مطالعۀ فنوتیپی و ژنوتیپی کلاس‌های ژن تنظیم‌گر مقاومت به کولیستین (arn) در اسینتوباکتر بومانی جداشده از موارد بالینی به روش PCR چندگانه

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 گروه میکروبیولوژی، دانشکده علوم پایه، واحد ساوه، دانشگاه آزاد اسلامی، ساوه، ایران

2 گروه میکروبیولوژی، دانشکده علوم پایه، واحد ساوه، دانشگاه آزاد اسلامی، ساوه، ایران.

10.22108/bjm.2020.120342.1248

چکیده

مقدمه: کولیستین آخرین خط درمان در عفونت‌های بیمارستانی ناشی از اسینتوباکتر بومانی به شمار می‌آید. امروزه با روشن‌شدن سازوکار انتقال مقاومت از طریق ژن‌های arn، بروز الگوی مقاومت دارویی جدید در جدایه‌‏های اسینتوباکتر بومانی مشاهده شده است. در مطالعۀ حاضر سعی شد به بررسی فنوتیپی و ژنوتیپی کلاس‌های ژن تنظیم‌گر مقاومت به کولیستین (arn) در گونه‌های جدا‌شده از موارد بالینی پرداخته شود.
مواد و روش‏‏ها: به‌منظور انجام این مطالعۀ توصیفی، پس‌از دریافت رضایت کتبی، تعداد 400 نمونۀ بالینی از بیماران بستری در بیمارستان حضرت رسول تهران جمع‌آوری شد. پس‌از شناسایی جدایه‌‏ها با استفاده از روش‌های بیوشیمیایی و بررسی 16S rDNA، الگوی مقاومت آنتی‏بیوتیکی جدایه‌‏ها به دو روش انتشار دیسک و روش مولکولی (برای ردیابی ژن‏های arnBوarnT) تعیین شد.
نتایج: تعداد 60 سویۀ اسینتوباکتر بومانی از 400 نمونۀ گرفته‌شده جدا شد. مطابق نتایج بررسی الگوی مقاومت آنتی‌بیوتیکی، در بیشترین حالت، بیش از 38 درصد نمونه‌های خون دارای گونۀ اسینتوباکتر بومانی بودند و در هیچ نمونۀ مغزی‌نخاعی، اسینتوباکتر بومانی یافت نشد و کمترین نسبت آلودگی را نشان داد (p <0.05)؛ همچنین اختلاف آماری معناداری بین حساسیت آنتی‌بیوتیکی جدایه‌های اسینتوباکتر بومانی به کولیستین و سایر آنتی‌بیوتیک‌ها مشاهده شد (p <0.05)؛ علاوه‌بر‌این، سویه‌های مقاوم به کولیستین دارای ژن‌های arnB و arnT بودند که در مقایسه با سایر سویه‌ها ازنظر آماری معنادار بود (p <0.05).
بحث و نتیجه‏گیری: باتوجه‌به اینکه کولیستین آخرین خط درمان است، افزایش مقاومت به آن می‌تواند به افزایش مرگ‌و‌میر و هزینه‌های بیمارستانی منجر شود؛ از‌این‌رو، به‌کارگیری رژیم‌های درمانی جدید و حساسیت بیشتر در تشخیص به‌موقع و کنترل عفونت‌های بیمارستانی امری ضروری به نظر می‌رسد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

A Phenotypic and Genotypic Study of Colistin arn Resistance Regulator Gene Classes in Acinetobacter Baumannii isolated from Clinical Cases using Multiplex PCR

نویسندگان [English]

  • Farnoosh Karimi 1
  • Kumarss Amini 2
  • Gholamreza javadi 1
1 Department of Microbiology, Faculty of Basic Sciences, Saveh Branch, Islamic Azad University, Saveh, Iran
2 Department of Microbiology, School of Basic Sciences, Saveh Branch, Islamic Azad University, Saveh, Iran.
چکیده [English]

