Isolation and Molecular Identification of Native Plant Growth-promoting Bacillus Strains from the Soil around Tehran Province

Document Type : Original Article- Persian

Authors

1 1Department of Microbiology, Faculty of Sciences, Islamic Azad University, Arak Branch, Arak, Iran

2 Department of Microbiology, Islamic Azad University, Arak Branch, Arak, Iran

3 Department of Microbiology, Faculty of Sciences, Islamic Azad University, Arak Branch, Arak, Iran

4 Department of Microbiology, Faculty of Medcine, Tehran University of Medical Science, Tehran, Iran.

10.22108/bjm.2023.138040.1545

Abstract

Introduction: The escalating consumption of chemical fertilizers has imposed severe environmental and economic burdens on the society. Studies have shown the detrimental effects of these chemical agents on human health, necessitating a shift towards alternative fertilization practices. Research has focused on harnessing the potential of naturally occurring soil microorganisms as a sustainable and environmentally friendly solution to enhance plant growth. Biofertilizers, soil amendments enriched with beneficial microorganisms such as fungi, protozoa, actinomycetes, or algae, collectively known as plant growth-promoting bacteria (PGPB), represent a promising alternative to chemical fertilizers. Studies have shown that Bacillus-based biofertilizers can enhance nutrient uptake and regulate phytohormone metabolism within plants. Moreover, Bacillus strains exhibit remarkable resilience under environmental stress and secrete enzymes that disrupt the cell walls of pathogenic bacteria, viruses, fungi, and nematodes, thereby protecting plants from disease and promoting healthy growth and yield. In light of the aforementioned benefits, this study aims to isolate and molecularly identify native Bacillus strains with plant growth-promoting properties. The potential of these strains for incorporation into biofertilizers derived from Iranian native strains will be investigated.
Materials and Methods: In this study, rhizospheric and rhizoplane Bacillus strains from Iranian agricultural soils with Nitrogen-fixing ability were isolated and characterized for their plant growth-promoting properties. Strains with higher growth capacity were screened by 5% overnight culture in 100 ml NFB medium completed with 0.5% yeast extract. The strains were streaked onto Pikovskaya agar containing insoluble tricalcium phosphate. Quantitative analysis of phosphate solubilization was performed by culturing the strains in the mentioned liquid medium.  For the screening of (IAA) producer strains, the overnight culture of bacteria inoculated to a 250 ml Erlenmeyer-containing nutrient broth fortified with L-tryptophan. Then 2 ml of the supernatant was mixed with 2 ml Salkowski reagent. The optical absorbance was measured at 535 nm and the produced IAA was measured by standard curve graph. Production of ammonia was assayed by inoculation e of strains into peptone water. Nessler’s reagent was added to the medium. The development of yellow color showed the production of ammonia by the strain. The ability of HCN production was assayed by overnight culture of strain inoculated in nutrient agar slant fortified with glycine. The color change of the paper filter soaked in 0.5% picric acid and 2% sodium carbonate from yellow to brown indicated the production of HCN. Evaluation of antifungal activity against aspergillus niger, verticillium dahlia, and fusarium graminearum was performed on potato agar (MPA) plates, and calculated according to the following formula I= [(C-T)/C]*100. Quantitative measurement of ACC-deaminase activity of bacillus isolates was carried out using a modified NFB-ACC medium. siderophore production from cultural variables analyzed by CAS agar plate in reference to the change of color of CAS medium when microorganisms were grown in CAS agar plates. Phylogenetic relationships among the strains were established using 16S rDNA gene sequencing.  GraphPad Prism 6 software was used for statistical analysis. Data analysis was performed using one-way ANOVA and t-test and statistically significant was considered as p<0.05.
Results: In the intricate realm of soil microbiology, the rhizosphere and rhizoplane stand out as vibrant microbial hotspots, teeming with life and playing pivotal roles in plant health and nutrition. The rhizosphere, the narrow zone of soil surrounding plant roots, is a dynamic environment enriched in root exudates, serving as a nutrient-rich haven for a diverse array of microorganisms. Within this intricate ecosystem, nitrogen-fixing bacteria emerge as crucial players, converting atmospheric nitrogen into a form usable by plants, thereby supporting their growth and productivity. Nitrogen-fixing growth-promoting bacteria isolated from the rhizosphere play a crucial role in regulating soil nitrogen availability for plants. Among the nitrogen-fixing bacteria that inhabit the rhizosphere, Bacillus strains have garnered attention for their exceptional ability to fix nitrogen and promote plant growth. These beneficial microbes possess a suite of plant growth-promoting traits, making them valuable assets for sustainable agricultural practices.
Discussion and Conclusion: This study focused on isolating nitrogen-fixing bacteria. Over 80% of the isolated nitrogen-fixing bacilli were obtained from the rhizoplane, likely due to the high concentration of root exudates and microbial accumulation in this region. Despite previous studies indicating higher bacterial diversity in the rhizosphere, our findings suggest a distinct microbial niche within the rhizoplane supporting nitrogen-fixing bacteria. To select Bacillus strains with the highest plant growth-promoting potential, we screened them based on their growth ability, resulting in the selection of five promising strains. Phosphorus, a critical nutrient for plant growth, is often limiting. Bacillus strain S3 demonstrated the highest phosphate dissolution capacity (278.3 µg/mL). Bacilli secrete organic acids and produce siderophores that chelate iron bound to mineralized phosphates, making them accessible to plants. Moreover, studies have shown that bacilli can convert insoluble inorganic and organic phosphorus compounds into soluble forms via ACC deaminase enzyme production. Most strains exhibited ACC deaminase activity, enabling them to utilize 1-aminocyclopropane-1 as a nitrogen source. Siderophores, known for their biocontrol potential against plant pathogens, were produced by all strains except S3. Indole-3-acetic acid, a key plant hormone that promotes plant growth and germination, was produced in significant amounts by Bacillus strain S3. IAA production varies among species depending on nutrient availability. Bacillus indirectly enhances root growth by producing ammonia, a nitrogen source. Bacillus strains S3 and S5 exhibited the highest ammonia production, corroborating previous studies. Additionally, all strains demonstrated over 70% growth inhibition against fungal strains. Collectively, the obtained results underscore the promising potential of the native Bacillus strains isolated in this study for biofertilizer development. Their diverse plant growth-promoting traits, including nitrogen fixation, phosphate solubilization, ACC deaminase activity, siderophore production, IAA synthesis, ammonia production, and antifungal activity, make them valuable candidates for sustainable agricultural practices.

Keywords

Main Subjects


مقدمه

امروزه با افزایش مصرف کودهای شیمیایی مشکلات جدی زیست‌محیطی و اقتصادی بر جوامع انسانی تحمیل شده‌اند. مطالعات نشان داده‌اند سموم شیمیایی آثار جبران‌ناپذیر بر بافت‌های بدن انسان و حیوانات تغذیه‌کننده از آنها دارند و تحقیقات باید به تغییر الگوی استفاده از این سموم متمرکز شود (1). در این راستا، تلاش‌های گسترده‌ای به‌منظور یافتن راهکارهای مناسب برای بهبود کیفیت خاک، محصولات کشاورزی و حذف آلاینده‌های شیمیایی از محصول نهایی صورت گرفته‌اند (2). محصولات کشاورزی و به‌خصوص صیفی‌جات به‌دلیل داشتن ویتامین‌ها و ترکیبات آنتی‌اکسیدان بخش مهمی از رژیم غذایی انسان را تشکیل می‌دهند. امروزه مشخص شده است سلامتی انسان با نوع رژیم غذایی رابطه دارد؛ بنابراین، مصرف‌کنندگان بر آن شده‌اند تا به دنبال کاهش بقایای سموم، توکسین‌ها و میکروارگانیسم‌های مضر در غذا باشند (3). در این بین، مطالعات بر استفاده از باکتری‌ها به‌عنوان میکروارگانیسم‌های خاکزی طبیعی و یکی از راهکارهای تولید بهینه محصول و حفظ سلامت محیط زیست متمرکز شده‌اند. کودهای زیستی به مواد حاصلخیزکننده‌ خاک اطلاق می‌شوند که حاوی تعداد کافی از یک یا چند گونه از میکروارگانیسم‌های مفید خاکزی مانند قارچ‌ها، پروتوزوا، اکتینومیست‌ها یا جلبک‌ها هستند که به اختصار [1]PGPB نامیده می‌شوند و عمدتاً سبب تحریک رشد گیاه می‌شوند (4). این میکروارگانیسم‌ها با قرارگیری در سطح ریشه یا خاک اطراف ریشه می‌توانند بهبود رشد گیاه را سبب شوند. از این محصولات به‌طور گسترده برای افزایش کارایی کشاورزی بهره برده می‌شود. میکروارگانیسم‌های خاکزی و کودهای زیستی با بهبود حاصلخیزی خاک و عرضه مناسب عناصر غذایی موردنیاز گیاه در یک سیستم مدیریت مصرف کود کشاورزی پایدار نقش اساسی دارند. در این میان، استفاده از میکروارگانیسم‌ها به‌خصوص باسیلوس‌های محرک رشد گیاه به‌طور روزافزون شایان توجه قرار گرفته است (5).

