Isolation and identification of Lactobacillus plantarum from vinegar, by specific RecA gene and its anticancer activities

Document Type : Original Article- English

Authors

1 Department of Cell and Molecular Biology and Microbiology, University of Isfahan, Isfahan, Iran

2 Department of Biotechnology, BuAli Sina University, Hamedan, Iran

3 Sir John Walsh Research institute, Faculty of Dentistry, University of Otago, Dunedin, New Zealand

Abstract

The rising demand for non-dairy probiotic products is driven by factors such as vegetarian diets, concerns about high cholesterol in milk and lactose intolerance. This research investigated the presence of Lactobacillus plantarum in apple, pear, and quince vinegar using molecular and biochemical methods. Isolated microorganisms were evaluated for probiotic potential based on their ability to grow at different bile salt concentrations and pH levels. Biochemical characterization included sugar fermentation profile, presence of extracellular enzymes and antibiotic susceptibility testing. Molecular identification of strains employed specific L. plantarum recA (Recombinase A) primer targeting the recA gene, which encodes a multifunctional protein essential for bacterial cells. Among the 24 microorganisms isolated from apple, pear, and quince vinegar, nine strains displayed a specific band with the L. plantarum recA primers, confirming their identity. These Gram-positive bacteria were positive for lipase and protease activity but negative for catalase, amylase, gelatinase, and oxidase. The L. plantarum strains fermented all tested sugars except xylose and demonstrated tolerance to acidic and bile-containing environments, high temperatures, and salt concentrations.  While resistant to eight of the 15 antibiotics tested, the bacteria showed relative sensitivity to three. Furthermore, they exhibited anti-proliferative effects on human HT-29 cancer cells, suggesting potential as anticancer agents. This study successfully isolated L. plantarum strains from apple, pear, and quince vinegar with promising probiotic and anticancer properties.

Keywords

Main Subjects


Introduction:

Probiotics are living microorganisms that, when consumed in sufficient quantities, have a beneficial effect on the health of their host (1). These bacteria are resistant to the acidic environment of the digestive tract, mainly by neutralizing harmful bacteria. This, in turn, contributes to a harmonious balance of intestinal flora, promoting health benefits and growth in both humans and livestock. The multiple roles of these bacteria include antimicrobial activity, reduction of serum cholesterol , improvement of metabolism, anti-mutagenic properties, stimulation of  the immune system, improvement of inflammatory intestines diseases, anti-cancer and anti-diarrheal properties, synthesis of biomaterials, differentiation of stem cells  and suppression of Helicobacteria (2, 3, 4, 5, 6, 7).

 Probiotic bacteria show efficacy not only in human and animal systems, but also in plant environments, offering significant benefits such as soil fertilization and commercial use for biological control of plant diseases (8). The ability of these bacteria to decompose insoluble phosphorus in the soil and make it available to plants has also been demonstrated (9). While the historical use of probiotics can be traced back to fermented dairy products, particularly in the human diet, recent years have witnessed a surge of interest in the application of probiotics in both the nutritional and agricultural fields. The selection of novel probiotic strains and the exploration of new applications have become paramount (10). Although dairy products have traditionally been the primary source of probiotic-rich foods, recent research has revealed the presence of probiotic bacteria in non-dairy sources (11). The escalating demand for non-dairy probiotic products, driven by dietary choices such as vegetarianism (avoidance of meat products) and the challenges posed by high cholesterol in milk and lactose intolerance in certain individuals, has underscored the need to prioritize research into the development of plant-based probiotic products (10). For the purpose of this study, vinegar is of primary interest.

The word vinegar, derived from the words "vin" meaning "wine" and "egar" meaning "sour", is a French word meaning "sour wine" which is produced in different ways using different raw materials. In terms of production, vinegar is obtained by alcoholic fermentation, then acetic fermentation of sugar substances. Fruit vinegar, in particular, is important in the field of food and agricultural products, as it is used both as a preservative and as an additive in the food industry (12). Vinegar contains organic acids such as malic acid and acetic acid, as well as flavonoids such as camperol, epicatechin, catechin, anthocyanin, and quercetin. Research suggests that these components have the potential to inhibit blood pressure increases and counteract toxic substances in the body (13). Lactobacilli are rod-shaped bacteria that are gram-positive and catalase and oxidase negative (14). These microorganisms are found in a variety of fermented plant, dairy, and meat products. The presence of these bacteria as probiotics in the digestive tract has also been demonstrated. L. plantarum is one of the most important species of lactic acid bacteria due to its great ability to be compatible with and adapt to different niches. The proven health effects of using L. plantarum in foods include the reduction of gastrointestinal infections and the risk of gastrointestinal inflammatory diseases and the stimulation of the immune system. Studies have shown that L. plantarum, as a natural inhibitor of bioprocessed foods, inhibits the growth of pathogenic bacteria and spoilage microorganisms during storage and increases the shelf life of the product (15).

