تحلیل فیلوژنتیکی پروتئین HC-Pro جدایه‌های ایرانی ویروس موزاییک زرد لوبیا

نوع مقاله: پژوهشی- فارسی

نویسندگان

گروه گیاهپزشکی، دانشکده کشاورزی، دانشگاه ولی عصر رفسنجان، ایران

10.22108/bjm.2020.120883.1262

چکیده

مقدمه: ویروس موزاییک زرد لوبیا (Bean yellow mosaic virus)به جنس Potyvirus و خانوادۀ Potyviridaeتعلقدارد و دارای پراکندگی جهانی گسترده و دامنۀ میزبانی وسیع است. در پژوهش حاضر، روابط فیلوژنتیکی 8 جدایۀ این ویروس که در سال‌های زراعی 96 و 97 از مناطق جغرافیایی مختلف ایران (آذربایجان شرقی، اردبیل، قزوین، زنجان، همدان، خوزستان، فارس و کرمان) از روی باقلا جدا شده بودند، در مقایسه با سایر جدایه‌های موجود در بانک ژن بررسی شدند.
مواد و روش‏‏ها: برگ‌های گیاهان دارای نشانه‌های ویروسی از مزارع باقلای نواحی مختلف ایران نمونه‏برداری و به آزمایشگاه منتقل شدند. به‌منظور تشخیص نمونه‌های آلوده به ویروس موزاییک زرد لوبیا، ابتدا از آزمون داس الیزا و آنتی‌بادی اختصاصی ویروس استفاده شد؛ سپس RNA کل نمونه‌های آلوده استخراج و ناحیۀ HC-Proجدایه‌های انتخابی تکثیر و توالی‌یابی شد. ارزیابی توالی، بررسی روابط فیلوژنتیکی، بررسی ساختار پروتئینی و همچنین شناسایی وقوع نوترکیبی در ناحیۀ HC جدایه‌های BYMV انتخابی با نرم‌افزارهای مختلف انجام شد.
نتایج: در درخت فیلوژنتیکی رسم‌شده، جدایه‌های ایرانی در دو گروه مونوفیلتیک مجزا قرار گرفتند؛ به‌طوری‌که پنج جدایۀ آذربایجان‌ شرقی، قزوین، زنجان، فارس و کرمان در کنار دو جدایه از استرالیا و ژاپن که همگی از روی باقلا جدا شده بودند، در یک گروه جای گرفتند و جدایه‌ها‌‌ی اردبیل، همدان و خوزستان به همراه دو جدایۀ دیگر ایرانی موجود در بانک ژن، دو جدایه از هند و دو جدایه از ژاپن در گروه دیگر قرار گرفتند. بر اساس نتایج آزمون نوترکیبی، هیچ‌کدام از جدایه‌های ایرانی جمع‌آوری‌شده در پژوهش حاضر، جدایۀ نوترکیب تشخیص داده نشدند.
بحث و نتیجه‏گیری: درک تغییرات ژنتیکی و نوترکیبی جمعیت ویروسی پیش‌نیاز مهمی برای تشخیص کارآمد، مدیریت مؤثر و کنترل بیماری در درازمدت است. قطعاً نتایج در توسعۀ راهکار‌هایی کاربرد دارند که به مقاومت در برابر BYMV منتج می‌شوند و چنانچه این بیماری در آینده همه‌گیر شود، می‌توانند در راستای اتخاذ راهبردهای مدیریتی اثربخش باشند.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

A Phylogenetic Analysis of HC-Pro Protein in Iranian Isolates of Bean Yellow Mosaic Virus

نویسندگان [English]

  • Ali Baradar
  • Ahmad Hosseini
  • Samin Hosseini
  • somayeh Abdani babaki
Department of Plant Protection, Faculty of Agriculture, Vali-e-University of Rafsanjan, Iran
چکیده [English]

مقدمه: ویروس موزاییک زرد لوبیا (Bean yellow mosaic virus)به جنس Potyvirus و خانوادۀ Potyviridaeتعلقدارد و دارای پراکندگی جهانی گسترده و دامنۀ میزبانی وسیع است. در پژوهش حاضر، روابط فیلوژنتیکی 8 جدایۀ این ویروس که در سال‌های زراعی 96 و 97 از مناطق جغرافیایی مختلف ایران (آذربایجان شرقی، اردبیل، قزوین، زنجان، همدان، خوزستان، فارس و کرمان) از روی باقلا جدا شده بودند، در مقایسه با سایر جدایه‌های موجود در بانک ژن بررسی شدند.
مواد و روش‏‏ها: برگ‌های گیاهان دارای نشانه‌های ویروسی از مزارع باقلای نواحی مختلف ایران نمونه‏برداری و به آزمایشگاه منتقل شدند. به‌منظور تشخیص نمونه‌های آلوده به ویروس موزاییک زرد لوبیا، ابتدا از آزمون داس الیزا و آنتی‌بادی اختصاصی ویروس استفاده شد؛ سپس RNA کل نمونه‌های آلوده استخراج و ناحیۀ HC-Proجدایه‌های انتخابی تکثیر و توالی‌یابی شد. ارزیابی توالی، بررسی روابط فیلوژنتیکی، بررسی ساختار پروتئینی و همچنین شناسایی وقوع نوترکیبی در ناحیۀ HC جدایه‌های BYMV انتخابی با نرم‌افزارهای مختلف انجام شد.
نتایج: در درخت فیلوژنتیکی رسم‌شده، جدایه‌های ایرانی در دو گروه مونوفیلتیک مجزا قرار گرفتند؛ به‌طوری‌که پنج جدایۀ آذربایجان‌ شرقی، قزوین، زنجان، فارس و کرمان در کنار دو جدایه از استرالیا و ژاپن که همگی از روی باقلا جدا شده بودند، در یک گروه جای گرفتند و جدایه‌ها‌‌ی اردبیل، همدان و خوزستان به همراه دو جدایۀ دیگر ایرانی موجود در بانک ژن، دو جدایه از هند و دو جدایه از ژاپن در گروه دیگر قرار گرفتند. بر اساس نتایج آزمون نوترکیبی، هیچ‌کدام از جدایه‌های ایرانی جمع‌آوری‌شده در پژوهش حاضر، جدایۀ نوترکیب تشخیص داده نشدند.
بحث و نتیجه‏گیری: درک تغییرات ژنتیکی و نوترکیبی جمعیت ویروسی پیش‌نیاز مهمی برای تشخیص کارآمد، مدیریت مؤثر و کنترل بیماری در درازمدت است. قطعاً نتایج در توسعۀ راهکار‌هایی کاربرد دارند که به مقاومت در برابر BYMV منتج می‌شوند و چنانچه این بیماری در آینده همه‌گیر شود، می‌توانند در راستای اتخاذ راهبردهای مدیریتی اثربخش باشند.

کلیدواژه‌ها [English]

  • تحلیل فیلوژنتیکی
  • آرایه‌بندی
  • HC-Pro
  • BYMV

مقدمه.