بررسی‌ها نشان داده‌اند کاربرد کودهای مبتنی بر باسیلوس، جذب عناصر موردنیاز در گیاه را افزایش می‌دهد و سبب تنظیم متابولیسم فیتوهورمون‌های درون‌سلولی گیاه می‌شود. همچنین، توانمندی بالای باسیلوس ازطریق تغییر در خصوصیات فیزیولوژیک گیاهان در مواجه با استرس‌های محیطی و ترشح آنزیم‌های تخریب‌کننده دیواره سلولی سبب حفاظت از گیاه در برابر تجمع پاتوژن‌هایی نظیر باکتری، ویروس، قارچ و نماتدها در خاک می‌شود و ازاین‌رو به حفظ سلامت گیاه و افزایش محصول کمک می‌کند (6)؛ به‌طور مثال، مطالعات روی باکتری‌های باسیلوس مگاتریوم جداسازی‌شده از ریزوسفر، نشان دادند این باکتری ازطریق تولید سیدروفور و کاهش آهن برای پاتوژن گیاهی با نام فوزاریوم به‌عنوان یک کنترل‌کننده زیستی عمل می‌کند و ضمن کنترل بیماری مذکور به افزایش عملکرد اندام هوایی، تعداد گل و کاهش زمان لازم برای گل‌دهی منجر شده است (7).

باسیلوس‌های موجود در کودهای زیستی، علاوه بر تأثیر مثبت بر رشد گیاهان، به‌دلیل خصوصیات ضدپاتوژن، نقش مؤثری در کنترل بیماری‌های گیاهان دارند. باکتری باسیلوس سوبتیلیس، با تولید ترکیبات ضدمیکروبی و افزایش مقاومت گیاهان در برابر بیماری‌های قارچی و باکتریایی، به کاهش استفاده از سموم شیمیایی در کشاورزی کمک می‌کنند. به همین دلیل، استفاده از کودهای زیستی حاوی باسیلوس‌ها به‌عنوان یک روش پایدار و سالم در کشاورزی درخور توجه قرار گرفته است (8).

همچنین، همواره شناسایی سویه‌های بومی با قابلیت‌های مفید از مهم‌ترین روش‌های جلوگیری از وابستگی به کشورهای خارجی به شمار می‌رود. مطالعات بسیاری در این زمینه در کشور، انجام و نتایج آنها در سطح صنعتی استفاده شده‌اند (9)؛ اما کمبود محسوسی در زمینه تولید کودهای زیستی مشاهده می‌شود؛ ازاین‌رو، در این مطالعه سعی شده است با جداسازی و شناسایی مولکولی سویه‌های باسیلوس واجد ویژگی‌های محرک رشد گیاهان، استفاده از آنها به‌منظور کاربرد در کودهای زیستی بر پایه سویه‌های بومی ایران بررسی شود.

 

مواد و روش‌ها

نمونه‌برداری: به‌منظور جداسازی باکتری‌های PGPB، از ریشه و خاک گیاهان مزارع گوجه‌فرنگی مناطق مختلف اطراف تهران نمونه‌برداری انجام شد. سپس برای حفظ رطوبت ریشه نمونه‌ها در کیسه‌های پلی‌اتیلن استریل قرار داده و سریعاً در دمای 4 درجه به آزمایشگاه منتقل شدند.

جداسازی باسیلوس‌های تثبیت‌کننده ازت: برای جداسازی باکتری‌های منطقه ریزوسفری، مقدار یک لیتر محلول نمکی کلرید سدیم 9/0 درصد درون ارلن تهیه و در اتوکلاو استریل شد (10). سپس ریشه‌ها به مدت 10 دقیقه درون ارلن تکان داده شدند. به‌منظور جداسازی جنس باسیلوس، محیط در دمای 80 درجه سانتی‌گراد به مدت 16 دقیقه تیمار حرارتی شد. در ادامه برای جداسازی باکتری‌های منطقه ریزوپلن محلول نمکی فوق حاوی v/v 1% تویین 80، تهیه و همانند قبل ریشه در محلول نمکی به خوبی تکان داده و تیمار حرارتی شد. برای جداسازی باکتری‌ها، از نمونه‌ها سریال رقت در بافر فسفات با pH خنثی، تهیه و به‌صورت پورپلیت در محیط کشت NFb medium3 آگار (Himedia، هند)، کشت و در دمای 25 درجه سانتی‌گراد به مدت 48 ساعت گرماگذاری شدند. سپس کلنی‌های مشکوک به باسیلوس‌ها جداسازی و خواص فیزیکوشیمیایی ازجمله توانایی تولید کپسول، آزمون کاتالاز، اکسیداز، توانایی احیای نیترات، MR-VP و اوره‌آز آنها تعیین شدند.

واکنش زنجیره‌ای پلیمراز: در این مرحله سویه‌های باسیلوس برای غربالگری دارابودن پتانسیل تثبیت‌کنندگی ازت، از نظر حضور ژن nifH بررسی شدند (11). جداسازی اولیه باکتری‌ها در محیط کشت NFB فاقد منبع ازت در دمای 33 درجه سانتی‌گراد صورت گرفت و به‌‌منظور اطمینان از توانایی تثبیت ازت، وجود ژن nifH در سویه‌های جداشده بررسی شد. برای این منظور، ابتدا ژنوم سویه‌ها توسط کیت استخراج DNA اختصاصی باکتری (GenElute, Sigma) استخراج شد. کیفیت و کمیت DNA استخراج‌شده با روش اسپکتروفتومتری (Nanodrop, Thermo Scientific) و الکتروفورز در ژل آگاروز 2 درصد تأیید شدند و تکثیر توالی nifH با استفاده از پرایمرهای اختصاصی انجام شد (12). با استفاده از نرم‌افزار Gene Runner پرایمرهای با توالی F5′-GCAATTTACGGCAAGGGTGGTATCGGCAA-3′ و R5′- ATGGCGAAGCCGCCACACACCACGTC -3′ برای بخش محافظت‌شده ژن هدف، طراحی و صحت آنها با استفاده از ابزار بلاست در پایگاه NCBI بررسی شدند. برای هر واکنش PCR، میزان 10 میکرولیتر PCR Master Mix 2x (Amplicon, USA)، 1 میکرولیتر از هرکدام از پرایمرها با غلظت 10 پیکومول بر میکرولیتر، 4 میکرولیتر از DNA الگو (150 نانوگرم) و 4 میکرولیتر آب مقطر نیاز بود. مراحل دمایی واکنش PCR شامل مرحله دناتوراسیون اولیه در دمای 95 درجه سانتی‌گراد به مدت 5 دقیقه، 35 چرخه شامل دناتوراسیون 95 درجه سانتی‌گراد به مدت 30 ثانیه، مرحله اتصال پرایمر در دمای 56 درجه سانتی‌گراد به مدت 30 ثانیه و مرحله تکثیر در دمای 72 درجه سانتی‌گراد به مدت 1 دقیقه و پس از 35 چرخه مرحله تکثیر نهایی در دمای 72 درجه سانتی‌گراد به مدت 10 دقیقه انجام شدند. محصولات PCR با اندازه 510 جفت‌باز در حضور کنترل منفی در ژل آگاروز 5/1 درصد الکتروفورز شدند و پس از رنگ‌آمیزی با اریتروژل توسط دستگاه ژل داک (MahamAzma, Iran) از آنها عکس‌برداری شد.

