology 2012; 5 (5): 624-32.
(69) Ntuba-Jua G. M, Mih A. M, Bechem E. E. Biosciences and Plant Biology. International Journal of Current Research Biosciences and Plant Biology 2017; 4 (6): 7.
(70) Peršoh D. Factors shaping community structure of endophytic fungi–evidence from the Pinus-Viscum-system. Journal of Fungal Diversity 2013; 60 (1): 55-69.
(71) Molina-Montenegro M. A., Oses R., Torres-Díaz C., Atala C., Zurita-Silva A., and Ruiz-Lara, S. Root-endophytes improve the ecophysiological performance and production of an agricultural species under drought condition. AOB Plants 2016; 8: 62.
(72) Acuña-Rodríguez I. S., Hansen H., Gallardo-Cerda J., Atala C., and Molina-Montenegro MA. Antarctic extremophiles: biotechnological alternative to crop productivity in saline soils. Front. Journal of Bioengenering Biotechnology 2019; 7: 22.
(73) Hamilton C. E., Gundel P. E., Helander M., Saikkonen K.. Endophytic mediation of reactive oxygen species and antioxidant activity in plants: a review. Journal of Fungal Divers 2012; 54: 1–10.
(74) Timmusk S, Abd El-Daim I. A., Copolovici L., Tanilas T., Kännaste A. Drought-tolerance of wheat improved by rhizosphere bacteria from harsh environments: enhanced biomass production and reduced emissions of stress volatiles. PLoS One 2014; 9: e96086.
(75) Lata R. S., Chowdhury S. K., Gond J. F., White J. M. Induction of abiotic stress tolerance in plants by endophytic microbes. Letters in Applied Microbiology 2018; 66 (4): 268–276.
(76) Hereme R., Morales-Navarro S., Ballesteros G., Barrera A., Ramos P., Gundel P. E., Molina-Montenegro M. A. Fungal Endophytes Exert Positive Effects on Colobanthus quitensis Under Water Stress but Neutral under a Projected Climate Change Scenario in Antarctica. Journal of Frontiers in Microbiology 2020; 11 (264).