The protein RecA (Recombinase A) in prokaryotic cells is an active protein that has multiple functions in a bacterial cell. The coding gene for this protein was first recognized in E. coli, and attempts to find the equivalent of this gene in bacteria led to the identification of a large number of these proteins. RecA is a small protein that has been shown to have multiple functions in DNA binding (single-stranded and double-stranded), coupling and exchange of homologous DNA, and hydrolysis of ATP (16). This primer has been used and confirmed for the study of different species of Lactobacillus, especially L. plantarum (17). In the selection of probiotic bacteria, evaluation of their resistance to antibiotics is a critical safety consideration for bacterial application. In assessing resistance to gastrointestinal conditions, these microorganisms must overcome the challenges posed by acidity and bile. If they demonstrate substantial survival capabilities under these conditions, their resistance to antibiotics is considered a valuable trait (18). Given the importance of the role of bacteria in the production of commercial and industrial enzymes and the role of these enzymes in the human and animal gastrointestinal tract, the ability  of several L. plantarum bacteria to produce certain enzymes has been investigated in vitro (19, 20, 21).

 The current study aimed to determine the presence of L. plantarum in apple, quince and pear vinegar by biochemical and molecular methods using specific primers and their anticancer effect on colon cancer cells.

Materials and Methods:

  • Sample collection , preparation, cultivation and incubation :

We collected samples of homemade apple, quince, and pear vinegars from local sources in Isfahan province. These samples were stored at room temperature until the time of collection. We then transported them to the Biotechnology Laboratory of Bu-Ali Sina University in Hamedan. The 10-4 serial dilution of the samples was prepared using the sterile physiological serum. For the growth of probiotic bacteria (Lactobacilli in particular) 100 μl of different dilutions were cultured on special de Man, Rogosa and Sharpe culture media (MRS; Merck, Germanyand the media were incubated at 37°C for 72 hours (22).

  • Morphological characteristics:

After Gram staining, the characteristics of each colony and cell were examined and recorded under a light microscope. Colonies similar in appearance to   Lactobacillus with the bacterial characteristics of rod-shaped, gram-positive and non-sporulated were selected. To confirm the purity of the bacteria, each strain was subcultured several times in the MRS medium (14).

  • Fermentation:

Acid production from sugars was analyzed using an MRS medium without meat extracts and glucose. For this purpose, 2 ml of a special MRS medium for fermentation containing 1% sugar and phenol reagent was added to each tube (using a Durham tube). After inoculation with 1% of the active bacterial isolate, the tubes were kept in the incubator under 5% carbon dioxide gas at 37ºC for a period of 72 hours to one week. The color change of the MRS medium from red to yellow and the formation of bubbles in the Durham tubes were considered as consumption of sugar and production of acid (23).

  • Evaluation of probiotic properties:

The ability of bacteria to grow in MRS medium with pH 3.5, 4, 4.5and 5 was tested. HCl (8N) was used to adjust the low pH. The ability of bacteria to grow in the presence of 0.3 and 0.5% Oxgall was simultaneously evaluated. For these experiments, 1% active culture was added to the MRS liquid culture medium supplemented with Oxgall. The cultures were incubated at 37ºC for 72 hours. The growth ability of the isolates was evaluated by observing the turbidity levels at 24, 48 and 72 hours and the results were recorded as positive-negative values (24). The growth ability of Lactobacillus isolates was investigated at 15, 20, 40 and, 45ºC, and 4.5% and 6.5% concentrations of NaCl (Sigma (. Tests were performed according to the method Adikari et al. (2021) (14).

  • Antibiotic resistance:

Antibiotic resistance of Lactobacillus isolates against 15 different antibiotics was evaluated. The antibiotics included tetracycline (30 μg), vancomycin (30 μg), ciprofloxacin (5 μg), penicillin (10 μg), amoxicillin (25 μg), co-amoxiclav (30 μg), ceftriaxone (30 μg), erythromycin (15 μg), ofloxacin (5 μg), nalidixic acid (30 μg), tobramycin (10 μg), rifampicin (5 μg), nitrofurantoin (300 μg), cefalexin (30 μg), chloramphenicol (30 μg). The experiment was performed according to the method of Cebeci et al. (2003). 200 μl of enriched culture was added to 4 ml of soft agar MRS medium (containing 1% agar). The soft agar was then poured onto pre-prepared plates (containing 15 ml of solid MRS medium (1.5% agar)). Antibiotic discs were placed on the agar surface and incubated at 37ºC. After 24 hours, the diameter of the inhibition zone around the discs was measured and the results were recorded as resistant, semi-sensitive and sensitive (25).

  • Screening of extracellular enzymes from  plantarum bacteria:

The production of extracellular enzymes by L. plantarum bacteria was investigated by screening digestion of the specific substrate of amylase (20), lipase (19), gelatinase  and protease (21) enzymes. Isolates were cultured on solid MRS medium and incubated for 48 hours. They were then cultured linearly on a specific enzyme medium and incubated at 37ºC for 5-10 days. The results of the presence or absence of an enzyme were recorded as positive or negative, respectively.