بررسی رشد سویه‌ها: برای انتخاب سویه‌های تثبیت‌کننده ازت با بالاترین توانایی رشدی، ابتدا 100 میلی‌لیتر محیط کشت مایع NFB غنی‌‌شده با 5/0 درصد عصاره مخمر درون ارلن تهیه و اتوکلاو شد. سپس از کشت تازه شبانه سویه‌های دارای ژن هدف به میزان 5 درصد در محیط فوق تلقیح شد. محیط‌های کشت روی شیکر انکوباتور با دور g 150، به مدت 48 ساعت در دمای 30 درجه سانتی‌گراد گرماگذاری شدند. بعد از اتمام دوره گرماگذاری، جذب نوری نمونه‌ها با استفاده از دستگاه اسپکتوفوتومتر در 600 نانومتر اندازه‌گیری شد.

.غربالگری باسیلوس‌های دارای توانایی انحلال فسفات: توانایی انحلال فسفات در جدایه‌ها با استفاده از محیط کشت (PVK) Pikovskaya (مرک، آلمان) بررسی شد (13). برای این منظور، ابتدا 100 میلی‌لیتر از محیط کشت‌های نوترینت‌براث، تهیه و در اتوکلاو استریل شدند. سپس 1 میلی‌لیتر از سویه‌های باکتریایی درون محیط کشت‌های مذکور تلقیح شد و به مدت 24 ساعت گرماگذاری شدند. 10 میکرولیتر از کشت مذکور به‌صورت لکه‌گذاری در محیط PVK آگار، کشت و به مدت 72 ساعت در دمای 30 درجه سانتی‌گراد گرماگذاری شد. هاله شفاف اطراف کلنی‌های باکتری به‌عنوان توانایی انحلال فسفات در نظر گرفته شد. آنالیز کمی توانایی انحلال فسفات نیز ازطریق کشت سویه‌ها در ارلن حاوی 100 میلی‌لیتر محیط PVK براث استریل صورت گرفت. سپس ارلن‌ها درون شیکر انکوباتور با دور g 120 به مدت 72 ساعت قرار گرفتند. در ادامه، کشت‌های باکتریایی به مدت 20 دقیقه با دور g 150 سانتریفیوژ شدند و میزان انحلال فسفات ازطریق اندازه‌گیری جذب نوری در طول موج 882 نانومتر و مقایسه با منحنی استاندارد محلول 4PO2KH مشخص شد (21).

.غربالگری باسیلوس‌های دارای توانایی تولید ایندول‌استیک‌اسید: برای این منظور، همانند قبل، کشت تازه شبانه از باکتری‌ها در محیط نوترینت‌براث (مرک، آلمان) تهیه شد (14). سپس 1 میلی‌لیتر از کشت تازه به ارلن‌های حاوی 100 میلی‌لیتر محیط نوترینت‌براث استریل غنی‌‌شده با ال- تریپتوفان به میزان 1/0 میلی‌گرم بر لیتر تلقیح شد و در دمای 30 درجه و دور  g150 به مدت 48 ساعت گرماگذاری شدند. پس از تکمیل رشد، کشت‌های باکتریایی به مدت 30 دقیقه با دور g300 سانتریفیوژ شدند و 2 میلی‌لیتر از سوپرناتانت نمونه‌ها همراه با 2 میلی‌لیتر معرف Salkowski، ترکیب و به مدت 30 دقیقه در دمای اتاق در تاریکی نگهداری شدند و جذب نوری نمونه‌ها در طول موج 535 نانومتر، تعیین و مقدار تولید ایندول استیک اسید محاسبه شد (14).

بررسی اثر ضدقارچی: سویه‌های جداسازی‌شده از نظر بروز اثرات ضدقارچی علیه سویه‌های آسپرژیلوس نایجر، ورتیکولوم داهلیائه و فوزاریوم گرانیناریوم بررسی شدند. این گونه‌های قارچی بیماری‌زا به‌علت شیوع زیاد در مناطق مختلف جهان، انتخاب شدند. 1 میلی‌لیتر از محیط کشت حاوی هر سویه در پلیت حاوی محیط کشت سیب‌زمینی آگار (MPA) به‌صورت سطحی کشت داده و نمونه‌ای با قطر 3 میلی‌متر از هیف‌های قارچی در مرکز پلیت قرار داده شد (15). پلیت به مدت 10 روز در دمای 25 درجه سانتی‌گراد انکوبه شد. از کشت قارچ در محیط فاقد باکتری، به‌عنوان نمونه کنترل بهره برده شد. میزان ممانعت از رشد هیف‌ها با استفاده از فرمول I= [(C-T)/C]*100 محاسبه شد. I برابر با درصد عدم رشد هیف، C قطر هیف کنترل و T قطر هیف در پلیت MPA بود.

فعالیت ACC دآمینازی[2]: بررسی فعالیت ACC دآمینازی با استفاده از روش گلیک[3] و همکاران انجام شد (16, 17). بدین منظور، 1 میکرولیتر از محیط کشت حاوی هر سویه در پلیت آگار حاوی NFB-ACC اضافه شد که دارای 1-آمینوسیکلوپروپان-1-کربوکسیلاز (5 گرم بر لیتر) به‌عنوان تنها منبع نیتروژن بود و در 28 درجه سانتی‌گراد به مدت 4 روز انکوبه شد. در صورت ایجاد کلنی، کشت مجدد در همان محیط صورت گرفت و سویه‌های رشدکرده با توانایی فعالیت ACC دآمینازی در نظر گرفته شدند.

تولید سیدروفور: تولید سیدروفور با روش نیلندز[4] و همکاران بررسی شد (18). برای این منظور، 1 میکرولیتر از کشت تازه یک شبه باکتری، به پلیت حاوی محیط کشت کروم آزورول اس (CAS)، تلقیح و در 30 درجه سانتی‌گراد به مدت 4 روز گرماگذاری شد. پلیت‌ها هر روز برای مشاهده ایجاد رنگ نارنجی در اطراف کلنی‌ها بررسی شدند. از سودوموناس فلورسنس سویه P1 به‌منظور کنترل مثبت استفاده شد.

.جداسازی باسیلوس‌های دارای توانایی تولید آمونیاک: برای بررسی توانایی تولید آمونیاک، 100 میکرولیتر از کشت 24 ساعته در 10 میلی‌لیتر محیط کشت پپتون‌براث، تلقیح و به مدت 72-48 ساعت در دمای 37 درجه سانتی‌گراد در شیکر انکوباتور گرماگذاری شد. در ادامه، 1 میلی‌لیتر معرف نسلر (مرک، آلمان) به محیط افزوده شد. تغییر رنگ محیط از قهوه‌ای به زرد به‌عنوان تولید آمونیاک در نظر گرفته می‌شد (14).

.غربالگری باسیلوس‌های دارای توانایی تولید سیانید هیدروژن: در این آزمون توانایی تولید سیانید هیدروژن توسط سویه‌های باکتریایی، با استفاده از روش لرک[5] و همکاران انجام شد (19). بدین منظور، 100 میکرولیتر از کشت یک ‌شبه سویه‌ها، در اسلنت محیط نوترینت‌آگار تکمیل‌شده 4/4 گرم بر لیتر گلایسین کشت داده شد. درب لوله‌ها به ‌خوبی با کاغذ صافی آغشته به معرف (5/0 درصد پیکریک اسید و سدیم کربنات 2 درصد) پوشانده و با نوار پارافیلم مسدود شد تا از خروج گاز سیانید هیدروژن جلوگیری شود. لوله‌ها به مدت 4 روز در دمای 2±28 درجه سانتی‌گراد درون انکوباتور گرماگذاری شدند. تغییر رنگ کاغذ صافی آغشته به معرف از رنگ زرد به قهوه‌ای نشان‌دهنده تولید گاز سیانید هیدروژن بود.