ویروس موزاییک زرد لوبیا[1] (BYMV) به جنس Potyvirus و خانوادۀ Potyviridae تعلق دارد. ویروس یادشده دارای RNA تک‌رشته‌ای مثبت است و از طریق چندین گونه شته به‏شکل ناپایا منتقل می‏شود. اگرچه خسارت آلودگی با BYMV سبب نابودی گیاه نمی‌شود، میزان عملکرد آن را کاهش می‌دهد (1). نشانه‌های بیماری ناشی از ویروس BYMV در گیاهان آلوده متغیر است و به‌طور درخور توجهی تحت‌تأثیر استرین ویروس و ژنوتیپ گیاه قرار دارد. مهم‌ترین نشانه‌هایی که این ویروس ایجاد می‌کند، عبارتند از: موزاییک، کوچک‌شدن، پیچیدگی و بدشکلی برگ‌ها (2). مشابه بسیاری از پوتی‌ویروس‌ها، ویروس موزاییک زرد لوبیا گسترش جهانی وسیعی دارد و تعداد زیادی از میزبان‌های گیاهی را آلوده و خسارت‌ اقتصادی مهمی را به انواع گیاهان تک‌لپه‌ای و دو‌لپه‌ای وارد می‌کند. ویروس موزاییک زرد لوبیا دارای استرین‌ها یا پاتوتیپ‌های بسیاری در طبیعت است که ازنظر ویژگی‌های زیستی مانند دامنۀ میزبانی و شدت بیماری‌زایی با یکدیگر تفاوت دارند (3). نخستین گزارش BYMV در ایران را کایزر[2] و همکاران (1968) از روی گیاهانی مانند نخود ایرانی، نخودفرنگی، عدس، لوبیا و باقلا ارائه کردند (4). تاکنون ویروس BYMV از استان‏های کرمان، هرمزگان، تهران، فارس، خوزستان، گیلان، مازندران، کرمانشاه، اصفهان، البرز و لرستان از روی باقلا (5 و 6)، آفتابگردان (7)، زعفران (8) و همچنین از پداژه‌های گلایول (9) گزارش شده است.

ویروس موزاییک زرد لوبیا (مانند سایر اعضای خانوادۀ Potyviridae) پلی‌پروتئینی را کد می‌کند که به 10 پروتئین با عملکرد مشخص تقسیم می‌شود (10). پروتئین‌هایی که ژنوم BYMV کد می‌کند، از قسمت َ5 به َ3 به‌ترتیب عبارتند از: P1، HC-Pro، P3، 6K1، CI، 6K2، VPg، NIa، NIb و CP (11)؛ همچنین یک قاب خواندنی باز[3] (ORF) کوتاه در سیترون P3 با عنوان [4]PIPO و با حفاظت‌شدگی زیاد گزارش شده است (12). پروتئین HC یکی از پروتئین‌هایی است که ویروس کد می‌کند، چندین عملکرد دارد و در بسیاری از مراحل چرخۀ آلودگی با ویروس دخیل است (13). این پروتئین دارای حفاظت‌شدگی زیادی بین اعضای جنس Potyvirus است و آغازگرهای طراحی‌شده بر اساس ناحیۀ HC-Pro می‌توانند تمام گونه‌های Potyvirus را شناسایی کنند (14). بر اساس پیش‌بینی‌های ساختاری، پروتئین HC به سه ناحیۀ کاربردی تقسیم می‌شود: ناحیه‌های انتهای آمینی و انتهای کربوکسیلی که هرکدام تقریباً 100 آمینو‌اسید دارند و ناحیۀ مرکزی که حدود 250 آمینو‌اسید را پوشش می‌دهد و شامل دامنه‌ای (حدود 100 آمینو‌اسید) است که سبب اتصال ناحیۀ مرکزی و انتهای کربوکسیلی می‌شود. ابتدا این پروتئین به‌شکل مؤلفۀ کمکی برای انتقال پوتی‌ویروس‌ها به‌واسطۀ شته از گیاهی به گیاه دیگر شناسایی شد. بر اساس پژوهش‌های انجام‌شده، احتمالاً ژن یادشده به‌شکل پلی بین استایلت شته و ویروس عمل می‌کند (15). تاکنون پنج عملکرد مختلف برای پروتئین HC ذکر شده است: انتقال ویروس از طریق شته، تکثیر RNA، حرکت سیستمیک، سرکوب خاموشی RNA و عمل به‌شکل پروتئیناز (16 و 17). باتوجه‌به اهمیت پروتئین HC به‌عنوان ناحیه‌ای با عملکرد چندگانه و انجام‌نشدن مطالعه‌ای روی ساختار این پروتئین در جدایه‌های ایرانی، در پژوهش حاضر به بررسی ویژگی‌های ساختاری و فیلوژنتیکی ناحیۀ HC-Pro در جدایه‌های جمع‌‌آوری‌شده از مناطق جغرافیایی مختلف ایران پرداخته و با سایر جدایه‌های موجود در بانک ژن مقایسه شد.

 

مواد و روش‌ها.

.ردیابی و شناسایی ویروس موزاییک زرد لوبیا در مزارع باقلا: در فصل‌های زراعی ۱۳۹۶ تا ۱۳۹۷، برگ‌های گیاهان دارای نشانه‌های ویروسی از مزارع باقلای استان‌های آذربایجان شرقی، اردبیل، زنجان، قزوین، همدان، خوزستان، فارس و کرمان به‌طور جداگانه و با ثبت نام محل و تاریخ نمونه‏برداری در کیسه‏های پلاستیکی مخصوص جمع‌آوری و در مجاورت یخ به آزمایشگاه منتقل شدند. آزمون داس الیزا[5] با بهره‌گیری از آنتی‏بادی‏ اختصاصی چندهمسانه‌ای BYMV که از مؤسسۀ Bioreba‏‏ تهیه شد، طبق دستورعمل کلارک[6] و آدامز[7] (1977) برای تشخیص BYMV در نمونه‏ها استفاده شد (18). پس‌از گذشت حدود ۳۰ دقیقه، نتایج با دستگاه الیزا‌خوان[8] Epoch (BioTech) در طول ‌موج ۴۰۵ نانومتر خوانده شدند و یک نمونۀ آلوده به ویروس از هر منطقه برای بررسی‌های بیشتر انتخاب شد.