  • Molecular identification:

Bacterial DNA was extracted and purified using the slightly modified method of Chagneud et al. (2001). 10 ml of bacterial suspension (from 24h culture) was centrifuged at 13000 rpm for 10 min. The pellets were transferred to microtubes and 1 ml of CTAB buffer at 65 ºC (CTAB powder (2%), 1M Tris-HCl pH 8, 50mM Na2EDTA pH 8 and 5M NaCl) was added. Samples were placed in a warm water bath at 60ºC for half an hour, stirring every 5 minutes. A volume of chloroform: isoamyl alcohol (24:1) equal to that of the samples was added and the tubes were vortexed. The samples were placed on a shaker for 10 minutes and the tubes were shaken by hand every minute. The tubes were then centrifuged at 13000 rpm for 5 minutes. At this stage, three phases were formed and the upper aqueous of each sample was gently transferred to the new tubes. After adding a volume of the pure cold isopropanol equal to that of upper aqueous, the contents of each tube were gently mixed by inversion and placed on ice for 10 minutes. For DNA sedimentation, samples were centrifuged at 13,000 rpm for 10 minutes at 4°C. The upper liquid layer was slowly removed and 500 μl of 70% ethanol was added to each tube. The samples were centrifuged at 13,000 rpm for 5 minutes and the supernatant was slowly removed. The tubes were then exposed to air for one hour to dry the DNA. After ensuring that the sediment was dry, 100 μl of sterilized deionized distilled water was added to each microtube and the samples were placed in a refrigerator at 4ºC for one night. For longer storage, samples were transferred to a freezer at -20ºC. The quality of the extracted DNA was confirmed by electrophoresis on a 1% agarose gel and by light absorption (26). Each 25 μl, PCR reaction mixture contained 7 μl of DNA samples. Specific PCR primers, a forward specific primer (planF; 5'-CCGTTTATGCGGAACACCTA-3') and (pREV; 5'-TCGGGACCAAACATCAC-3'), were used to identify L. plantarum isolates (previously identified based on phenotypic and biochemical characteristics). The primers were purchased from SinaGene Co. The specific primer designed by Torriani et al. (2001) was used based on a specific sequence of the recA gene to identify L. plantarum. The final concentration of each primer in the PCR mixture was 1 mM. For this purpose, 0.5 μl of   primer solution was added to each reaction mixture. The master mix (Amplicon, Denmark) containing dNTP, MgCl2, Taq polymerase enzyme and buffer was used. The PCR (Techne, UK) was programmed as follows: Denaturation at 94°C for 3 minutes, followed by the first stage amplification reaction in 30 cycles: denaturation at 94°C for 30 seconds, primer annealing at 51°C for 45 seconds and the elongation step at 72°C for 30 seconds and final expansion at 72°C for 5 minutes. Five μl of samples were applied to 1% agarose gel wells containing green viewer, and electrophoresed in a TBE buffer, at a constant voltage of 80 volts. After 1.5 hours, the voltage was removed and the gel was photographed in the gel duct system using ultraviolet light.

  • Evaluation of cell proliferation by MTT assay

Cultured bacterial cells (A1) were centrifuged at 5,000 g for 15 minutes, and the resulting supernatants were filtered through a 0.45 µm filter. These cell-free supernatants were then subjected to freeze-drying. Different concentrations (2, 5, and 10 mg/ml) of the cell-free supernatant were prepared for cell viability assays. The HT-29 human colon cancer cell line was obtained from the Pasteur Institute of Iran in Tehran. HT-29 cells were cultured in RPMI medium (Sigma, Germany) containing 10% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin/streptomycin. The cells were incubated at 37°C in a humidified atmosphere containing 5% CO2. After reaching confluence, the cells were detached using trypsin-EDTA. The MTT assay is based on the reduction of the tetrazolium salt, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Merck, Germany), by actively growing cells. In the experiment, 180 µl of cells were seeded in 96-well microplates at a concentration of 2×104 cells/ml and incubated for 24, 48 and 72 hours. Then, 20 µl of different concentrations of cell-free supernatants were added and the cells were further incubated at 37°C. Bradford's solution was used to quantify the protein content in a mixture. The preparation consisted of thoroughly dissolving 0.01 grams of Coomassie Blue G-250 color powder in 5 ml of 95% ethanol.  Then 10 ml of phosphoric acid (85%) was added to the mixture. The volume was then adjusted to 100 ml with distilled water. The resulting solution was carefully stored in a dark container, protected from light, and kept at refrigeration temperature. To convert the numerical value obtained from the quantitative protein measurement using the Bradford solution by colorimetry to the final concentration of protein expressed in milligrams per milliliter of solution, the light absorbance was compared to a standard curve. After   24, 48 and 72 hours of incubation, 20 µl of MTT solution (5 mg/ml) was added to each well and incubated for a further 3 hours. The culture medium was then removed and the blue formazan crystals were solubilized with 150 µl of dimethyl sulfoxide (DMSO, Merck, Germany). MTT was converted to formazan by metabolically viable cells, and its absorbance was measured at 540 nm using an ELISA reader (27, 28).

  • Statistical analysis

One-way analysis of variance (ANOVA) was used to evaluate the experimental data, with differences considered significant at a significance level of P < 0.05.

 Results:

  • Biochemical characterization of isolated bacteria:

Various microorganisms, including Gram-positive cocci, Gram-positive and -negative rod bacilli, and yeasts, thrived on the MRS medium see Table 1). Among the bacteria that exhibited a bacilli-like microscopic morphology, were positive for Gram staining, and were negative for both catalase and oxidase assays, the strains identified as Lactobacillus were selected for subsequent experiments. These Lactobacillus bacteria were used in the remaining phases of the study. The fermentation of sugars by the bacilli bacteria is detailed in Table 2. The sugar fermentation pattern of the nine isolates (A1, A7, A8, P2, P5, P6, Q3, Q4, Q5) was consistent with the characteristics of the L. plantarum species mentioned in the systematic classification of Bergey (23).