.شناسایی مولکولی سویه‌های باسیلوس منتخب: شناسایی سویه‌های باسیلوس منتخب، با تکثیر قسمتی از ناحیه ژنی کدکننده 16S rDNA با استفاده از واکنش‌های زنجیره‌ای پلی‌مراز صورت گرفت. بدین منظور، ژنوم سویه‌های منتخب استفاده شدند که در مراحل قبل استخراج شده بودند. تکثیر توالی 16S rDNA با استفاده از پرایمرهای PIB16) (5- AGAGTTTGATCCTGGCTCAG-3 و MIB16 (5-GGCTGCTGGCACGTAGTTAG-3) انجام گرفت (12). برای هر واکنش PCR میزان 10 میکرولیتر PCR Master Mix 2x (Amplicon, USA)، 1 میکرولیتر از هرکدام از پرایمرها با غلظت 10 پیکومول بر میکرولیتر، 5 میکرولیتر از DNA الگو (200 نانوگرم) و 5 میکرولیتر آب مقطر نیاز بود. مراحل دمایی واکنش PCR شامل مرحله دناتوراسیون اولیه در دمای 95 درجه سانتی‌گراد به مدت 4 دقیقه، 36 چرخه شامل دناتوراسیون 94 درجه سانتی‌گراد به مدت 45 ثانیه، مرحله اتصال پرایمر در دمای 55 درجه سانتی‌گراد به مدت 30 ثانیه و مرحله تکثیر در دمای 74 درجه سانتی‌گراد به مدت 1 دقیقه و پس از 36 چرخه مرحله تکثیر نهایی در دمای 71 درجه سانتی‌گراد به مدت 8 دقیقه انجام شد. محصولات PCR در حضور کنترل منفی در ژل آگاروز 2 درصد الکتروفورز شدند و پس از رنگ‌آمیزی توسط دستگاه ژل‌داک (MahamAzma, Iran) از آنها عکسبرداری شد. محصول PCR در ناحیه bp 1500 از روی ژل، جداسازی و به میکروتیوپ استریل منتقل شد. سپس برای توالی‌یابی به شرکت Microsynth سوئیس ارسال شد. با مقایسه توالی به‌دست‌آمده از سویه‌ها با توالی قرار داده شده در پایگاه داده (http://www.ncbi.nlm.nih.gov/BLAST) میزان مشابهت آنها تعیین شد. درخت فیلوژنی با استفاده از نرم‌افزار MEGA6 به روش Neighbor-joining و با مدل کیمورا 2 انجام شد. در این مطالعه از سویه‌های باسیلوس سوبتیلیس ATCC 14579، باسیلوس مگاتریوم سویه K31.3 و باسیلوس فلکسا سویه DRG4 به‌عنوان باکتری‌های تیپیک برای رسم درخت فیلوژنی استفاده شد.

روش آماری: در این مطالعه به‌منظور تحلیل آماری داده‌ها، از نرم‌افزار 9 GraphPad Prism استفاده شد. تجزیه و تحلیل داده‌ها نیز با استفاده از روش آنالیز واریانس ANOVA یک‌طرفه و T test در سطح احتمال 05/0 p≤ بررسی شد.

 

نتایج.

جداسازی باسیلوس‌ها: برای جداسازی باسیلوس‌های با توانایی تثبیت ازت، 6 نمونه خاک و ریشه از مزارع مختلف گوجه‌فرنگی در اطراف تهران، تهیه و باکتری‌ها در محیط فاقد ازت جداسازی شدند. از 6 نمونه خاک / ریشه منتقل‌شده به آزمایشگاه، 28 باکتری از ناحیه ریزوسفر و 22 باکتری از ناحیه ریزوپلن جداسازی شدند و خصوصیات ریخت‌شناسی آنها با رنگ‌آمیزی گرم بررسی شد. داده‌ها نشان دادند از سویه‌های جداسازی‌شده، 15 سویه متعلق به جنس باسیلوس از ناحیه ریزوسفر و 8 سویه از ناحیه ریزوپلن بوده‌اند. این سویه‌های گرم مثبت دارای نتایج بیوشیمیایی کاتالاز مثبت، احیاکننده نیترات، سیترات مثبت، MR منفی و VP مثبت و اوره‌آز منفی بودند. سویه‌های جداشده به‌صورت استوک گلیسرول در فریزر نگهداری شدند.

غربالگری سویه‌های تثبیت‌کننده ازت: به‌منظور اطمینان از توانایی تثبیت ازت، باکتری‌ها از لحاظ وجود ژن nifH غربالگری شدند. نتایج نشان دادند 8 باکتری از سویه‌های جداسازی‌شده دارای ژن nifH هستند و محصول PCR پس از الکتروفورز در منطقه 510 جفت‌باز قرار داشته است. در شکل 1 نتایج حاصل از الکتروفورز ژنوم باکتری‌ها نمایش داده ‌شده‌اند. این سویه‌ها از S1 تا S8 کدگذاری شدند.

 

 

 

شکل 1- نتایج الکتروفورز محصولات PCR ژن nifH در سویه‌های باسیلوس جداسازی‌شده از خاک. C- کنترل منفی، +:کنترل مثبت ستون 1 تا 8 نتیجه PCR ژن مطالعه‌شده، M: مارکر وزن مولکولی bp 100

 

.بررسی پتانسیل رشد باسیلوس‌های جداشده: به‌منظور انتخاب سویه‌هایی با توانایی بالاتر رشدی، باکتری‌های باسیلوس جداسازی‌شده در محیط کشت NFB غنی‌شده با 1 درصد عصاره مخمر کشت داده شدند. پس از تکمیل رشد، میزان جذب نوری (با استفاده از دستگاه اسپکتروفتومتر) و تعداد باکتری‌های زنده شمارش شد. در جدول 1 نتایج به‌دست‌آمده برای 5 سویه با بیشترین توانایی رشدی آورده شده‌اند. همان‌طور که مشاهده می‌شود باکتری‌هایی با بیشترین توانایی رشد عمدتاً از ناحیه ریزوپلن جداسازی شدند. سویه S6 دارای بیشتری میزان رشد و سویه‌های S2، S4 و S7 دارای کمترین توانایی رشد بین باسیلوس‌های جداسازی‌شده بوده‌اند.

بررسی اثر ضدقارچی: سویه‌های جداسازی‌شده از نظر بروز اثرات ضدقارچی علیه سویه‌های قارچی بررسی شدند. داده‌ها نشان دادند سویه‌های باسیلوس منتخب این تحقیق در بیشتر موارد دارای اثر مهار‌کنندگی رشد علیه سویه‌های قارچی به میزان بیش از 70 درصد بودند. سویه S6 در این مطالعه کمترین میزان اثر ضدقارچی و سویه S1 بیشترین میزان ممانعت از رشد گونه‌های قارچی را نشان داد.

فعالیت ACC دآمینازی[6]: بررسی فعالیت ACC دآمینازی نشان داد همه سویه‌ها به‌جز سویه S5 توانایی رشد در محیط حاوی 1-آمینوسیکلوپروپان-1 ازطریق فعالیت ACC دآمینازی بودند (جدول 1).

تولید سیدروفور: تولید سیدروفور در همه سویه‌های جداسازی‌شده بررسی شد و شکل 2 نشان داد به‌جز سویه S3، بقیه سویه‌ها دارای توانایی تولید سیدروفور بودند (جدول 1).

 

 

 

شکل 2- نمودار نشان‌دهنده میزان ممانعت از رشد در محیط کشت (MPA) در دمای 25 درجه سانتی‌گراد به مدت 10 روز توسط سویه‌های باسیلوس منتخب این مطالعه با استفاده از نرم‌افزار گراف پد prism. *: اختلاف معنی‌دار 05/0p<

 

شکل 3- تصویر نتیجه مثبت تولید سیدروفور در محیط کشت CAS توسط سویه S5

 

جدول 1- بررسی ویژگی‌های مختلف سویه‌ها و رشد سویه‌ها پس از 48 ساعت انکوباسیون در دمای 30 درجه سانتی‌گراد محیط کشت NFB

تولید سیدروفور

فعالیت  ACC دآمینازی

فعالیت ضدقارچی

تعداد باکتری پس از 48 انکوباسیون در محیط کشت NFB (CFUs/mL)

OD600nm

کد ایزوله

+

+

-

3e 3.4

16/3

S1

+

+

-

3e 1/1

01/1

S2

-

+

+

6e 2/2

52/4

S3

+

+

-

2e 1/1

91/0

S4

+

-

+

3e 4/5

02/5

S5

+

+

-

2e 9.2

79/4

S6

+

+

-

4e 1/1

12/1

S7

+

+

+

1e 1/7

92/3

S8

 

 

بررسی توانایی انحلال فسفات: نتایج ارزیابی انحلال فسفات به‌‌صورت کیفی نشان دادند تمام 5 سویه باکتریایی منتخب، قادر به انحلال فسفات هستند. بیشترین و کمترین قطر هاله به‌ترتیب برابر 34 میلی‌لیتر و 7 میلی‌لیتر بود که به‌ترتیب توسط سویه‌های S3 و S5 ایجاد شده بود. شکل 4 نمایش‌‌دهنده نتایج ارزیابی انحلال فسفات توسط باکتری در محیط PVK است. نتایج نشان دادند میزان انحلال فسفات توسط باسیلوس‌ها تفاوت معنی‌دار دارد. همان‌طور که در نمودار مشاهده می‌شود بیشترین میزان توانایی انحلال فسفات در سویه‌های (3/293 میکروگرم بر میلی‌لیتر) S3 و (6/267 میکروگرم بر میلی‌لیتر) S6 مشاهده شده است؛ درحالی‌که سویه (6/191 میکروگرم بر میلی‌لیتر) S5 دارای کمترین مقدار توانایی انحلال فسفات است که از لحاظ آماری اختلاف معنی‌داری با سویه‌های دیگر دارد (01/0p<).