Introduction: Colistin is considered as the last line of treatment in nosocomial infections caused by Acinetobacter baumannii. Nowadays, with the elucidation of resistance transition mechanisms through arn genes, a new drug resistance pattern has been observed in Acinetobacter baumannii isolates. The aim of this study was to investigate the phenotypic and genotypic roles of the genes for regulating resistance to Colistin (arn) in strains isolated from clinical cases.
Materials and methods: To conduct this descriptive study, after obtaining the written consent, 400 clinical samples were collected from patients admitted to Hazrat-e-Rasoul Hospital in Tehran. After the identification of the isolates using biochemical methods and 16srDNA analysis, the antibiotic resistance pattern of the isolates was determined by disk diffusion and molecular methods (to detect arnT, arnB genes).
Results: Sixty Acinetobacter baumannii strains were isolated from 400 samples. The results of antibiotic resistance analysis showed that, in most cases, more than 38% of blood samples had Acinetobacter species. Also, no Acinetobacter was found in any of the spinal cord specimens, which showed the lowest infection rate (p <0.05). There was also a significant difference between the antibiotic susceptibility of Acinetobacter baumannii isolates to Colistin and other antibiotics (p <0.05). In addition, Colistin resistant strains had arnB and arnT genes, which were considered statistically significant (p <0.05) compared to other strains.
Discussion and conclusion: Since Colistin is used as the last line of treatment, increased resistance to it can lead to increased mortality and hospital costs. Therefore, the application of new therapeutic regimens and greater sensitivity to the timely diagnosis and control of nosocomial infections seems necessary.

کلیدواژه‌ها [English]

  • Colistin
  • Acinetobacter
  • Resistance
  • arn gene

مقدمه

اسینتوباکتر بومانی (Acinetobacter baumannii)، باکتری بیماری‌زای فرصت‌طلب و ازجمله باکتری‌های گرم‌ منفی، هوازی و غیرتخمیری است که به‌شکل کوکسی یا کوکوباسیل دیده می‌شود. ازآنجاکه این گونۀ باکتریایی نیازمندی‌های غذایی اندکی برای رشد دارد، می‌تواند به‌مدت طولانی در شرایط نامساعد، سطوح خشک و همچنین محیط آبی زنده بماند (1). اسینتوباکتر در بسیاری منابع ازجمله شیر پاستوریزه‌شده، غذاهای یخ‌زده، هوای بیمارستان، لباس شسته‌شده، لارنگوسکوپ، کاتتر آنژیوگرافی، ونتیلاتورها، بالشت‌های بیمارستانی و صابون‌ها مشاهده شده است و مقاومت آن به برخی شوینده‌های شیمیایی همچون کلرهگزیدین سبب شده است از علل مهم عفونت‌های بیمارستانی به شمار آید. تعدادی از گونه‌های اسینتوباکتر مستقیماً در عفونت‌های انسانی دخالت دارند که مهم‌ترین آنها، اسینتوباکتر بومانی است (2). مطالعه‌های همه‌گیرشناسی (Epidemiology) اثبات کرده‌اند این باکتری به‌ندرت سبب بروز عفونت‌‌های سخت در افراد دارای سطح ایمنی طبیعی می‌شود، اما در گروه‌های مختلف مستعد عفونت‌های فرصت‌طلب همچون افراد بستری در بخش مراقبت‌های ویژۀ بیمارستان، افراد دارای نقص ایمنی یا سوختگی وسیع و سالمندان سبب ایجاد عفونت‌های مجاری ادراری، مننژیت، اندوکاردیت، پریتونیت، عفونت‌های زخم و عفونت پوست می‌شود (3).

امروزه علاوه‌بر فساد مواد غذایی، مقاومت آنتی‌بیوتیکی سویه‌های اسینتوباکتر بومانی مقاوم به چند دارو (MDR) از مهم‌ترین عوامل عفونت بیمارستانی به شمار می‌آید. مطالعه‌ها نشان می‌دهند مقاومت آنتی‌بیوتیکی در این سویه‌هابه‌واسطۀ سازوکارهای اکتسابی و ذاتی همچون تغییر آنزیمی، جهش در ژن‌های هدف، تغییر نفوذ‌پذیری غشای خارجی، افزایش بیان افلاکس پمپ‌ها و انتقال ژن‌های مقاومت دارویی منتقل‌شونده با عناصر ژنتیکی متحرک (مانند ترانسپوزون‌ها) رخ می‌دهد (1)؛ در این بین، کولیستین از مهم‌ترین آنتی‌بیوتیک‌های ضد‌ اسینتوباکتر است که امروزه، مقاومت علیه آن مدنظر قرار گرفته است. این دارو، نوعی آنتی‌بیوتیک از دستۀ پلی‌میکسین است که غشای خارجی باکتری‌های گرم منفی را تخریب می‌کند و دارای آثار وابسته به غلظت باکتری‌کش بر اسینتوباکتر بومانی است. اگرچه مطالعه‌های اخیر مقاومت اسینتوباکتر بومانی نسبت به پلی‌میکسین‌ها را در شرایط بالینی و آزمایشگاهی نشان‌ می‌دهند، سازوکارهای این مقاومت هنوز ناشناخته است. دستۀ ژنی arnBCADTEF پروتئینی را تولید می‌کند که نقش اساسی در تنظیم مقاومت به کولیستین دارد (4 و 5).