.استخراج RNAکل گیاه، تکثیر و توالی‌یابی ناحیۀ HC-Pro جدایه‌های انتخابی: RNA کل 8 نمونۀ انتخابی آلوده به BYMV با استفاده از کیت Top Plant and Fungi RNA Purification kit (شرکت توپازژن، ایران) بر اساس دستورعمل شرکت سازنده استخراج شد. ناحیۀ HC-Pro جدایه‏های بررسی‌شده به روش‏ مولکولی RT-PCR و به کمک جفت آغازگر اختصاصی 1370For (CTM[9]CARATGGAGAAY[10]CCYGC) و 2340R (CCAAAGTTCCAATCACCACC) تکثیر شد (19). واکنش RT-PCR برای تولید cDNA در دو مرحله و در حجم نهایی 20 میکرولیتر انجام شد. ابتدا میکروتیوب‌های حاوی 4 میکرولیتر Reverse transcriptase buffer 10X، 1 میکرولیتر dNTPs (10 mmol/ul) (تهیه‌شده از شرکت یکتا تجهیز آزما)، 1 میکرولیتر آغازگر 2340R (10pmol/ul)، 8 میکرولیتر آب مقطر استریل و 5 میکرولیتر RNA استخراج‌شده به‌مدت 5 دقیقه در دمای 65 درجۀ سانتی‌گراد در دستگاه ترموسایکلر (Bio-Rad, T-100) و سپس روی یخ قرار داده شدند؛ در مرحله بعد، هرکدام از آنزیم‌های MuMLV Reverse transcriptase (RT) و RNase inhibitor (40U/ul) به میزان 5/0 میکرولیتر به میکروتیوب اضافه شدند و به‌مدت 1 ساعت در دمای 42 درجۀ سانتی‌گراد در دستگاه ترموسایکلر قرار گرفتند. واکنش PCR در حجم نهایی 25 میکرولیتر شامل 5/5 میکرولیتر آب استریل، 5/12 میکرولیتر Master mix (1.5 mM MgCl2) ساخت شرکت ویراژن، 1 میکرولیتر آغازگر (10 pmol/ul) و 5 میکرولیتر cDNA در دستگاه ترموسایکلر انجام شد. برنامۀ گرمایی واکنش PCR به‌شکل واسرشت‌سازی اولیه به‌مدت 3 دقیقه در دمای 94 درجۀ سانتی‌گراد و 35 چرخه شامل واسرشت‌سازی به‌مدت 1 دقیقه در دمای 94 درجۀ سانتی‌گراد، اتصال به‌مدت 1 دقیقه در دمای 53 درجۀ سانتی‌گراد و بسط به‌مدت 1 دقیقه در دمای 72 درجۀ سانتی‌گراد تنظیم شد و درنهایت، بسط نهایی به‌مدت 10 دقیقه در دمای 72 درجۀ سانتی‌گراد انجام شد. کیفیت قطعه‌های تکثیرشدۀ حاصل از واکنش روی ژل آگارز 1 درصد در بافر TBE (Tris-Borate-EDTA) بررسی شد. پس‌از اطمینان‌یافتن از خالص‌بودن قطعۀ تکثیری به‌ طول حدود 1100 جفت باز، ناحیۀ مدنظر تکثیرشده از جدایه‏‌های مختلف برای تعیین توالی به شرکت توپازژن ارسال شد.

.بررسی توالی ناحیۀ HC-Pro در جدایه‌های BYMV: به‌منظور مقایسۀ توالی جدایه‌های بررسی‌شده با سایر جدایه‌ها، تمام جدایه‌هایی که توالی HC-Pro آنها ثبت شده بود، از بانک ژن برداشت شدند. ویژگی‌های جدایه‌ها به‌طور خلاصه در جدول 1 بیان شده‌اند. توالی‌های نوکلئوتیدی به‌دست‌آمده از جدایه‌های ایرانی با برنامۀ ترجمه ExPASY (https://web.expasy.org/translate) به توالی آمینواسیدی تبدیل شدند. نرم‌افزار MAFFT v.7 با تنظیمات پیش‌فرض برای هم‌ردیف‌سازی چندگانه بر اساس توالی نوکلئوتیدی و آمینواسیدی استفاده شد (20). فایل هم‌ردیف‌سازی‌شده به‌طوردستی با برنامۀ Mesquite v.3.04 بازبینی شد (21). به‌منظور مشاهدۀ توالی‌های حفاظت‌شده بین توالی‌های هم‌ردیف‌سازی‌شده، توالی‌های یادشده با برنامۀ Weblogo.v.2.8.2 به تصویر کشیده شدند (22).

 

 

جدول 1- جدایه‌های جمع‌آوری‌شده از مناطق جغرافیایی مختلف ایران و بانک ژن

میزبان

شهر

کشور

سال

رأس‌شمار

نام جدایه

Broad bean

Fasa

Iran

2017

MN117959

2Fa

Broad bean

Tabriz

Iran

2017

MN117966

6T

Faba Bean

-

Australia

1998

HG970867

FB

Faba Bean

-

Japan

1990

AB439731

90.2

Broad bean

Zanjan

Iran

2018

MN117962

1Z

Broad bean

Ghazvin

Iran

2018

MN117963

2Gh

Broad bean

Giroft

Iran

2018

MN117961

50G

Broad bean

Dezfol

Iran

2017

MN117960

28KH

Broad bean

Ardabil

Iran

2017

MN117965

4A

-

-

Australia

1996

U47033

BYMVS

Sunflower

Esfahan

Iran

2012

KT934334

BYSun

Gladiolus

Karaj

Iran

2010

KR065420

GPK

Gladiolus

-

Japan

2008

AB439729

Gla

Faba Bean

-

India

2013

KF155423

Vfaba4

Gladiolus

-

India

2013

KF155422

Glad20

Gladiolus

-

Japan

2008

AB439730

G1

Faba Bean

-

India

2013

KF155424

Vfaba2

Eustoma

-

Taiwan

2007

AM884180

Lisianthus

Gladiolus

-

USA

2002

AY192568

GDD

Gladiolus

-

India

2013

KF155420

CKGL5

Pea

-

India

2013

KJ922618

RM

Soybean

-

India

2013

KJ872537

RRM

Gladiolus

-

India

2013

KF155421

Glad7

-

-

Japan

2002

AB079888

GB2

Pea

-

India

2014

KJ994279

RM3

Gladiolus

-

India

2013

KF155414

CKGL3

-

-

Japan

1996

NC_003492

MB4

Pea

-

India

2014

KJ994280

RM4

Gladiolus

-

India

2012

KM114059

CKGL2

Pea

-

India

2014

KJ994278

RM2

Pea

-

India

2014

KJ734282

R3

Trifolium

-

Japan

1991

AB439732

92.1

Faba Bean

-

Australia

1998

HG970868

LPexFB

Lupinis

-

Australia

1998

HG970866

LP

Diuris

-

Australia

2012

KF632713

SW9

Lupinis

-

Australia

2011

HG970854

GB32A

Lupinis

-

Australia

2011

HG970856

ES69C

Diuris

-

Australia

2011

JX156423

SW3.2

Lupinis

-

Australia

2011

HG970863

AR87C

Lupinis

-

Australia

1998

HG970855

LMBNN

Lupinis

-

Australia

2011

HG970849

MD6

Lupinis

-

Australia

2011

HG970850

MD7

Lupinis

-

Australia

2011

HG970859

ES11A

Lupinis

-

Australia

2011

HG970853

GB42C

Lupinis

-

Australia

2011

HG970847

MD1

Lupinis

-

Australia

2011

HG970857

ES67C

Lupinis

-

Australia

2011

HG970858

ES55C

Lupinis

-

Australia

2011

HG970862

PN77C

Lupinis

-

Australia

2011

HG970861

PN80A

Lupinis

-

Australia

2011

HG970860

PN83A

Lupinis

-

Australia

2011

HG970852

GB17A

Lupinis

-

Australia

2011

HG970864

AR98C

Lupinis

-

Australia

2011

HG970865

AR93C

Lupinis

-

Australia

2012

HG970869

NG1

Diuris

-

Australia

2011

JX173278

KP2

Lupinis

-

Australia

2011

HG970851

SP1

Freesia

-

South Korea

2008

FJ492961

Fr

Gladiolus

-

India

2012

KF155409

CKGL1

-

-

Japan

2002

AB079887

IbG

-

-

Japan

2002

AB079886

M11

Lupinis

-

Australia

2011

HG970848

MD5

-

-

Japan

2007

AB373203

CS

Trifolium

-

USA

2008

GQ181115

Alaska

Trifolium

-

Australia

2012

HG970870

CYVV

Broad bean

Hamadan

Iran

2018

MN117964

3H

 