توانایی تولید ایندول استیک اسید: تعیین میزان ایندول استیک اسید تولیدی توسط سویه‌ها به روش رنگ‌سنجی و با معرف Salkowski انجام شد. برای این منظور سویه‌های منتخب کشت داده شدند و پس از تکمیل فرایند تخمیر، سوپرناتانت محیط کشت، جداسازی و سپس تغییرات غلظت ایندول استیک اسید ارزیابی شد. براساس یافته‌ها تمام باسیلوس‌های منتخب، توانایی تولید ایندول استیک اسید را داشتند. نتایج نشان دادند بیشترین میزان ایندول استیک اسید توسط سویه S3 و برابر با 9.687 میکروگرم بر میلی‌لیتر بوده است. علاوه بر این، کمترین میزان تولید ایندول استیک اسید در سویه S1 و برابر با 3.814 میکروگرم بر میلی‌لیتر بوده است (شکل 5).

 

 

 

شکل 4- تصویر مقایسه مقادیر قطر هاله ایجادشده توسط باکتری باسیلوس منتخب جداشده از خاک پس از 48 ساعت انکوباسیون در محیط کشت PVK. *: اختلاف معنی‌دار 05/0p<

 

 

شکل 5- تصویر مقایسه مقادیر ایندول استیک اسید تولیدشده توسط باکتری باسیلوس منتخب جداشده از خاک پس از 48 ساعت انکوباسیون در محیط کشت نوترینت‌براث ترکیب‌شده با ال-تریپتوفان

 

.بررسی تولید آمونیوم و سیانید هیدروژن توسط باسیلوس‌ها: بررسی تولید آمونیاک توسط سویه‌ها به‌واسطه افزودن معرف نسلر به کشت‌های باکتریایی 72-48 ساعته در محیط پپتون‌براث و مشاهده تغییر رنگ محیط از قهوه‌ای به زرد انجام شد. براساس نتایج به‌دست‌آمده تمامی 5 سویه جداسازی‌شده توانایی تولید آمونیاک را داشتند؛ اما سویه S3 بیشترین میزان تولید این ماده را داشت. همچنین تولید گاز سیانید هیدروژن ازطریق مشاهده تغییر رنگ زرد به قهوه‌ای کاغذ صافی آغشته به معرف (5/0 درصد پیکریک اسید و سدیم کربنات 2 درصد) در اسلنت محیط نوترینت‌آگار غنی‌شده با 4/4 گرم بر لیتر گلایسین انجام شد و نتایج این آزمون نشان دادند پس از 4 روز گرماگذاری کاغذ صافی آغشته به معرف زرد رنگ مشاهده شد که نشان‌دهنده عدم تولید گاز هیدروژن توسط 4 سویه و تولید این گاز توسط سویه S2 بود.

بررسی روابط فیلوژنتیکی: بررسی روابط فیلوژنی سویه‌های منتخب در شکل 6 نشان داد سویه‌های S6 و S3 با سویه باسیلوس سوبتیلیس در یک خوشه قرار گرفتند، سویه S1 با سویه S8 دارای روابط فیلوژنتیکی بسیار نزدیک با یکدیگر بودند و سویه S5 با سویه‌های باسیلوس مگاتریوم k31.1 و سویه باسیلوس فلکسا DRG4 قرابت ژنتیکی بیشتری نشان داد.

 

 

 

شکل 6- تصویر درخت فیلوژنتیک رسم‌شده با نرم‌افزار MEGA6 به روش Neighbor-joining و با مدل کیمورا 2 به‌منظور بررسی روابط ژنتیکی 5 سویه منتخب با یکدیگر و با سویه‌های تیپیک بر پایه توالی بخشی از ژن 16S rDNA. شماره‌های مجاور گره‌ها میزان احتمال تکرار بوت استرپ را به درصد نشان می‌دهد.

 

بحث و نتیجه‌گیری.

امروزه دانشمندان دربارة استفاده از باکتری‌های محرک رشد گیاه به‌‌منظور بهبود رشد محصولات کشاورزی تحقیقات مختلفی انجام داده‌اند (20). کود زیستی تهیه‌شده با این باکتری‌ها مزیت بسیاری نسبت به سایر کودها دارد. این سویه‌ها با قرارگیری در سطح ریشه یا خاک اطراف ریشه باعث رشد گیاه می‌شوند که برای افزایش کارایی کشاورزی مفید هستند. در یک سیستم مدیریت مصرف کود کشاورزی پایدار، باکتری‌های موجود در کودهای زیستی با بهبود حاصلخیزی خاک و عرضه مناسب عناصر غذایی موردنیاز گیاه نقش اساسی دارند (5).

بررسی‌ها نشان داده‌اند کاربرد کودهای مبتنی بر باسیلوس، جذب عناصر موردنیاز در گیاه را افزایش می‌دهد و سبب تنظیم متابولیسم فیتوهورمون‌های درون‌سلولی گیاه می‌شود.

هدف این تحقیق جداسازی و شناسایی باسیلوس‌های بومی دارای ویژگی‌های تحریک‌کننده رشد گیاهان بود؛ بنابراین، از دو منطقه ریزوسفر و ریزوپلن از مزارع کشاورزی اطراف تهران، نمونه ریشه گیاه به همراه خاک آن به آزمایشگاه منتقل شد و باکتری‌های تثبیت‌کننده ازت از این مناطق جدا شدند. نیتروژن یک عنصر ضروری برای رشد و تولید گیاه است. تثبیت بیولوژیکی نیتروژن تنها وسیله طبیعی برای تبدیل این عنصر ضروری به شکل قابل استفاده برای گیاهان است. برخی از گیاهان مانند گیاهان حبوبات (نخود، لوبیا و شبدر) کلنی‌هایی از باکتری‌های تثبیت‌کننده نیتروژن در گره‌های متصل به ریشه خود دارند. این باکتری‌ها قادر به تبدیل نیتروژن اتمسفر به شکل قابل استفاده توسط گیاه هستند؛ در عوض، این گیاه قندهای تولیدشده ازطریق فتوسنتز را در اختیار باکتری‌ها قرار می‌دهد. همچنین، میکروارگانیسم‌های ریزوسفر نقش مهمی در تنظیم نیتروژن خاک در دسترس گیاهان دارند. مکانیسم تعامل بین گیاهان و میکروارگانیسم‌های ریزوسفر یک حوزه کلیدی تحقیقات در استفاده از میکروارگانیسم‌های کشاورزی است (20)؛ ازاین‌رو، این تحقیق بر جداسازی باکتری‌هایی با توانایی تثبیت ازت متمرکز شده است. مطالعات قبلی نشان داده‌اند باسیلوس‌ها قادر به تولید انواعی از ازت‌های مفید برای گیاهان هستند که باعث افزایش رشد و عملکرد گیاهان می‌شوند. این باکتری‌ها می‌توانند ازت جوی را به فرم‌های مختلفی مانند آمونیوم، نیترات و نیتریت تبدیل کنند که همگی برای گیاهان کشاورزی مفید هستند (21). باکتری‌های باسیلوس همچنین می‌توانند بهبود خاک و افزایش تثبیت ازت در خاک را بهبود بخشند تا گیاهان بهتر از ازت در خاک استفاده کنند و عملکرد آنها افزایش یابد. همچنین، اثبات شده است باکتری‌های باسیلوس باعث کاهش نیاز به کود شیمیایی و در نتیجه کاهش آلودگی محیط زیست می‌شوند (22).