مقاومت آنتی‌بیوتیکی سویه‌های مقاوم به چند کلاس مختلف آنتی‌بیوتیکی همچون بتالاکتام‌ها، آمینوگلوکوزید‌ها و فلوئوروکینولون‌ها سبب افزایش طول مدت بستری و هزینه‌های درمانی و نهایتاً افزایش میزان مرگ‌ومیر افراد می‌شود. درمان عفونت‌های ناشی از این عامل بیماری‌زا به‌علت مقاومت درخور توجه آن به طیف وسیعی از آنتی‌بیوتیک‌ها بسیار دشوار است و میزان مرگ‌ومیر بیماران آلوده را به 43 درصد و در برخی کشورهای جهان سوم به 75 درصد می‌رساند (6 و 7).

مطالعه‌ها روی سطوح و الگوهای مختلف حساسیت آنتی‌بیوتیکی سویه‌های مختلف اسینتوباکتر بومانی در مناطق مختلف جهان و ایران نشان می‌دهند سویه‌های اسینتوباکتر بومانی در مقایسه با سایر گونه‌های اسینتوباکتر، مقاومت آنتی‌بیوتیکی بیشتری دارند. باوجود نمونه‌های پراکندۀ عفونت اسنتیوباکتر، شیوع عفونت بیمارستانی ناشی از سویه‌های اسنتیوباکتر بومانی به‌طور گسترده در مقاله‌های همه‌گیرشناسی (Epidemiology) گزارش و به نگرانی فزاینده‌ای در بیمارستان‌ها تبدیل شده است (5). سیستم‌های طبقه‌‌بندی متعددی برای تعیین منشأ عفونت و روش گسترش گونه‌ها توسعه یافته‌اند که از طبقه‌بندی فنوتیپی اولیه (طبقه‌بندی بر اساس یافته‌های سرم‌شناسی و طبقه‌بندیباکتریوسین) تا روش‌های مولکولی معتبرتر مانند طبقه‌بندی ریبوزومی، تحلیل چند‌ریختی‌های طول محدودیت در DNA کروموزومی از طریق PFGE تعیین اثر PNR، ARDRA، تحلیل DNA چندریختی تکثیرشدۀ تصادفی AFLP، PCR منطقۀ محدودیت کمیاب (IRS-PCR) و PCR مبتنی بر توالی متقارن برون زاد تکراری (REP-PCR) را شامل می‌شوند. اگرچه تمام روش‌های یادشده درصدهایی از تمایز را میان جدایه‌های بالینی نشان می‌دهند، در حال حاضر هیچ روش استاندارد توافق‌شده‌ای برای دسته‌بندی اسینتوباکتر بومانی بر اساس الگوی حساسیت آنتی‌بیوتیکی وجود ندارد (8 و 9).

ازآنجاکه شناسایی الگوی حساسیت آنتی‌بیوتیکی در هر منطقه از مهم‌ترین عوامل جلوگیری از گسترش مقاومت آنتی‌بیوتیکی است، مطالعۀ حاضر می‌کوشد به بررسی فنوتیپی و ژنوتیپی تعیین میزان شیوع مقاومت آنتی‌بیوتیکی و توزیع ژن تنظیم‌گر مقاوم به کولیستین (arn) در باکتری اسینتوباکتر بومانی جداشده از نمونه‌های بالینی (خون، ترشحات تنفسی، ادرار، زخم پوست) به ‏روش ‏Multiplex PCR‏ و تعیین مقاومت آنتی‌بیوتیکی به روش انتشار دیسک بپردازد.