 

Table 1- Growth of microorganisms on a specific culture medium of apple, pear and quince vinegar

Strain

A1

A2

A3

A4

A5

A6

A7

A8

P1

P2

P3

P4

P5

P6

P7

P8

Q1

Q2

Q3

Q4

Q5

Q6

Q7

Q8

Cell shape

bacilli

yeast

cocci

bacilli

yeast

cocci

bacilli

bacilli

yeast

bacilli

bacilli

yeast

bacilli

bacilli

cocci

cocci

yeast

yeast

bacilli

bacilli

bacilli

cocci

cocci

cocci

Gram

positive

-

positive

positive

-

negative

positive

positive

-

positive

positive

-

positive

positive

negative

positive

-

-

positive

positive

positive

positive

positive

negative

A; Apple vinegar strains, P; Pear vinegar strains, Q; Quince vinegar strains

 

 

Table 2- Use and fermentation of different sugars.

 

 

 

 

 

 

 

Sugars

 

 

 

 

 

 

 

Strains

Sorbitol

Mannose

Xylose

Gluconate

Manitol

Cellubiose

Arabinose

Threhalose

Raffinose

Melebiose

Fructose

Lactose

Galactose

Ribose

A1

+

+

-

+

+

+

+

W

+

+

+

+

+

+

A4

+

+

-

+

+

+

-

+

+

-

+

+

+

+

A7

+

+

-

+

+

+

W

+

+

+

+

+

+

+

A8

+

+

-

+

+

+

+

+

+

+

+

+

+

+

P2

+

+

-

+

+

+

+

+

+

+

+

+

+

+

P3

-

+

+

+

-

+

+

+

+

+

+

+

+

-

P5

+

+

-

+

+

+

+

+

+

+

W

+

+

+

P6

+

+

-

+

+

+

+

+

+

+

+

+

+

+

P8

+

W

-

+

+

+

+

+

+

+

+

+

+

+

Q3

W

+

-

+

+

+

+

+

+

+

+

+

+

+

Q4

+

+

-

+

+

W

+

+

+

+

+

+

+

+

Q5

+

+

-

+

+

+

+

+

+

+

+

+

+

+

+; growth, -; lack of growth, w; poor growth.

 

  • Molecular identification of selected strains:

Previous research results indicate that the use of a set of recA gene sequences as primers for the identification of L. plantarum species results in the formation of a distinct band at 318 base pairs. This particular primer was designated as the PlanF primer. Nine isolates consistent with the characteristics of the L. plantarum species were selected and tested with PlanF using recA gene-specific primers. Judging by the formation of a specific band in the range of 318 bp in the electrophoresis of the PCR products, consistent with Torriani et al. (2001) (16), it appears that these nine isolates belong to L. plantarum (Figure 1). 

The NCBI sequence of L. plantarum partial mRNA for RecA protein (recA gene) was “ACTAGACCCCGTTTATGCGGAACACCTAGGGGTCAACATTGATGACCTGTTACTTTCGCAACCAGATACTGGTGAACAAGGGCTTGAAATTGCAGATGCCTTAGTTTCCAGTGGTGCGGTCGATATTTTAGTTGTTGACTCGGTGGCGGCCTTAGTGCCACGTGCCGAAATTGAAGGTGAAATGGGTGACGCACACGCTGGGTTACAAGCGCGGCTGATGTCACAAGCGCTCCGGAAGTTATCAGGGACATTGAACAAAACCAAGACAATCGCGTTATTTATCAATCAAATTCGTGAAAAAGTTGGTGTGATGTTTGGTAAT

Figure 1- 318 bp bond related to specific planF primer in L. plantarum PCR product electrophoresis was formed. M; 100 bp marker.

  • Evaluation of probiotic properties:

Almost all nine L. plantarum isolates grew well at 20 and 40ºC after 24 hours of incubation (Table 3). Their growth at 15ºC was detectable after 48 hours, but no growth was detected at 45ºC. Bacterial growth was observed at 4.5% and 6.5 % salt concentrations. At 4.5% concentration, the growth turbidity of all bacteria was very high and similar to the control samples. Most of the bacteria could grow well at 6.5% salt concentration. All isolates grew well in the presence of 0.3% Oxgal, but weak growth was observed in 0.5% Oxgal medium (Table 3). The results showed that the bacteria grew well at all pHs (Table 3).

Table 3- Lactobacillus growth at different temperatures,  salt and oxgall concentrations and pH.

Stains

15ºC

 

20ºC

40ºC

pH 2

 

pH 3.5

PH 9.6

Oxgall

0.3%

Oxgall 0.5%

Salt 4.5%

 

Salt 6.5%

A1

+

+

+

-

+

-

+

-

+

W

A4

+

+

+

-

+

-

+

-

+

-

A7

+

+

+

-

+

-

+

W

+

+

A8

+

+

+

-

+

-

+

W

+

+

P2

+

+

+

-

+

-

+

W

+

+

P3

+

+

W

-

+

-

+

W

+

W

P5

+

+

+

-

+

-

+

-

+

+

P6

+

+

+

-

+

-

+

W

+

+

Q3

+

+

+

-

+

-

+

W

+

W

Q4

+

+

+

-

+

-

+

W

+

+

Q5

+

+

+

-

+

-

+

-

+

+

+; growth, -; lack of growth, w; poor growth.