در این تحقیق بیش از 80 درصد باسیلوس‌های جداشده با توانایی تثبیت ازت از ناحیه ریزوپلن جدا شدند. مطالعات قبل نشان داده‌اند همواره تعداد و تنوع باکتری‌ها در منطقه ریزوسفری بیشتر از خاک ریزوپلن بوده است (22). در مطالعات قبلی همچون تحقیق بارا و همکاران در سال 2021 و کونگ و همکاران در سال 2019 افزایش تنوع باکتریایی در منطقه ریزوسفری به غلظت بالاتر متابولیت‌های مغذی و مواد آلی در این منطقه نسبت داده شده است (23, 24). در ادامه، به‌منظور دستیابی به باسیلوس‌های دارای بالاترین پتانسیل بهبود رشد گیاهان، غربال‌سازی سویه‌ها براساس توانایی رشدی صورت گرفت تا توانایی آنها برای تولید کود زیستی بررسی شود؛ بنابراین، تمامی سویه‌ها در محیط کشت مشابه کشت داده و برترین سویه‌ها (5 سویه) انتخاب شدند. فسفر از عناصر غذایی پر مصرف مهم در تغذیه گیاهان به شمار می‌رود و کمبود آن، رشد گیاه را به شدت محدود می‌کند (10). حلالیت فسفر در خاک کم بوده است؛ بنابراین، قسمت اعظم فسفر طبیعی یا فسفر موجود در کودهای شیمیایی در خاک به فرم فسفات‌های نامحلول در خاک تثبیت می‌شود. با توجه به اینکه خاک‌های کشاورزی حاوی مقادیر زیادی از ذخایر فسفر نامحلول هستند، آزادسازی فسفر از فرم‌های نامحلول و تثبیت‌شده موجود در خاک به‌منظور افزایش قابلیت فراهمی فسفر برای گیاهان زراعی از اهمیت خاصی برخوردار است (9). توانایی افزایش حلالیت فسفات‌های معدنی نامحلول یکی از صفاتی است که معمولاً در غربالگری و انتخاب باکتری‌های محرک رشد گیاه در نظر گرفته می‌شود (10، 25).

در این تحقیق باکتری‌های باسیلوس با قابلیت رشد در محیط کشت NFB، توانایی انحلال فسفر را نشان دادند. باکتری‌ها می‌توانند فسفر را ازطریق مکانیسم‌های مختلفی تجزیه کنند. انحلال فسفر توسط باکتری‌ها یک فرایند مهم در چرخه فسفر است. این فرایند به گیاهان کمک می‌کند به فسفر دسترسی پیدا کنند که یک ماده معدنی ضروری برای رشد و نمو آنها است. رایج‌ترین مکانیسم‌ها عبارت‌اند از 1) تولید اسیدهای آلی، مانند اسید سیتریک، اسید مالیک و اسید لاکتیک؛ این اسیدها می‌توانند یون‌های کلسیم و منیزیم را از فسفات‌های معدنی جدا کنند که باعث می‌شود فسفات در دسترس گیاهان باشد؛ 2) تولید آنزیم فسفاتاز: این آنزیم می‌تواند پیوندهای فسفات را در فسفات‌های معدنی بشکند که باعث می‌شود فسفات در دسترس گیاهان باشد؛ 3) تولید سیدروفور: این مولکول‌ها می‌توانند آهن را به خود جذب کنند. آهن یک ماده معدنی ضروری برای رشد باکتری‌ها است؛ بنابراین، باکتری‌ها آهن را از فسفات‌های معدنی جذب می‌کنند که باعث می‌شود فسفات در دسترس گیاهان باشد. میزان توانایی انحلال فسفات در سویه‌های منتخب در بازه 290-190 میکروگرم بر میلی‌لیتر مشاهده شد. مشابه با تحقیق حاضر، در مطالعات قبلی ماکزیمم میزان انحلال فسفر توسط سویه منتخب برابر با 290 میکروگرم بر میلی‌لیتر گزارش شده است (26). تحقیقات در این زمینه نشان دادند حلالیت میکروبی فسفات‌های نامحلول در محیط کشت حاوی این میکروارگانیسم‌ها به‌دلیل ترشح اسیدهای آلی از قبیل اگزالیک، سیتریک، لاکتیک و گلوکنیک اسید است که با روش‌های مختلف کروماتوگرافی از قبیل TLC و HPLC در محیط کشت مایع میکروارگانیسم‌های حل‌کننده فسفات، تعیین و توسط محققان گزارش شده است (27). علاوه بر این، گزارش شده است باسیلوس‌ها با تولید اسیدهای معدنی، تولید پروتون، ترشح سیدروفور، کلاته‌کردن و تولید آنزیم‌های ACC دآمیناز و فسفاتاز، قادرند ترکیبات نامحلول معدنی و آلی فسفر را به ترکیبات محلول تبدیل کنند (28)؛ ازاین‌رو، توانایی انحلال فسفات در سویه‌های منتخب این تحقیق می‌تواند به تولید این عوامل نسبت داده شود؛ زیرا بیشتر سویه‌ها توانایی تولید سیدروفور و فعالیت دآمینازی را داشتند. سیدروفورها به‌عنوان یک مکانیزم کنترل بیولوژیکی علیه میکروب‌های بیماری‌زای گیاهی به‌طور گسترده‌ای مطالعه شده‌اند؛ همچنین ممکن است تغذیه گیاهان از آهن را فراهم کنند. مشخص شده است سیدروفورها می‌توانند رشد گیاه را به‌طور غیرمستقیم با مهار میکروارگانیسم‌های بیماری‌زای گیاهی تحریک کنند که برای منابع آهن فریک نامحلول محدودکننده رشد رقابت می‌کنند (15). در ادامه این مطالعه، توانایی تولید ایندول استیک اسید توسط باسیلوس‌ها بررسی شد. مطالعات نشان داده‌اند ایندول استیک اسید از مهم‌ترین هورمون‌های گیاهی است که بعضی از باسیلوس‌های جداسازی‌شده توانایی تولید آن و سایر فیتوهورمون‌ها را دارند. توانایی تولید فیتوهورمون‌ها توسط ویدواتی و همکاران در سال 2020 (29) و فیگوئردو و همکاران در سال 2023 گزارش ‌شده است (30). یگانه و همکاران در تحقیقی در سال 2023 در بهینه‌سازی تولید زیستی ایندول استیک اسید از سوبسترای آب پنیر با استفاده از باکتری‌های جداسازی‌شده از ریزوسفر و فیلوسفر گیاهان، بیشترین میزان ایندول استیک اسید تولیدشده توسط سویه‌ باسیلوس سوبتیلیس جداشده در تحقیق خود را برابر 15/4 میکروگرم بر میلی‌لیتر گزارش کردند (31). گروننوال و همکاران در سال 2018 نیز تولید ایندول استیک اسید را توسط سویه‌های باسیلوس مگاتریوم گزارش کردند (32). همچنین، نتایج مطالعه حاضر نشان دادند سویه باسیلوس S3 قادر به تولید 687/9 میکروگرم بر میلی‌لیتر ایندول استیک اسید در شرایط آزمایشگاهی بود. در تحقیقات تفاوت بین سویه‌ها و گونه‌های مختلف در میزان تولید ایندول استیک اسید به شرایط محیطی و نیز تفاوت‌های ژنتیکی باکتری‌ها ارتباط داده شده است (33). توانایی تولید آمونیاک و سیانید هیدروژن از دیگر ویژگی‌های مهم باکتری‌های محرک رشد گیاه است که سبب افزایش رشد گیاهان به‌‌طور غیرمستقیم می‌شود (33). باکتری‌هایی تولیدکننده سیانید هیدروژن عمدتاً به‌عنوان کنترل‌گر زیستی استفاده می‌شوند؛ زیرا برای پاتوژن‌های گیاهی سمی هستند. در مطالعه‌ای در زمینه تولید هیدروژن سیانید توسط سویه‌ها در ریزوسفر، دانشمندان نشان دادند یو‌ن‌های آهن به سیانید هیدروژن متصل می‌شوند که باعث افزایش دسترسی سویه‌ها به فسفات می‌شود (34). در تحقیق دیگری آگبوجاتو و همکاران در سال 2015 نشان دادند توانایی تولید سیانید هیدروژن به جنس باکتری وابسته نیست و از باسیلوس‌ها می‌توان برای افزایش تولید گیاهی بهره برد (35). مطالعات قبلی نیز نشان دادند سویه‌های سیانوژنیک از سودوموناس فلورسنس می‌توانند در افزایش طول ساقه و ریشه گیاه و جوانه‌زنی آن نقش داشته باشند (36). علاوه بر سیانید هیدروژن، سویه‌های محرک رشد گیاه با توانایی تولید آمونیاک در بهبود رشد گیاه نقش دارند؛ زیرا آمونیاک می‌تواند در منطقه ریشه تجمع یابد و به‌‌عنوان منبع ازت توسط گیاه استفاده ‌شود و رشد ریشه و ساقه و تولید بیومس را افزایش دهد (37). آنتیل و همکاران در سال 2023 نشان دادند سویه‌هایی که توانایی تولید سیانید هیدروژن و آمونیاک را دارند، اثرات هم‌افزایی در بهبود رشد گیاه نشان می‌دهند (21). نتایج این تحقیق نیز نشان دادند تمامی سویه‌های منتخب توانایی تولید آمونیاک را دارند و سویه‌های باسیلوس S3 و S5 بالاترین میزان آمونیاک را تولید کردند که با نتایج سایر مطالعات در این زمینه مطابقت دارند (38). سویه‌های آزمایش‌شده در این تحقیق، به‌جز سویه باسیلوس S2، توانایی تولید سیانید هیدروژن را نداشتند. عالی و همکاران نیز عدم تولید سیانید هیدروژن توسط سویه‌های ریزوسفری ریزوبیوم، ازتوباکتر، سودوموناس و باسیلوس را در تحقیقی گزارش کردند (39). نتایج مشابه در سایر تحقیقات نشان‌دهنده عدم تولید سیانید هیدروژن در سویه باسیلوس مگاتریوم جداشده توسط بسیاری از دانشمندان بود (40، 41، 42).