.بررسی امکان نوترکیبی در جدایه‌های BYMV انتخابی: شش برنامۀ مختلف موجود در بستۀ نرم‌افزار RDP v.4 (RDP، GENECONV، BOOTSCAN، MAXCHI، SISCAN و 3SEQ) با تنظیمات پیش‌فرض برای بررسی احتمال نوترکیبی بین توالی‌های نوکلئوتیدی بررسی‌شده استفاده شدند. توالی‌هایی که دست‌کم با سه برنامه با P value کمتر از 6-10 شناسایی شدند، توالی‌های نوترکیب در نظر گرفته شدند (23).

.بررسی روابط فیلوژنتیکی جدایه‌های BYMV: به‌منظور بررسی روابط فیلوژنتیکی جدایه‌های بررسی‌شده در پژوهش حاضر با سایر جدایه‌های برداشت‌شده از بانک ژن (جدول ۱)، درخت فیلوژنی به روش Maximum Likelihood و بر اساس توالی نوکلئوتیدی و پروتئینی با برنامۀ IQtree v.1.6 رسم شد (24)؛ این برنامه بهترین و مناسب‌ترین مدل برای رسم درخت فیلوژنی را به‌طور خودکار انتخاب می‌کند.

بررسی ساختار پروتئینی توالی‌های BYMV: ساختار پروتئینی جدایه‌های بررسی‌شده با برنامۀ Pfam[11] ارزیابی شد. به‌منظور بررسی میزان حفاظت‌شدگی ژن HC-Pro، ساختاری کریستالی مربوط به بخش انتهای کربوکسیلی پروتئین یادشدۀ موجود در بانک دادۀ پروتئینی (PDB) با شماره شناسۀ 3RNV انتخاب شد؛ ساختار یادشده به ویروس موزاییک شلغم تعلق داشت و به روش تفرق اشعۀ ایکس تعیین شده بود (25). توالی‌های پروتئینی موجود که در بخش‌های پیش هم‌ردیف‌سازی شدند، با برنامۀ تحت‌وب Consurf (http://consurf.tau.ac.il) روی ساختار کریستالی پروتئین 3RNV هم‌ردیف‌سازی شدند.

 

نتایج و بحث

تکثیر و توالی‌یابی بخشی از ناحیۀ HC-Pro: به‌منظور بررسی ساختار HC-Pro در جدایه‌های ایرانی BYMV، یک جدایه از هر استان که در آزمون الیزا مثبت شده بود، انتخاب شد. واکنش RT-PCR با استفاده از آغازگرهای اختصاصی ناحیۀ HC-Pro به تکثیر قطعه‌ای به طول حدود 1100 جفت باز منجر شد. نتایج تکثیر ژن HC-Pro روی ژل آگارز 1 درصد در شکل 1 مشاهده می‌شوند. توالی‌های 8 جدایۀ بررسی‌شده با نام‌های 2Fa، 28KH، 50G، 1Z، 2Gh، 3H، 4A و 6T به‌ترتیب به استان‌های فارس، خوزستان، کرمان، زنجان، قزوین، همدان، اردبیل و تبریز تعلق داشتند.

بررسی ساختار توالی جدایه‌های HC-Pro: توالی نوکلئوتیدی جدایه‌های ایرانی انتخابی پس‌از ترجمه به توالی آمینواسید، با استفاده از برنامۀ Pfam بررسی شد. همان‌طورکه در جدول ۲ مشاهده می‌شود، ساختار پروتئینی 8 توالی بررسی‌شده از ناحیه‌ای با عملکرد پپتیداز و متعلق به گروه HC-Pro تشکیل شده است.

 

 

شکل 1- الکتروفورز محصولات آزمون  RT-PCRبا استفاده از آغازگرهای 1370Forو 2340Rev  روی  ژل آگارز 1 درصد رنگ‌آمیزی‌شده با Red-safe: راهک 1: DNA Ladder (1kb)، راهک 2: شاهد منفی، راهک‌های 3، 4، 5، 6، 7، 8، 9 و 10: نمونۀ باقلای جدا‌شده از مناطق جغرافیایی مختلف ایران (آذربایجان شرقی، اردبیل، قزوین، زنجان، همدان، خوزستان، فارس و کرمان)

 

نتایج بررسی جدایه‌های ایرانی با سایر جدایه‌های موجود در بانک ژن به کمک برنامۀ بلاست نشان دادند جدایه‌های 2Fa و 50G بیشترین شباهت را به‌ترتیب به میزان 11/98 و 69/97 درصد با جدایۀ استرالیایی FB جداشده از باقلا نشان می‌دهند. جدایه‌های 28KH، 3H و 4A بیشترین شباهت را به‌ترتیب به میزان 69/97، 89/92 و 15/98 درصد با دیگر جدایۀ ایرانی (Bysun) جداشده از آفتابگردان نشان دادند. دو جدایۀ 1Z و 2Gh به‌ترتیب به میزان 34/97 و 16/96 درصد با جدایۀ ژاپنی 90.2 جداشده از باقلا شباهت داشتند و جدایۀ 6T به میزان 11/94 درصد با جدایۀ آمریکایی GDD جداشده از گلایول مشابهت نشان داد.

 


جدول ۲- بررسی عملکرد پروتئین HC-Pro جدایه‌های ایرانی با استفاده از برنامۀ Pfam

E-value

Bit score

HMM

Alignment

Family/Description

Isolate

End

Start

End

Start

7.2e-54

183.4

338

113

230

3

Peptidase C6/

Helper component proteinase

2Fa

1.9e-77

261.1

400

112

292

2

Peptidase C6/

Helper component proteinase

28KH

8.7e-81

272.1

414

121

299

3

Peptidase C6/

Helper component proteinase

50G

7.5e-94

315.1

440

139

306

3

Peptidase C6/

Helper component proteinase

1Z

2.1e-98

330.1

440

112

337

7

Peptidase C6/

Helper component proteinase

2Gh

4.1e-44

151.2

349

139

228

16

Peptidase C6/

Helper component proteinase

3H

1.2e-97

327.6

440

112

339

9

Peptidase C6/

Helper component proteinase

4A

2.9e-69

234.1

368

112

264

6

Peptidase C6/

Helper component proteinase

6T

 

 