مواد و روش‌ها

جمعیت مطالعه و جداسازی باکتری: به‌منظور انجام این مطالعۀ توصیفی- مقطعی، تعداد 400 نمونۀ بالینی شامل خون (140 نمونه)، ترشحات تنفسی (122 نمونه)، ادرار (59 نمونه)، مایع مغزی‌نخاعی (40 نمونه)، خلط (20 نمونه) و زخم (19 نمونه) طی مدت سه ماه (مهر تا دی 97) از بیماران بستری در بیمارستان حضرت رسول (تهران) جمع‌آوری و به آزمایشگاه میکروب‌شناسی تحقیقاتی پاسارگاد منتقل شد. بیمارانی شرایط مطالعه را داشتند که رضایت‌نامۀ کتبی را به‌منظور موافقت با انجام مطالعه روی نمونه امضا کرده بودند و در پروندۀ آنها تأیید شده بود که عفونت بیمارستانی دارند. نمونه‌ها به‌مدت 24 ساعت در دمای 37 درجۀ سانتی‌گراد انکوبه و سپس رنگ‌آمیزی گرم شدند تا وجود کوکوباسیل‌های گرم منفی اسینتوباکتر تأیید شود. به‌منظور شناسایی گونه‌های مختلف اسینتوباکتر، آزمون‌های بیوشیمیایی IMVIC، اوره‌آز، SIM، MRVP، OF، TSI، کاتالاز و اکسیداز و رشد در 37 و 42 درجۀ سانتی‌گراد انجام شدند. گونه‌هایی که نتایج آزمون‌های کاتالاز، سیترات و اوره‌آز آنها مثبت و لاکتوز، اکسیداز، اندول، H2S، MRVP آنها منفی و بدون حرکت بودند، اسینتوباکتر بومانی در نظر گرفته شدند و در محیط پپتون‌واتر (30 درصد گلیسرول) و دمای منفی 60 درجۀ سانتی‌گراد نگهداری شدند. تأیید قطعی گونه‌ها با ردیابی قطعۀ ژنی 16S rDNA طبق روش یادشده در مطالعۀ قبلی (10) و طی واکنش PCR انجام شد.

آزمون تعیین حساسیت جدایه‌ها به آنتی‏بیوتیک‏ها:مقاومت به آنتی‏بیوتیک‏ها با استفاده از دیسک‏های آنتی‏بیوتیکی (شرکت پادتن طب، ایران) بر اساس CLSI (2018) (11) و به روش انتشار دیسک در محیط مولر‌هینتون‌آگار ارزیابی شد. گفتنی است از سویۀ استاندارد اسینتوباکتر بومانی ATCC 23155 برای شاهد مثبت و از سویۀ استاندارد اشریشیا کلی ATCC 12475 برای شاهد منفی کیفیت آنتی‌بیوگرام استفاده شد. آنتی‏بیوتیک‏های آزمون‌شده در جدول 1 دیده می‌شوند. سوسپانسیون باکتری با کدورت معادل 5/0 مک‌فارلند روی محیط مولر‌هینتون‌آگار تلقیح شد؛ پس‌از گذاشتن دیسک‏ها در محیط‌کشت و 24 ساعت انکوباسیون در دمای 37 درجۀ سانتی‌گراد، نتایج بررسی قطر هالۀ رشدنکردن با جدول CLSI تفسیر شدند.

مراحل مولکولی: در مطالعۀ حاضر، جداسازی DNA با استفاده از کیت اختصاصی جداسازی DNA (سیناژن، ایران) و با‌توجه‌به دستورعمل سازنده انجام شد؛ سپس به‌منظور بررسی کمّی و کیفی DNA جداشده، روش‌های اسپکتروفتومتری با نانودراپ و الکتروفورز در ژل انجام شدند و کمیت و کیفیت مناسب ژنوم جداشده در تمام نمونه‌ها تأیید شد. آغازگرهای استفاده‌شده (ماکروژن، ایران) برای ردیابی ژن‌های arnB و arnT در جدول 2 دیده می‌شوند که با نرم‌افزار Gene runner طراحی و در سایت NCBI بلاست شدند.

آزمون Multiplex PCR با مقادیر 10 میکرولیتر PCR Master Mix 2x (Amplicon)، 8/0 میکرولیتر از هر آغازگر (جدول 2) با غلظت 10 پیکومول‌بر‌میکرولیتر و 4 میکرولیتر از DNA الگو (150 نانوگرم) برای هر واکنش در مراحل دمایی شامل دناتوراسیون اولیه در دمای 95 درجۀ سانتی‌گراد به‌مدت 5 دقیقه، 35 چرخه شامل دناتوراسیون در 95 درجۀ سانتی‌گراد به‌مدت 30 ثانیه، مرحلۀ اتصال آغازگر در دمای 55 درجۀ سانتی‌گراد به‌مدت 30 ثانیه و مرحلۀ تکثیر در دمای 72 درجۀ سانتی‌گراد به‌مدت 1 دقیقه و پس‌از 35 چرخه، مرحلۀ تکثیر نهایی در دمای 72 درجۀ سانتی‌گراد به‌مدت 10 دقیقه انجام شد.