داده‌های تحقیق حاضر نشان دادند سویه‌های باسیلوس منتخب این تحقیق در بیشتر موارد اثر مهار‌کنندگی رشد علیه سویه‌های قارچی به میزان بیش از 70 درصد داشتند. این نتایج در توافق با بسیاری از مطالعات دیگر در تأیید اثرات ضدقارچی سویه‌های باسیلوس است (15، 43). در همین زمینه در جداسازی سودوموناس پروتوژن مقاوم به فلزات سنگین از آب چاه کشاورزی در شمال شرقی الجزایر با فعالیت‌های محرک رشد، حشره‌کش و ضدقارچی نشان داده شد سویه‌های آنها ماکزیمم 54 درصد فعالیت ضدقارچی داشتند (44). پیشنهاد می‌شود با مبادرت به جداسازی سویه‌های دارای توانایی‌های مشابه با سویه‌های این تحقیق از سایر مزارع، محققان برای بررسی پتانسیل این سویه‌ها به‌منظور تولید سایر محصولات زیستی گام بردارند.

 

نتیجه‌گیری

در این مطالعه سویه‌های بومی دارای ویژگی‌های محرک رشد گیاه از مزارع اطراف شهر تهران جداسازی و تکثیر شدند. نتایج مطالعه حاضر نشان دادند سویه‌های جداسازی‌شده بومی توانایی انحلال فسفات، تولید ایندول استیک اسید، فعالیت ACC دآمینازی و تولید سیدروفور را داشتند و علاوه بر این، فعالیت‌های چشمگیر در ممانعت از رشد سویه‌های پاتوژن قارچی نشان دادند. با توجه به اهمیت تولید محصولات زیستی کارآمد، به نظر می‌رسد سویه‌های بومی جداسازی‌شده در این تحقیق بتوانند از نظر استفاده در تولید کودهای زیستی به‌طور تکمیلی مطالعه شوند.

 