  • Antibiotic resistance:

Based on the results of the L. plantarum resistance test against antibiotics, the isolates were resistant to vancomycin, ciprofloxacin, ofloxacin, nalidixic acid, tobramycin, nitrofurantoin, gentamicin, kanamycin, semisensitive to penicillin, amoxicillin, cefalexin and were sensitive to tetracycline, co-amoxyclave, ceftriaxone, chloramphenicol, cifampicin, crythromycin.

  • Screening of extracellular enzymes:

The screening of extracellular enzymes in L. plantarum bacteria revealed their inability to degrade starch and gelatin. However, when cultured in a medium containing skim milk, these bacteria demonstrated the ability to produce protease enzymes as evidenced by the formation of a distinct clear zone around the colony. Furthermore, the growth results of L. plantarum isolates on a medium containing Tween 80 indicated the bacteria's ability to produce the lipase enzyme.

  • Anti-proliferative effects of cell-free supernatants of Lactobacillus plantarum A1

Figure 2 illustrates the anti-proliferative effects of bacterial cell-free supernatants at different concentrations on the conversion of   MTT tetrazolium salt in cells after   24, 48 and 72 hours of incubation in comparison to the control groups. For each concentration tested, an equal volume of MRS broth, as used in the test sample, was used as a control. Cells were exposed to increasing concentrations of bacterial cell-free supernatants, and cell survival was evaluated using the MTT assay after 24 hours of incubation. It is noteworthy that all tested concentrations of L. plantarum (A1) cell-free supernatants (2, 5, 10 mg/ml) showed significant (P<0.05) inhibitory effects on HT-29 cells   compared to the control groups. Therefore, we evaluated the effect of the samples on HT-29 cells using the MTT assay. The results of the MTT assay indicated that, in general, the cell-free supernatant at a concentration of 2 mg/ml showed the least cytotoxicity (35% compared to the control), while the concentration of 10 mg/ml showed the highest ability to inhibit cancer cells (56% compared to the control) (Figure 2). Figure 3 shows the change in cell morphology and density before and after treatment with probiotic L. plantarum.

Figure 2- Effects of 2, 5 and 10 mg/ml of cell free supernatant of Lactobacillus plantarum A1 on the viability of the colon cancerous cell line HT-29  .

Figure 3-Morphological and cellular changes of cancerous cell line HT-29 treated with 10 mg/ml cell-free supernatant of Lactobacillus plantarum A1 after 72h (magnifications ×20). A; control, B; treated cells.

Discussion

The identification of lactic acid-producing bacteria from diverse sources is of great importance in advancing research in various fields, including medicine, food industry, and agriculture (29). The extensive genome and robust enzymatic capabilities of L. plantarum, among the Lactobacillus species, contribute to its presence in diverse conditions and environments (30, 31). The biochemical tests conducted in this study demonstrated the presence of nine isolates with the characteristic L. plantarum in apple, pear, and quince vinegar, exhibiting the capacity to ferment the majority of the utilized sugars. In supplementary molecular investigations employing a recA-specific primer, the existence of a specific bond was discerned in nine isolates of this species. In the study by Torriani et al.  (2001) (16), the 322-bp recA fragment sequences were aligned, and four regions were selected for the design of species-specific primers. PCR tests employed a single reverse primer (pREV) and three forward primers (paraF, pentF and planF). The positioning of the forward specific primers on the fragment sequences (numbered 1 to 322) was as follows: planF, the specific primer for L. plantarum, spanned nucleotide positions 9 to 28; pentF, the specific primer for L. pentosus, covered nucleotide positions 109 to 127; and paraF, the specific primer for L. paraplantarum, encompassed nucleotide positions 220 to 239. Consequently, the expected amplicon sizes were 318 bp for L. plantarum, 218 bp for L. pentosus, and 107 bp for L. paraplantarum.  Subsequent investigations confirmed, the efficacy of the PlanF primer as a specific primer for L. plantarum. These results together with biochemical outcomes showed that nine strains of A1, A7, A8, P2, P5, P6, Q3, Q4, and Q5 are likely to be L. plantarum. So far, this bacterium has been extracted from a variety of sources, including dairy products, breast milk, swine intestine, and fermented olives (32, 33). De Vries et al. (2006) investigated the acid tolerance of these bacteria and observed that they were unable to thrive at a pH below 4. In our current study, the isolated bacteria exhibited growth patterns that closely resembled those of the control samples at pH 3. This is likely due to the influence of the acidity of the bacterium's initial environment, which was the surrounding vinegar.To provide further contextualization of  these findings, a comparison was made with the research conducted by Sajedinejad et al. (2015) on Lactobacillus bacteria extracted from the mouth, which confirmed their compatibility (34). In the investigation conducted by De Vries et al. (2006) (30) on the growth of Lactobacillus in different salt concentrations, the bacteria exhibited poor growth, particularly at a 5% concentration. Furthermore, their survival rate notably declined in higher salt concentrations. In contrast with the aforementioned findings, the present study demonstrated that the bacteria exhibited robust growth at a 4.5% concentration, with some isolates even displaying significant growth comparable to the control sample at a 6.5% salt concentration. Additionally, the isolates demonstrated notable resistance to a bile-containing medium, indicating that Lactobacilli isolated from apple, pear, and quince vinegar may possess the capability to endure the gastrointestinal environment. It is important to acknowledge, however, that making direct comparisons and establishing precise correspondences between acid and bile acid resistance results across various studies and natural bodily conditions can be challenging (24). Lactobacillus demonstrates the capacity to to proliferate across a temperature range of 15°C to 45°C, suggesting its potential to survive in apple, pear and quince vinegar (across seasonal variations) and in diverse body temperature conditions (even during fever). Kurniati et al. (2015) (35) posited that the proteolytic capability of   probiotic bacteria within the gastrointestinal tract, resulting in the production of essential peptides and amino acids for growth, represents a beneficial and advantageous trait within this bacterial group. This capacity represents a noteworthy attribute of L. plantarum. Several studies, including the work by Kurniati et al. (2015), have demonstrated the presence of protease enzymes in L. plantarum. The present study has confirmed that L. plantarum bacteria do, in fact, produce protease enzymes. Many studies have been carried out to prove the presence of lipase enzymes in L. plantarum bacteria, including Esteban Torres et al. (2015). Microbial lipases are one of the most important enzymes due to their high stability in organic solvents, the ability to catalyze hydrolytic reactions, ease of production, and relatively low costs and are one of the important sources of industrial production (19, 35). Here, the presence of the lipase enzyme was indicated in a medium containing Tween 80. In accordance with the experimental design, Tween 80 agar was utilized as a specific substrate for lipase testing, in accordance with established literature protocols (36, 37, 19). The utilization of Tween 80 in lipase assays is a well-documented methodology in microbiology, where the hydrolysis of Tween 80 by lipases results in the formation of a clear zone around the bacterial growth. This zone is indicative of lipase activity. In the present study, the methodology was based on previously established procedures, and our results clearly demonstrated the presence of a distinct zone of clearing around the bacterial growth on the Tween 80 agar. This observation aligns with the expected outcome of lipase hydrolysis. Furthermore, we included a positive control in our experiment, and the positive control exhibited the expected clear zone, validating the reliability of our experimental setup. It is important to note that while growth on Tween 80 agar may not be a definitive indicator of lipase production in all bacterial species, the specific conditions and methodology   employed were selected to target lipase activity in a manner that aligns with the experimental objectives.