تاکنون توالی پروتئین HC مربوط به 54 جدایۀ BYMV در بانک ژن ثبت شده است. توالی‌های آمینواسیدی ثبت‌شده به همراه 8 توالی ایرانی بررسی‌شده در پژوهش حاضر پس‌از هم‌ردیف‌سازی با برنامۀ وب‌لوگو[12] به تصویر کشیده شدند (شکل ۲، الف). همان‌طور که شکل ۲، الف نشان می‌دهد نخستین ناحیۀ پروتئین که شامل آمینواسیدهای موقعیت‌های ۱ تا ۱۰۰ هستند، ناحیۀ انتهایی آمینی نامیده می‌شود (26). ناحیۀ انتهایی آمینی در انتقال شته اهمیت دارد، اما نقشی در آلوده‌سازی و حیات ویروس ندارد (27). در پژوهش‌های انجام‌شده، ناحیۀ حفاظت‌شدۀ KITC در بخش انتهایی آمینی پوتی‌ویروس‌ها، ناحیۀ مهمی معرفی شده است که برای اتصال استایلت شتۀ ناقل و انتقال ویروس ضروری است. همان‌طور که در شکل ۲، الف مشخص شده است، جدایه‌های بررسی‌شدۀ ویروس موزاییک زرد لوبیا به‌جای KITC، توالی RITC را دارند. نتایج فلاسینسکی[13] و همکاران نشان دادند اگرچه آرژنین در تعداد کمی از پوتی‌ویروس‌ها مانند ویروس موزاییک زرد لوبیا جایگزین لیزین می‌شود، خاصیت انتقال با شته حفظ می‌شود (28).

بخش دوم پروتئین یا ناحیۀ مرکزی شامل آمینواسیدهای موقعیت‌های ۱۰۰ تا ۳۰۰ است. همان‌طور که در شکل ۲، الف مشخص شده است، دو توالی حفظ‌شدۀ PTK و FRNK در این ناحیه وجود دارند. در پژوهش‌های انجام‌شده به نقش این توالی‌ها به‌ترتیب در انتقال شته از طریق واکنش با پروتئین پوششی (29) و در بازدارندگی خاموشی ژن (30) در برخی پوتی‌ویروس‌ها اشاره شده است.

ناحیۀ انتهایی کربوکسیلی در بخش انتهای پروتئین قرار دارد و شامل ۱۰۰ آمینواسید است. ویژگی پروتئازی پروتئین HC که از نوع سیستئین است، ازجمله ویژگی‌های این ناحیه است. ناحیۀ انتهایی کربوکسیلی خاصیت خودبرشی دارد و بر فعالیت بازدارندگی خاموشی ژن تأثیرگذار است (31). ناحیۀ حفظ‌شدۀ YXVG در انتهای توالی پروتئین HC به‌عنوان توالی ناحیۀ خودبرشی در پوتی‌ویروس‌های مختلف شناسایی شده است (32)؛ این توالی در جدایه‌های ویروس موزاییک زرد لوبیا به‌شکل توالی حفاظت‌شدۀ YRVG با رنگ قرمز در شکل ۲، الف مشخص شده است. دو آمینواسید هیستیدین و سیستئین که برای فعالیت خود‌برشی پروتئین HC ضروری هستند (33)، در توالی‌های بررسی‌شده به‌شکل حفظ‌شده وجود دارند و با پیکان در شکل ۲، الف مشخص شده‌اند.

به‌منظور بررسی بهتر و کسب اطلاعات بیشتر دربارۀ ساختار ناحیۀ انتهایی کربوکسیلی، توالی‌های بررسی‌شده در پژوهش حاضر روی ساختار سه‌بعدی این ناحیه که به ویروس موزابیک شلغم تعلق داشت، هم‌ردیف‌سازی شدند (شکل ۲، ب). همان‌طور که مشاهده می‌شود، ناحیۀ انتهایی کربوکسیلی از چهار مارپیچ آلفا و دو صفحۀ بتا تشکل شده است؛ موقعیت این نواحی به‌ترتیب به‌شکل مربع خاکستری و آبی روی وب‌لوگو (شکل ۲، الف) مشخص شده است. صفحه‌های بتا بین مارپیچ سوم و چهارم و پشت‌سرهم قرار گرفته‌اند. دو آمینواسید ضروری در فعالیت کاتالیتیک سیستئین و هیستیدین به‌ترتیب در بخش‌های ابتدایی مارپیچ آلفای اول و صفحۀ بتای دوم قرارگرفته‌اند. همان‌طور که در شکل سه‌بعدی مشاهده می‌شود، اتصال انتهای سه مارپیچ شماره‌های ۱، ۲ و ۳ از یک سو و اتصال به صفحۀ بتای ۲ از سوی دیگر که به هم باند شده‌اند، مانع پذیرش پیش‌مادۀ جدید به پروتئین برای ایجاد برش می‌شود؛ این ویژگی ساختاری سبب ایجاد فعالیت خودبرشی می‌شود (25).

 

 

               ب                                                                 الف

1

Ɓ2

2

3

4

Ɓ1

N-terminus

 

 

 

 

 

Central region

 

 

 

 

 

 

 

C-terminus

آمینواسیدهای مرتبط با فعالیت آنزیمی

شکل 2- الف. نمایی کلی از هم‌ردیف‌سازی ترادف‌های آمینواسیدی پروتئین HC-Pro جدایه‌های ایرانی و سایر جدایه‌های موجود در بانک ژن با برنامۀ وب‌لوگو که به سه بخش ناحیۀ انتهای آمینی یا N-terminal، ناحیۀ مرکزی یا Central region و ناحیۀ انتهای کربوکسیلی یا C-terminal تقسیم می‌شوند. موتیف‌های مسئول انتقال شته و بازدارندگی خاموشی، ناحیۀ خودبرشی با رنگ قرمز، محل مارپیچ‌های آلفا و صفحه‌های بتا به‌ترتیب با رنگ‌های خاکستری و آبی مشخص شده‌اند. ب. طرح حفاظت‌شدگی توالی‌های پروتئینی HC-Pro هم‌ردیف‌سازی روی ساختار سه‌بعدی پروتئینی موجود در PDB با شماره شناسۀ 3RNV با استفاده از برنامۀ Consurf