[1]- plant growth promoting bacteria

[2]- 1-aminocyclopropane-1-carboxylate (ACC) deaminase

[3]- Glick

[4]- Nielands

[5]- Lorck

[6]- 1-aminocyclopropane-1-carboxylate (ACC) deaminase

  • Wang H., Liu R., You MP., Barbetti MJ., Chen Y. Pathogen biocontrol using plant growthromoting bacteria (PGPR): Role of bacterial diversity. Microorganisms 2021; 9 (9): 1988. https://doi.org/10.3390/microorganisms9091988
  • Sansinenea E. Bacillus spp: As plant growth-promoting bacteria. Secondary metabolites of plant growth promoting rhizomicroorganisms: Discovery and applications. 2019; 225-37. https://doi.org/10.1007/978-981-13-5862-3_11
  • Kerbab S., Silini A., Chenari Bouket A., Cherif-Silini H., Eshelli M., El Houda Rabhi N., et al. Mitigation of NaCl stress in wheat by rhizosphere engineering using salt habitat adapted PGPR halotolerant bacteria. Applied Sciences 2021; 11 (3): 1034. https://doi.org/10.3390/app11031034
  • Neshat M., Abbasi A., Hosseinzadeh A., Sarikhani MR., Dadashi Chavan D., Rasoulnia A. Plant growth promoting bacteria (PGPR) induce antioxidant tolerance against salinity stress through biochemical and physiological mechanisms. Physiology and Molecular Biology of Plants 2022; 28 (2): 347-61. https://doi.org/10.1007/s12298-022-01128-0
  • Vandana UK., Singha B., Gulzar A., Mazumder P. Molecular mechanisms in plant growth promoting bacteria (PGPR) to resist environmental stress in plants. In: Molecular aspects of plant beneficial microbes in agriculture. Elsevier; 2020: 221-33.
  • Ashry NM., Alaidaroos BA., Mohamed SA., Badr OA., El-Saadony MT., Esmael A. Utilization of drought-tolerant bacterial strains isolated from harsh soils as a plant growth-promoting rhizobacteria (PGPR). Saudi Journal of Biological Sciences 2022; 29 (3): 1760-9. https://doi.org/10.1016/j.sjbs.2021.10.054
  • Xia Y., Farooq MA., Javed MT., Kamran MA., Mukhtar T., Ali J., et al. Multi-stress tolerant PGPR Bacillus xiamenensis PM14 activating sugarcane (Saccharum officinarum L.) red rot disease resistance. Plant Physiology and Biochemistry 2020; 151: 640-9.
  • Kashyap BK., Solanki MK., Pandey AK., Prabha S., Kumar P., Kumari B. Bacillus as plant growth promoting rhizobacteria (PGPR): a promising green agriculture technology. Plant Health Under Biotic Stress: Volume 2: Microbial Interactions 2019: 219-36. https://doi.org/10.1007/978-981-13-6040-4_11
  • Lotfi N., Soleimani A., Çakmakçı R., Vahdati K., Mohammadi P. Characterization of plant growth-promoting rhizobacteria (PGPR) in Persian walnut associated with drought stress tolerance. Scientific Reports 2022; 12 (1): 12725. https://doi.org/10.1038/s41598-022-16852-6
  • Cochard B., Giroud B., Crovadore J., Chablais R., Arminjon L., Lefort F. Endophytic PGPR from tomato roots: isolation, in vitro characterization and in vivo evaluation of treated tomatoes (Solanum lycopersicum L.). Microorganisms 2022; 10 (4): 765. https://doi.org/10.3390/microorganisms10040765
  • Masood S., Zhao XQ., Shen RF. Bacillus pumilus promotes the growth and nitrogen uptake of tomato plants under nitrogen fertilization. Scientia Horticulturae 2020; 272: 109581. https://doi.org/10.1016/j.scienta.2020.109581
  • Izadi M., Fooladi MH., Sharifi Sirchi G., Amini J. Isolation of Lactobacillus acidophilus from Sharbabk city yoghurt and its molecular characterization. Agricultural Biotechnology Journal 2010; 2 (2): 1-12.
  • Koua Sh., N’golo DC., Alloue-Boraud WM., Konan F., Dje KM. Bacillus subtilis strains isolated from cocoa trees (Theobroma cacao L.) Rhizosphere for their use as potential plant growth promoting rhizobacteria in Côte d’Ivoire. Current Microbiology 2020; 77: 2258-64. https://doi.org/10.1007/s00284-020-02027-x
  • Li W., Lee S-Y., Cho Y-J., Ghim S-Y., Jung H-Y. Mediation of induced systemic resistance by the plant growth-promoting rhizobacteria Bacillus pumilus S2-3-2. Molecular Biology Reports 2020; 47: 8429-38. https://doi.org/10.1007/s11033-020-05883-9
  • Xie S., Liu J., Gu S., Chen X., Jiang H., Ding T. Antifungal activity of volatile compounds produced by endophytic Bacillus subtilis DZSY21 against Curvularia lunata. Annals of Microbiology 2020; 70 (1): 1-10. https://doi.org/10.1186/s13213-020-01553-0
  • Glick BR., Karaturovíc DM., Newell PC. A novel procedure for rapid isolation of plant growth promoting pseudomonads. Canadian Journal of Microbiology 1995; 41 (6): 6-533.
  • Naing AH., Maung TT., Kim CK. The ACC deaminase‐producing plant growth‐promoting bacteria: influences of bacterial strains and ACC deaminase activities in plant tolerance to abiotic stress. Physiologia Plantarum 2021; 173 (4): 1992-2012. https://doi.org/10.1111/ppl.13545
  • Schwyn B., Neilands J. Universal chemical assay for the detection and determination of siderophores. Analytical Biochemistry 1987; 160 (1): 47-56.
  • Essalimi B., Esserti S., Rifai LA., Koussa T., Makroum K., Belfaiza M., et al. Enhancement of plant growth, acclimatization, salt stress tolerance and verticillium wilt disease resistance using plant growth-promoting rhizobacteria (PGPR) associated with plum trees (Prunus domestica). Scientia Horticulturae 2022; 291: 110621. https://doi.org/10.1016/j.scienta.2021.110621
  • Liu J., Zhang J., Zhu M., Wan H., Chen Z., Yang , et al. Effects of plant growth promoting rhizobacteria (PGPR) strain Bacillus licheniformis with biochar amendment on potato growth and water use efficiency under reduced irrigation regime. Agronomy 2022; 12 (5): 1031. https://doi.org/10.3390/agronomy12051031
  • Chaiharn M., Lumyong, S. Screening and optimization of indole-3-acetic acid production and phosphate solubilization from rhizobacteria aimed at improving plant growth. Current Microbiology 2011; 62: 173-18. https://doi.org/10.1007/s00284-010-9674-6
  • Tsotetsi T., Nephali L., Malebe M., Tugizimana F. Bacillus for Plant Growth Promotion and Stress Resilience: What Have We Learned? Plants 2022; 11 (19): 2482. https://doi.org/10.3390/plants11192482
  • Barra Caracciolo A., Terenzi V. Rhizosphere microbial communities and heavy metals. Microorganisms 2021; 9 (7): 1462. https://doi.org/10.3390/microorganisms9071462
  • Kong HG., Song GC., Ryu CM. Inheritance of seed and rhizosphere microbial communities through plant–soil feedback and soil memory. Environmental Microbiology Reports 2019; 11 (4): 479-86. https://doi.org/10.1111/1758-2229.12760
  • Gashash EA., Osman NA., Alsahli AA., Hewait HM., Ashmawi AE., Alshallash KS., et al. Effects of plant-growth-promoting rhizobacteria (PGPR) and cyanobacteria on botanical characteristics of tomato (Solanum lycopersicon L.) plants. Plants 2022; 11 (20): 2732. https://doi.org/10.3390/plants11202732
  • Tahir M., Mirza MS., Zaheer A., Dimitrov MR., Smidt H., Hameed S. Isolation and identification of phosphate solubilizer'Azospirillum, Bacillus' and'Enterobacter'strains by 16SrRNA sequence analysis and their effect on growth of wheat ('Triticum aestivum'L.). Australian Journal of Crop Science 2013; 7 (9): 1284-92. https://doi.org/10.25130/tjas.23.2.12
  • Lim J-H., Kim S-D. Synergistic plant growth promotion by the indigenous auxins-producing PGPR Bacillus subtilis AH18 and Bacillus licheniforims K11. Journal of the Korean Society for Applied Biological Chemistry 2009; 52: 531-8.
  • Kang S-M., Khan M-A., Hamayun M., Kim L-R., Kwon E-H., Kang Y-S., et al. Phosphate-solubilizing Enterobacter ludwigii AFFR02 and Bacillus megaterium Mj1212 rescues alfalfa’s growth under post-drought stress. Agriculture 2021; 11 (6): 485. https://doi.org/10.3390/agriculture11060485
  • Widawati S. Isolation of Indole Acetic Acid (IAA) producing Bacillus siamensis from peat and optimization of the culture conditions for maximum IAA production. IOP Conference Series: Earth and Environmental Science; 2020: IOP Publishing.
  • Figueredo EF., da Cruz TA., de Almeida JR., Batista BD., Marcon J., de Andrade PAM., et al. The key role of indole-3-acetic acid biosynthesis by Bacillus thuringiensis RZ2MS9 in promoting maize growth revealed by the ipdC gene knockout mediated by the CRISPR-Cas9 system. Microbiological Research 2023; 266: 127218. https://doi.org/10.1016/j.micres.2022.127218
  • Yeganeh L., Mmahmoodi SMM. Optimization of Indole Acetic Acid Bio-production from Whey Substrate Using Bacteria Isolated from Rhizosphere and Phyllosphere of Plants. Biological Journal of Microorganism 2023; 12 (45): 19-30. https://doi.org/10.18178/ijpmbs.7.2.20-27
  • Grunennvaldt RL., Degenhardt-Goldbach J., Tomasi JDC., Dos Santos GD., Vicente VA., Deschamps C. Bacillus megaterium: an endophytic bacteria from callus of Ilex paraguariensis with growth promotion activities. Biotecnología Vegetal2018; 18 (1): 3-13.
  • Sritongon N., Boonlue S., Mongkolthanaruk W., Jogloy S., Riddech N. The combination of multiple plant growth promotion and hydrolytic enzyme producing rhizobacteria and their effect on Jerusalem artichoke growth improvement. Scientific Reports 2023; 13 (1): 5917. https://doi.org/10.1038/s41598-023-33099-x
  • Rijavec T., Lapanje A. Hydrogen cyanide in the rhizosphere: not suppressing plant pathogens, but rather regulating availability of phosphate. Frontiers in Microbiology 2016; 7: 1785.
  • Agbodjato NA., Noumavo PA., Baba-Moussa F., Salami HA., Sina H., Sèzan A., et al. Characterization of potential plant growth promoting rhizobacteria isolated from Maize (Zea mays L.) in central and Northern Benin (West Africa). Applied and Environmental Soil Science 2015; 2015.
  • Kalam S., Basu A., Podile AR. Functional and molecular characterization of plant growth promoting Bacillus isolates from tomato rhizosphere. Heliyon 2020; 6 (8): e04734. https://doi.org/10.1016/j.heliyon.2020.e04734
  • Dashti N., Al-Sarraf NYA., Cherian VM., Montasser MS. Isolation and characterization of novel plant growth-promoting rhizobacteria (PGPR) isolates from tomato (Solanum lycopersicum L.) rhizospherical soil: A novel IAA producing bacteria. Kuwait Journal of Science 2021; 48 (2).
  • Wu J., Kamal N., Hao H., Qian C., Liu Z., Shao Y., et al. Endophytic Bacillus megaterium BM18-2 mutated for cadmium accumulation and improving plant growth in Hybrid Pennisetum. Biotechnology Reports 2019; 24: e00374.
  • Ali A., Khalid R., Safdar A., Akram Z., Hayat R. Characterization of plant growth promoting rhizobacteria isolated from chickpea (Cicer arietinum). British Microbiology Research Journal 2015; 6 (1): 32.
  • Pathak E., Sanjyal A., Regmi CR., Paudel S., Shrestha A. Screening of potential plant growth promoting properties of Bacillus species isolated from different regions of Nepal. Nepal Journal of Biotechnology 2021; 9 (1): 79-84.
  • Kumar P., Pahal V., Gupta A., Vadhan R., Chandra H., Dubey RC. Effect of silver nanoparticles and Bacillus cereus LPR2 on the growth of Zea mays. Scientific Reports 2020; 10 (1): 1-10.
  • Thilagar G., Bagyaraj D., Podile AR., Vaikuntapu PR. Bacillus sonorensis, a novel plant growth promoting rhizobacterium in improving growth, nutrition and yield of chilly (Capsicum annuum L.). Proceedings of the National Academy of Sciences, India Section B: Biological Sciences 2018; 88: 813-8.
  • Hashem AH., Abdelaziz AM., Askar AA., Fouda HM., Khalil AM., Abd-Elsalam KA., et al. Bacillus megaterium-mediated synthesis of selenium nanoparticles and their antifungal activity against Rhizoctonia solani in faba bean plants. Journal of Fungi 2021; 7 (3): 195.
  • Bensidhoum L., Nabti E., Tabli N., Kupferschmied P., Weiss A., Rothballer M., et al. Heavy metal tolerant Pseudomonas protegens isolates from agricultural well water in northeastern Algeria with plant growth promoting, insecticidal and antifungal activities. European Journal of Soil Biology 2016; 75: 38-46.