 The results demonstrated, the L. plantarum isolates exhibited sensitivity to the majority of   cell wall synthesis inhibitors, particularly co-amoxyclave and ceftriaxone. However, they displayed resistance to vancomycin. The sensitivity of these bacteria to erythromycin, and eenicillin and their resistance to ciprofloxacin are consistent with Vizoso's report on the same strains of L. plantarum (38). With regard to the inhibition of nucleic acid synthesis by antibiotics, the isolates exhibited resistance to a specific antibiotic group, including nalidixic acid and ofloxacin. It is noteworthy that   these findings are in accordance with those previously reported by Cebeci et al. (2003), with the exception that L. plantarum demonstrated sensitivity to rifampicin in the present study. The potential anticancer activity of lactobacilli may be attributed to factors such as polysaccharides and peptidoglycans. Nevertheless, the presence of enzymes, proteins, and toxins in the cytoplasmic extract of lactobacilli markedly reduces the survival of colorectal cancer cells. Notably, the anticancer effects of lactobacilli might be attributed to the peptides present in their cytoplasmic extract, specifically lactoferrin. Lactoferrin exhibits its anticancer activity by inducing apoptosis, as well as by inhibiting the cell cycle and migration in cancer cells. The anticancer attributes of lactoferrin can be ascribed to the electrostatic binding of its cationic N-terminal region to acidic molecules, including proteoglycans, glycosaminoglycans, and sialic acids. These acidic molecules are   expressed in abundance on the surface of cancer cells. Another anticancer mechanism of lactobacilli is to reinforce the immune system by producing cytokines, IFN-γ and TNF-α, which consequently result in the eradication of tumor cells (27, 25).

Conclusion:

The results of this study demonstrate that Lactobacillus plantarum strains are capable of growth in native fruit vinegar produced in Iran. These bacteria demonstrate resistance to commonly used antibiotics and possess the capacity to grow and survive in acidic, bile, and saline environments at varying temperature levels.

 Conflict of Interest Statement

We wish to confirm that there are no conflicts of interest.