بررسی احتمال نوترکیبی: نوترکیبی از پدیده‌های رایج در چرخۀ تکثیر ویروس‌هاست (34 و 35). نوترکیبی‌های ژنتیکی نقش مهمی را در خطاهای فیلوژنتیکی ایفا می‌کنند. معمولاً پدیدۀ نوترکیبی بین جدایه‌های یک پوتی‌ویروس بسیار متداول است، ولی با شدت کمتر بین گونه‌های مختلف نیز اتفاق می‌افتد (36). معمولاً پدیدۀ نوترکیبی بین جدایه‌های یک‌ گونۀ پوتی‌ویروسی سبب جابه‌جایی قطعه‌های ژنومی می‌شود؛ البته وقوع آن بین جنس‌های مختلف به‌ندرت گزارش ‌شده است. به‌منظور بررسی این پدیدۀ زیستی در ژنوم جدایه‌های بررسی‌شده در مطالعۀ حاضر، پس‌از هم‌ردیف‌سازی این توالی‌ها با سایر جدایه‌های انتخابی موجود در بانک ژن و با الگوریتم‌های مختلف، از نرم‌افزار RDP4 استفاده شد. در حالتی وجود نوترکیبی پذیرفته می‌شود که دست‌کم با سه روش با P value کمتر از 6-10 شناسایی شود (23). همان‌طورکه در جدول 3 مشاهده می‌شود، نوترکیبی در جدایۀ 28KH جدا‌شده از استان خوزستان با دو برنامۀ GENECONV و 3Sec شناسایی شد و نکتۀ درخور توجه این است که جدایۀ ایرانی BYSun جداشده از آفتابگردان والد اصلی معرفی شده است؛ اما ازآنجاکه این نوترکیبی تنها با دو روش شناسایی شده است، چندان قابل‌اعتماد نیست و می‌توان نتیجه‌ گرفت هیچ‌کدام از جدایه‌های ایرانی بررسی‌شده نوترکیب نیستند. در زمینۀ سایر جدایه‌های موجود در بانک ژن نیز باتوجه‌به نتایج و همان‌طور که در جدول 3 مشاهده می‌شود، جدایه‌های CKGL3، M11، RM2 و GDD بر اساس معیارهای نتایج نوترکیبی، جدایه‌های نوترکیب هستند. مطالعه‌های انجام‌شده تغییر شرایط میزبانی و اقلیمی و درنتیجۀ آن، تغییر شدید ژنوم به‌منظور سازگاری با شرایط جدید را منشأ پیدایش بسیاری از گونه‌های ویروسی عنوان می‌کنند.

 

 

جدول 3- بررسی وقوع نوترکیبی در توالی HC-Pro جدایه‌‌هایBYMVبا استفاده از برنامۀ RDP

Detection method / Pvalue

Minor[14] parent

Major[15] parent

Recomb.

 

T

S

C

M

B

G

R

 

4.4*10-15

9.7*10-46

2.2*10-04

9.5*10-15

6.8*10-13

1.7*10-13

2.2*10-18

CKGL2

Gla

CKGL3

1

4.4*10-28

3.2*10-50

1.5*10-07

1.2*10-07

-

2 *10-02

1.9*10-05

SW9

BYSun

M11

2

3.4*10-12

3.1*10-15

-

4.5*10-08

3.2*10-03

5.2*10-03

5*10-04

Unknown

Glad7

RM2

3

6.3*10-04

5.4*10-30

-

3.8*10-04

-

-

3.8*10-05

CKGL2

Gla

RM2

4

-

9.4*10-13

-

2.5*10-02

-

-

-

RM

RM2

RM3

5

1.3*10-04

-

-

-

-

4.9*10-05

-

BYSun

CKGL2

MB4

6

8.9*10-04

1.9*10-14

9.2*10-03

3.5*10-03

-

2.4*10-03

1.9*10-04

KP2

Gla

GDD

7

2.2*10-02

-

-

-

-

1*10-03

-

Unknown

BYSun

28KH

8

6.7*10-02

-

-

-

-

-

-

CKGL2

BYMVS

Lisianthus

9

.


بررسی روابط فیلوژنتیکی جدایه‌های ایرانی با سایر جدایه‌های BYMV: به‌منظور بررسی روابط فیلوژنی جدایه‌های بررسی‌شده با سایر جدایه‌های موجود، پس‌از حذف توالی‌های نوترکیب، از برنامۀ IQtree استفاده شد. بهترین مدل‌ها برای رسم درخت فیلوژنی بر اساس توالی نوکلئوتیدی و آمینواسیدی برآورد‌شده با برنامۀ مدل‌یاب موجود در نرم‌افزار IQtree به‌ترتیب مدل‌های TIM2+F+I+G4 و FLU+G4 بودند. درخت‌های فیلوژنتیکی رسم‌شده بر اساس توالی نوکلئوتیدی و آمینواسیدی HC-Pro به‌ترتیب در شکل‌های ۳ و ۴ نمایش داده شده‌اند. همان‌طور که مشاهده می‌شود، شش گروه کلی در هر دو درخت فیلوژنتیکی رسم‌شده بر اساس توالی HC-Pro وجود دارند که با شماره‌های ۱ تا ۶ نام‌گذاری شده‌اند. همۀ نمونه‌ها به‌جز ۱۵ جدایۀ موجود در گروه ۴، در پنج گروه مونوفیلتیک با بوت‌استرپ بیش از ۹۶ درصد در درخت رسم‌شده بر اساس توالی نوکلئوتیدی و بیش از ۸۰ درصد بر اساس توالی پروتئینی قرار گرفتند. بوت‌استرپ درخت رسم‌شده بر اساس توالی نوکلئوتیدی بیشتر از توالی آمینواسیدی و ترتیب گروه‌های تشکیل‌شده در درخت رسم‌شده بر اساس توالی نوکلئوتیدی و آمینواسیدی با یکدیگر متفاوت است.

تقسیم‌بندی انجام‌شده در پژوهش حاضر بر اساس توالی پروتئینی HC-Pro با تقسیم‌بندی انجام‌شده بر اساس توالی کل ژنوم (کهو[16] و همکاران، 2014( و توالی ناحیۀ CP (ویلی[17] و همکاران، 2008) مطابقت کامل ندارد (37 و 38). در طبقه‌بندی ویلی و همکاران (2008) بر اساس ناحیۀ CP، جدایه‌ها در هفت گروه Canna، Monocot، General، W، Broad bean، Lupine و Pea قرار گرفته‌اند. نتایج این پژوهش نشان دادند بین گروه‌های فیلوژنتیکی، میزبان و منطقۀ جغرافیایی ارتباط وجود دارد (38). در بررسی کهو و همکاران (2014( بر اساس توالی کامل ژنوم BYMV، گروه‌های مونوفیلتیک تشکیل‌شده با اعداد لاتین از I تا IX نام‌گذاری شده‌اند. باتوجه‌به نتایج پژوهش یادشده، ارتباطی بین گروه‌های فیلوژنتیکی، میزبان و جغرافیا مشاهده نمی‌شود (34).

در درخت‌های رسم‌شده در شکل‌های ۳ و ۴، جدایه‌های استرالیایی که از گیاه لوبیای مصری (Lupin) جداسازی شده‌اند، در گروه ۱ قرار گرفته‌اند. تعدادی از این جدایه‌ها که توالی کامل آنها نیز وجود دارد، در گروه I کهو و همکاران (۲۰۱۴) قرار گرفته‌اند (34) و هیچ‌کدام از جدایه‌های یادشده در پژوهش ویلی و همکاران (2008) استفاده نشده‌اند (38).

گروه 2 شامل یک جدایه از کشور ژاپن است که در گروه‌های III کهو و همکاران (۲۰۱۴) (37) و Monocot ویلی و همکاران (2008) (38) قرار گرفته است.

در گروه ۳، پنج جدایۀ ایرانی بررسی‌شده در پژوهش حاضر و دو جدایه از استرالیا و ژاپن قرار گرفته‌اند که همگی از روی باقلا جدا شده‌اند. جدایه‌های استرالیا و ژاپن در طبقه‌بندی‌های انجام‌شده به‌ترتیب به گروه VII کهو و همکاران (۲۰۱۴) و Broad Bean ویلی و همکاران (2008) تعلق دارند (37 و 38).