  • Zendeboodi F, Khorshidian N, Mortazavian AM, da Cruz AG. Probiotic: conceptualization from a new approach. Current Opinion in Food Science, 2020; 32: 103-123. https://doi.org/10.1016/j.cofs.2020.03.009
  • Nouri S, Roghanian R, Emtiazi G, Shafiei R. Biosynthesis of nano-calcite and nano-hydroxyapatite by the probiotic bacteria of Bacillus subtilis and Bacillus coagulans. Applied Food Biotechnology, 2022; 9(4): 275-286. https://doi.org/10.22037/afb.v9i4.38768
  • Nobakht F, Mohabatkar H, Behbahani M. An experimental study of the effects of lactobacillus acidophilus and lactobacillus Plantarum probiotic bacteria on the immune system, growth factors, and disease resistance in the rainbow trout. Journal of Microbial Biology, 2021; 10(40): 115-126.https://doi.org/10.22108/bjm.2021.128192.1381
  • Nouri S, Roghanian R, Emtiazi G, Gunduz O, Shafiei R. Osteoblastic Differentiation of Stem Cells from Human Exfoliated Deciduous Teeth by Probiotic Hydroxyapatite. Cell Journal (Yakhteh), 2023; 25(11): 753. https://doi.org/10.22074%2FCELLJ.2023.1999743.1276
  • Liu X, Mao B, Gu J, Wu J, Cui S, Wang G, Zhao J, Zhang H, Chen W. Blautia—a new functional genus with potential probiotic properties?. Gut microbes, 2021; 13(1): 1875796. https://doi.org/10.1080/19490976.2021.1875796
  • Poluektova E, Yunes R, Danilenko V. The putative antidepressant mechanisms of probiotic bacteria: relevant genes and proteins. Nutrients, 2021; 13(5): 1591. https://doi.org/10.3390/nu13051591
  • Zulkhairi Amin FA, Sabri S, Ismail M, Chan KW, Ismail N, Mohd Esa N, Mohd Lila MA, Zawawi N. Probiotic properties of Bacillus strains isolated from stingless bee (Heterotrigona itama) honey collected across Malaysia. International journal of environmental research and public health, 2020; 17(1): 278. https://doi.org/10.3390/ijerph17010278
  • Nouri S, Nazeri S, Hosseyni P. Isolation and Biochemical and Molecular Identification of Lactobacillus Plantarum‎ Bacteria from Rhizosphere of Lenjan Rice. Journal of Microbial Biology, 2018; 7(27): 61-71. https://doi.org/10.22108/bjm.2018.109730.1112 [In Persian].
  • Yeganeh L, Mmahmoodi SM. Optimization of Indole Acetic Acid Bio-production from Whey Substrate Using Bacteria Isolated from Rhizosphere and Phyllosphere of Plants. Biological Journal of Microorganism, 2023; 12(45): 19-30. https://doi.org/10.22108/bjm.2022.131740.1433 [In Persian].
  • Rigobelo, E.C. (2012). Probiotis. UNESP Univ Estadual Paulista. Brazil. 600pp.
  • Rivera-Espinoza Y, Gallardo-Navarro Y. Non-dairy probiotic products. Food microbiology, 2010; 27(1): 1-11. https://doi.org/10.1016/j.fm.2008.06.008
  • Xia T, Zhang B, Duan W, Zhang J, Wang M. Nutrients and bioactive components from vinegar: A fermented and functional food. Journal of Functional Foods, 2020; 64: 103681. https://doi.org/10.1016/j.jff.2019.103681
  • Ousaaid D, Mechchate H, Laaroussi H, Hano C, Bakour M, El Ghouizi A, Conte R, Lyoussi B, El Arabi I. Fruits vinegar: Quality characteristics, phytochemistry, and functionality. Molecules, 2021; 27(1): 222. https://doi.org/10.3390/molecules27010222
  • Adikari AM, Priyashantha H, Disanayaka JN, Jayatileka DV, Kodithuwakku SP, Jayatilake JA, Vidanarachchi JK. Isolation, identification and characterization of Lactobacillus species diversity from Meekiri: traditional fermented buffalo milk gels in Sri Lanka. Heliyon, 2021; 7(10). https://doi.org/10.1016/j.heliyon.2021.e08136
  • Yi C, Li Y, Zhu H, Liu Y, Quan K. Effect of Lactobacillus plantarum fermentation on the volatile flavors of mung beans. Lwt, 2021; 146: 111434. https://doi.org/10.1016/j.lwt.2021.111434
  • Torriani S, Felis GE, Dellaglio F. Differentiation of Lactobacillus plantarum, pentosus, and L. paraplantarum by recA gene sequence analysis and multiplex PCR assay with recA gene-derived primers. Applied and environmental microbiology, 2001; 67(8): 3450-3454. https://doi.org/10.1128/AEM.67.8.3450-3454.2001
  • Xu H, Liu W, Zhang W, Yu J, Song Y, Menhe B, Zhang H, Sun Z. Use of multilocus sequence typing to infer genetic diversity and population structure of Lactobacillus plantarum isolates from different sources. BMC microbiology, 2015; 15: 1-10. https://doi.org/10.1186/s12866-015-0584-4
  • Mekonnen SA, Merenstein D, Fraser CM, Marco ML. Molecular mechanisms of probiotic prevention of antibiotic-associated diarrhea. Current opinion in biotechnology, 2020; 61: 226-234. https://doi.org/10.1016/j.copbio.2020.01.005
  • Esteban-Torres M, Mancheño JM, de las Rivas B, Muñoz R. Characterization of a halotolerant lipase from the lactic acid bacteria Lactobacillus plantarum useful in food fermentations. LWT-Food Science and Technology, 2015; 60(1): 246-52. https://doi.org/10.1016/j.lwt.2014.05.063