در گروه 5، سه جدایۀ اردبیل، همدان و خوزستان همراه با دو جدایۀ ایرانی موجود در بانک ژن جداشده از آفتابگردان و گلایول و دو جدایه از هند (گلایول و باقلا) و دو جدایه از ژاپن (گلایول و شبدر) جای گرفته‌اند. بر اساس تقسیم‌بندی‌های انجام‌شده، جدایۀ ایرانی آفتابگردان و جدایۀ استرالیایی S و ژاپنی 1/92 در گروه V، دو جدایۀ LP و LPexFB استرالیایی جداشده از Lupine در گروه VI، جدایۀ گلایول هند Gla در گروه III و جدایۀ Vfaba2 در گروه IV کهو و همکاران (۲۰۱۴) قرار گرفته‌اند (37). در درختی که ویلی و همکاران (2008) رسم‌ کرده‌اند (38)، جدایۀ S به گروه Broad Bean تعلق گرفته است.

جدایۀ آمریکایی Alaska جداشده از شبدر و جدایۀ CS ژاپن در گروه 6 قرار گرفته‌اند؛ جدایۀ CS در گروه IX کهو و همکاران (۲۰۱۴) و Pea ویلی و همکاران (2008) قرار گرفته است (37 و 38). در کنار گروه‌های مونوفیلتیک یادشده، ده جدایه از کشور هند (جداشده از نخود، گلایول، باقلا و سویا)، یک جدایۀ تایوانی (Eustoma)، سه جدایۀ ژاپنی و یک جدایۀ آمریکایی (گلایول) در کنار هم قرار گرفته‌اند، اما گروه مونوفیلتیک ایجاد نکرده‌اند؛ این دسته با عنوان گروه 4 در شکل‌های 3 و 4 نام‌گذاری شده است.

 

 

 

شکل ۳- درخت‌ فیلوژنتیک ۵۸ جدایۀ BYMV همراه با گروههای ادغام‌شده؛ درخت بر اساس توالی نوکلئوتیدی ناحیۀ HC-Pro با نرم‌افزار IQtree رسم شده و CYVV برای ریشه به کار رفته است. جدایه‌های ایرانی با رنگ قرمز مشخص شده‌اند.

 

شکل ۴- درخت‌ فیلوژنتیک ۵۸ جدایۀ BYMV همراه با گروه‌های ادغام‌شده؛درخت بر اساس توالی آمینواسید ناحیۀ HC-Pro با نرم‌افزار IQtree رسم شده و CYVV برای ریشه به کار رفته است. جدایه‌های ایرانی با رنگ قرمز مشخص شده‌اند.

 


نتیجه‌گیری

تحلیل مقایسه‌ای توالی‌ها در سیستماتیک و زیست‌شناسی به‌منظور درک بهتر مسیرهای تکاملی دارای کاربرد روزافزون است و یکی از مناسب‌ترین داده‌ها برای این پژوهش‌ها، به‌کار‌بردن توالی‌های نوکلئوتیدی و پروتئینی است. معمولاً توالی‌های نوکلئوتیدی اطلاعات بسیار ارزشمندی را برای مقایسۀ گونه‌های نزدیک به هم یا جدایه‌های یک‌گونۀ ویروسی در خود جای داده‌اند (39). در پژوهش حاضر به بررسی مولکولی و فیلوژنتیکی جدایه‌های ایرانی ویروس موزاییک زرد لوبیا و سایر جدایه‌های موجود در بانک ژن بر اساس توالی‌های نوکلئوتیدی و پروتئینی پرداخته شد. بر اساس نتایج، توالی جدایه‌های ایرانی BYMV جداشده از باقلا سطوح متفاوتی از تنوع را در سطح ژن HC-Pro نشان می‌دهند. در درخت فیلوژنتیکی رسم‌شده بر اساس توالی نوکلئوتیدی و پروتئینی، 8 جدایۀ ایرانی BYMV بررسی‌شده در پژوهش حاضر در دو خوشه‌بندی مجزا قرار گرفتند؛ به‌طوری‌که گروه اول شامل جدایه‌های ایرانی جمع‌آوری‌شده از فارس، تبریز، قزوین، جیرفت و زنجان و گروه دوم شامل جدایه‌های جمع‌آوری‌شده از اردبیل، همدان و خوزستان بودند. ترتیب جدایه‌ها و گروه‌بندی مشاهده‌شده در درخت فیلوژنی رسم‌شده بر اساس توالی HC-Pro، تفاوت‌هایی با درخت رسم‌شده بر اساس ژن CP در مطالعه‌های گذشته (38) دارد؛ این تفاوت‌ها نشان‌ می‌دهند تاریخچۀ تکاملی این دو ژن در طول زمان متفاوت است. نتایج پژوهش حاضر، ایجادنشدن نوترکیبی در ساختار ژن HC-Pro در جدایه‌های ایرانی بررسی‌شده را نشان می‌دهند. درک تغییرات ژنتیکی و نوترکیبی جمعیت ویروسی پیش‌نیاز مهمی برای تشخیص کارآمد، مدیریت مؤثر و کنترل بیماری در درازمدت است (40). قطعاً نتایج پژوهش حاضر در توسعۀ راهبردهایی تأثیر دارند که به مقاومت در برابر BYMV منتج می‌شوند و چنانچه این بیماری در آینده همه‌گیر شود، می‌توانند در راستای اتخاذ راهبردهای مدیریتی اثربخش باشند.

 

سپاسگزاری

پژوهش حاضر با حمایت مالی دانشگاه ولی‌عصر (عج) رفسنجان در قالب رسالۀ دکتری و بخشی از آن در قالب فرصت مطالعاتی در دانشگاه بولونیا (UNIBO) در کشور ایتالیا انجام شده است.

(1) Kyrychenko AM., Antipov IO., Hrynchuk KV. Phylogenetic analysis of Ukrainian BYMV isolates from soybeans and beans. Cytology and Genetics 2017; 51(3): 173-178.
(2) Luo H., Wylie SJ., Coutts B., Jones RA., Jones MG. A virus of an isolated indigenous flora spreads naturally to an introduced crop species. Annals of Applied Biology 2011; 159(3): 339-347.
(3) Bos L. Bean yellow mosaic virus. Descriptions of Plant Viruses 1970; 40: 8.
(4) Kaiser WJ., Mueller KE., Danesh D. An outbreak of broad bean disease in Iran. Iranian Journal of Plant Pathology 1968; 4: 1.
(5) Davoodi Z., Hosseini S., Hosseini A. Occurance and detection of bean yellow mosaic virus in faba bean fields of Kerman province. Agricultural Biotechnology 2014; 5: 73-75.
(6) Baradar A., Hosseini A., Hosseini S., Abdani Babaki S. The first report of the bean yellow mosaic virus incidence in broad bean fields of Hormozgan province. Proceedings of the 23rd Iranian Plant Protection Congress, Gorgan University, Gorgan, Iran 2018; 656-657.
(7) Rabiee S., Hosseini S., Hosseini A. Occurrence and distribution of some sunflower viruses from sunflower fields in Kerman and Isfahan provinces, Iran. Archives of Phytopathology and Plant Protection 2015; 48(3): 223-228.
 