  • Hattingh M, Alexander A, Meijering I, Van Reenan CA, Dicks LM. Amylolytic strains of Lactobacillus plantarum isolated from barley. African Journal of Biotechnology, 2015; 14(4): 310-318. https://doi.org/10.5897/AJB2014.14149
  • Rathakrishnan P, Nagarajan P. Optimization of the production of protease by Bacillus cereus with response surface methodology using groundnut shell. International Journal of Pharmaceutical, Chemical and Biological Sciences, 2013; 2: 200-209.
  • Solval KM, Chouljenko A, Chotiko A, Sathivel S. Growth kinetics and lactic acid production of Lactobacillus plantarum NRRL B-4496, acidophilus NRRL B-4495, and L. reuteri B-14171 in media containing egg white hydrolysates. Lwt, 2019; 105: 393-399. https://doi.org/10.1016/j.lwt.2019.01.058
  • Hussin FS, Chay SY, Hussin AS, Wan Ibadullah WZ, Muhialdin BJ, Abd Ghani MS, Saari N. GABA enhancement by simple carbohydrates in yoghurt fermented using novel, self-cloned Lactobacillus plantarum Taj-Apis362 and metabolomics profiling. Scientific reports, 2021; 11(1): 9417. https://doi.org/10.1038/s41598-021-88436-9
  • Zheng J, Du M, Jiang W, Zhang J, Shen W, Ma X, Liang Z, Shen J, Wu X, Ding X. In vitro probiotic characteristics and whole genome sequence analysis of lactobacillus strains isolated from cattle-yak milk. Biology, 2021; 11(1): 44. https://doi.org/10.3390/biology11010044
  • Cebeci A, Gürakan C. Properties of potential probiotic Lactobacillus plantarum strains. Food microbiology, 2003 Oct 1;20(5):511-518. https://doi.org/10.1016/S0740-0020(02)00174-0
  • Chagnaud P, Machinis K, Coutte LA, Marecat A, Mercenier A. Rapid PCR-based procedure to identify lactic acid bacteria: application to six common Lactobacillus Journal of Microbiological Methods, 2001; 44(2): 139-148. https://doi.org/10.1016/S0167-7012(00)00244-X
  • Padasht N, Issazadeh K, Shah Illi M. Cytotoxic Effects of Lactobacillus Cytoplasmic Extract isolated from Guilan province dairy products on Colon Cancer Cell Line (HT-29). Biological Journal of Microorganism, 2023; 12(46): 13-25. https://doi.org/10.22108/bjm.2022.133373.1466 [In Persian].
  • Samanarad Z, AkhavaneSepahy A, Bikhof Torbati M. Investigating the synergism of lactobacillus plantarum cell lysate supernatant and carboplatin on the induction of cell death and expression of Bax and Bcl-2 genes in the SK-OV-3 cell line. Journal of Microbial Biology, 2023; 12(48): 51-64. https://doi.org/10.22108/bjm.2023.132367.1515
  • Yogeswara AI, Kusumawati IG, Sumadewi NL, Rahayu ES, Indrati R. Isolation and identification of lactic acid bacteria from Indonesian fermented foods as γ-aminobutyric acid-producing bacteria. International Food Research Journal, 2018; 25(4): 1753-1757. https://B2n.ir/b26931
  • De Vries MC, Vaughan EE, Kleerebezem M, de Vos WM. Lactobacillus plantarum—survival, functional and potential probiotic properties in the human intestinal tract. International Dairy Journal, 2006; 16(9): 1018-1028. https://doi.org/10.1016/j.idairyj.2005.09.003
  • Łubiech K, Twarużek M. Lactobacillus bacteria in breast milk. Nutrients, 2020; 12(12): 3783. https://doi.org/10.3390/nu12123783
  • Balasingham K, Valli C, Radhakrishnan L, Balasuramanyam D. Probiotic characterization of lactic acid bacteria isolated from swine intestine. Veterinary world, 2017; 10(7): 825. https://doi.org/10.14202%2Fvetworld.2017.825-829
  • Esmaeili T, Emami Z, Ahadi AM, Shahanipour K, Shafighi M. lactobacillus plantarum isolated from olives using PCR-RFPF method. Microbial biotechnology, 2012; 4(12); 21-28.
  • Sajedinejad N, Paknejad M, Houshmand B, Sharafi H, Jelodar R, Shahbani Zahiri H, Noghabi KA. Lactobacillus salivarius NK02: a potent probiotic for clinical application in mouthwash. Probiotics and antimicrobial proteins, 2018; 10: 485-495. https://doi.org/10.1007/s12602-017-9296-4
  • Kurniati N, Mubarik NR. Optimization of production of protease by Lactobacillus plantarum SK (5) from bekasam with response surface methodology. Pakistan Journal of Biotechnology, 2015; 12(2): 123-130.
  • Luz BD, Sarrouh B, Bicas JL, Lofrano RC. Lipase production by microorganisms isolated from the Serra de Ouro Branco State Park. Anais da Academia Brasileira de Ciências, 2021; 93: e20190672. https://doi.org/10.1590/0001-3765202120190672
  • Techo S, Kuncharoen N, Tanasupawat S. Diversity and lipolytic activity of lactic acid bacteria isolated from fermented foods and plant materials in Thailand. The Thai Journal of Pharmaceutical Sciences, 2022; 46(4): 454-461. https://doi.org/10.56808/3027-7922.2628
  • Pinto MG, Franz CM, Schillinger U, Holzapfel WH. Lactobacillus spp. with in vitro probiotic properties from human faeces and traditional fermented products. International journal of food microbiology, 2006; 109(3): 205-214. https://doi.org/10.1016/j.ijfoodmicro.2006.01.029