 
(8) Dorrigiv R., Mehrvar M., Jafarpour B., Zakiaghl M. New host records for Bean yellow mosaic virus in Iran.21st Iranian Plant Protection Congress, Urmia University, Urmia, Iran 2014; 387.
(9) Sharifi Nezamabad P., Koohi Habibi M., Dizadji A., Kalantari S., Ranjbar Aghdam M. Biological characteristics and phylogenetic Iranian isolates of gladiolus Bean yellow mosaic virus. Iranian Journal of Plant Protection Science 2014; 45(1): 13-27.
(10)           Al-Saleh MA., Al-Shahwan IM., Amer MA., Abdalla OA. Etiology of a mosaic disease of radish and lettuce and sequencing of the coat protein gene of the causal agent in Saudi Arabia. International Journal of Virology 2009; 5: 131-142.
(11)           Waltermann A., Maiss E. Detection of 6K1 as a mature protein of 6 kDa in plum pox virus-infected nicotiana benthamiana. Journal of General Virology 2006; 87(8): 2381-2386.
(12)           Chung BY., Miller WA., Atkins JF., Firth AE. An overlapping essential gene in the Potyviridae. Proceedings of the National Academy of Sciences 2008; 105(15): 5897-5902.
(13)           Rajamäki ML., Mäki-Valkama T., Mäkinen K., Valkonen JP. 3 Infection with Potyviruses. In Annual Plant Reviews, Plant- Pathogen Interactions 2004; 11: 68-91.
(14)           Ha C., Coombs S., Revill PA., Harding RM., Vu M., Dale JL. Design and application of two novel degenerate primer pairs for the detection and complete genomic characterization of Potyviruses. Archives of Virology 2008; 153(1): 25-36.
(15)           Plisson C., Drucker M., Blanc S., German-Retana S., Le Gall O., Thomas D., Bron P. Structural characterization of HC-Pro, a plant virus multifunctional protein. Journal of Biological Chemistry 2003; 278(26): 23753-61.
(16)           Maia IG., Haenni AL., Bernardi F. Potyviral HC-Pro: a multifunctional protein. Journal of General Virology 1996; 77(7): 1335-41.
(17)           Urcuqui-Inchima, S. Potyvirus proteins: a wealth of functions. Virus Research 2001; 74: 157-175.
(18)           Clark MF., Adams AN. Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. Journal of General Virology 1977; 34(3): 475-83.
(19)           Nakazono-Nagaoka E., Sato C., Kosaka Y., Natsuaki T. Evaluation of cross-protection with an attenuated isolate of Bean yellow mosaic virus by differential detection of virus isolates using RT-PCR. Journal of General Plant Pathology 2004; 70(6): 359-62.
(20)           Katoh K., Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 2013; 30(4): 772-780.
(21)           Maddison WP., Maddison DR. Mesquite, a modular system for evolutionary analysis, Version 2.75. Retrieved from http. mesquiteproject. Org/ On: 03 December 2011.
(22)           Crooks GE., Hon G., Chandonia JM., Brenner SE. WebLogo: A sequence logo generator. Genome Research 2004; 14(6): 1188-1190.
(23)           Martin DP., Murrell B., Golden M., Khoosal A., Muhire B. (2015) RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evolution 1(1): 1-5.
(24)           Nguyen LT., Schmidt HA., Von Haeseler A., Minh BQ. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 2014; 32(1): 268-274.
(25)           Guo B., Lin J., Ye K. Structure of the autocatalytic cysteine protease domain of Potyvirus helper-component proteinase. Journal of Biological Chemistry 2011; 286(24): 21937-21943.
(26)           Hasiów-Jaroszewska B., Fares MA., Elena SF. Molecular evolution of viral multifunctional proteins: The case of Potyvirus HC-Pro. Journal of Molecular Evolution 2014; 78(1): 75-86.
(27)           Dolja VV., Herndon KL., Pirone TP., Carrington JC. Spontaneous mutagenesis of a plant potyvirus genome after insertion of a foreign gene. Journal of Virology 1993; 67(10): 5968-5975.
(28)           Flasinski S., Cassidy BG. Potyvirus aphid transmission requires helper component and homologous coat protein for maximal efficiency. Archives of Virology 1998; 143(11): 2159-2172.
(29)           Peng Y., Kadoury D., Gal-On A., Huet H., Wang Y., Raccah B. Mutations in the HC-Pro gene of zucchini yellow mosaic potyvirus: effects on aphid transmission and binding to purified virions. Journal of General Virology 1998; 79(4): 897-904.
(30)           Shiboleth YM., Haronsky E., Leibman D., Arazi T., Wassenegger M., Whitham SA., Gal-On A. The conserved FRNK box in HC-Pro, a plant viral suppressor of gene silencing, is required for small RNA binding and mediates symptom development. Journal of Virology 2007; 81(23): 13135-13148.
(31)           Torres-Barceló C., Martín S., Daròs JA., Elena SF. From hypo-to hypersuppression: effect of amino acid substitutions on the RNA-silencing suppressor activity of the Tobacco etch potyvirus HC-Pro. Genetics 2008; 180(2): 1039-1049.
(32)           Carrington JC., Herndon KL. Characterization of the potyviral HC-Pro autoproteolytic cleavage site. Virology 1992; 187(1): 308-315.
(33)           Cronin S., Verchot J., Haldeman-Cahill R., Schaad MC., Carrington JC. Long-distance movement factor: a transport function of the potyvirus helper component proteinase. The Plant Cell 1995; 7(5): 549-559.
(34)           Gutiérrez P., Mesa HJ., Marín MM. Genome sequence of a divergent Colombian isolate of Potato virus V (PVV) infecting Solanum phureja. Acta virologica 2016; 60(1): 49-54.
(35)           Zhu F., Sun Y., Wang Y., Pan H., Wang F., Zhang X., Zhang Y., Liu J. Molecular characterization of the complete genome of three basal-BR isolates of Turnip mosaic virus infecting Raphanus sativus in China. International Journal of Molecular Sciences 2016; 17(6): 888.
(36)           Gibbs AJ., Ohshima K., Yasaka R., Mohammadi M., Gibbs MJ., Jones RA. The phylogenetics of the global population of Potato virus Y and its necrogenic recombinants. Virus Evolution 2017; 3(1): vex002.
(37)           Kehoe MA., Coutts BA., Buirchell BJ., Jones RA. Plant virology and next generation sequencing: experiences with a Potyvirus. PLoS One 2014; 9(8): e104580.
(38)           Wylie SJ., Coutts BA., Jones MG., Jones RA. Phylogenetic analysis of Bean yellow mosaic virus isolates from four continents: relationship between the seven groups found and their hosts and origins. Plant Disease 2008; 92(12): 1596-1603.
(39)           Yang Z., Rannala B. Molecular phylogenetics: Principles and practice. Nature Reviews Genetics 2012; 13(5): 303.
(40)           Balasubramanian V., Sukanya RS., Anuradha C., Selvarajan R. Population structure of Banana bract mosaic virus reveals recombination and negative selection in the helper component protease (HC-Pro) gene. Virus Disease 2014; 25(4): 460-466.