 

جدول 1- دیسک‌های استفاده‌شده برای آزمون آنتی‌بیوگرام و تفسیر قطر هالۀ رشدنکردن بر اساس میلی‌متر

مقاوم

حدواسط

حساس

آنتی‌بیوتیک/غلظت بر اساس میکروگرم

10

-

11

کولیستین 10

13

20-14

21

سفتریاکسون 30

15

20-16

21

سیپروفلوکساسین 30

17

20-18

21

پیپیراسیلین 100

14

16-15

17

آمیکاسین 30

11

14-12

15

آمپی‌سیلین 10

14

22-15

23

سفوتاکسیم 30

14

15-17

18

سفتازیدیم 30

12

14-13

15

توبرامایسین 10

17

20-18

21

مروپنم 10

13

15-14

16

ایمی‌پنم 10

 

 

 

جدول 2- آغازگرهای استفاده‌شده در مطالعۀ حاضر

توالی آغازگر

اندازۀ محصول

ژن هدف

F=5ʹ- ATAATCGGCGACAGGATAGC -3ʹ

R=5ʹ- CAGTATCGGTCAGTGGCTGT-3ʹ

147 جفت باز

arnT

F=5ʹ- CTAGGAATTCCACGCCAAGGACGCCAAC -3ʹ

R=5ʹ- CTAGGGATCCCCGGGAGAATGGCAGAAAGTC -3ʹ

1040 جفت باز

arnB

F=5ʹ CATTATCACGGTAATTAGTG-3ʹ

R=5ʹ- AGAGCACTGTGCACTTAAG-3ʹ

200 جفت باز

16S rDNA

 

 

به‌منظور تکثیر قطعه‌های ژنی مطالعه‌شده از دستگاه ترموسایکلر (اپندورف، آلمان) و برای ردیابی قطعۀ ژنی تکثیریافته در PCR از الکتروفورز محصول PCR روی ژل آگارز استفاده شد. در این مرحله، 15 میکرولیتر از محصول PCR مربوط به هر مرحله از آزمایش در حضور نشانگر 100 جفت بازی DNA (سیناژن، ایران) به‌مدت حدود 32 دقیقه روی ژل آگارز 5/1 درصد دارای اتیدیوم‌بروماید در ولتاژ ثابت 76 ولت الکتروفورز شد و سپس ژل به‌دست‌آمده با دستگاه ژل داک مشاهده و از آن عکس‌برداری شد.

تجزیه‌و‌تحلیل آماری: داده‏های حاصل با نرم‌افزار آماری SPSS، نسخۀ 21 و مدل‏های آماری مجذور کای و دقیق فیشر در سطح اطمینان 95 درصد تحلیل شدند.
نتایج

در مطالعۀ حاضر، 60 سویه استینوباکتر بومانی از 400 نمونۀ گرفته‌شده از بیماران بستری در بیمارستان به دست آمد. مطابق داده‌ها در بیشترین حالت، بیش از 38 درصد نمونه‌های خون دارای گونۀ استینوباکتر بومانی بودند و استینوباکتر بومانی در هیچ نمونۀ مغزی‌نخاعی یافت نشد و کمترین نسبت آلودگی را نشان داد (P<0.05). در مرحلۀ بعد، تمام سویه‌های استینوباکتر بومانی جدا‌شده برای تعیین الگوی حساسیت آنتی‌بیوتیکی در حضور آنتی‌بیوتیک‌های هدف مطالعۀ حاضر به روش انتشار دیسک بررسی شدند (جدول 3). نتایج آماری نشان دادند اختلاف آماری معناداری بین حساسیت آنتی‌بیوتیکی جدایه‌های اسینتوباکتر بومانی به کولیستین و سایر آنتی‌بیوتیک‌ها وجود دارد (P<0.05).

 

 

جدول 3- نتایج آنتی‌بیوگرام سویه‌های اسینتوباکتر بومانی

تعداد و درصد سویه‌ها بر اساس تفسیر CLSI

 

Resistance

Intermediate

Sensitive

مادۀ ضدمیکروبی

درصد

تعداد

درصد

تعداد

درصد

تعداد

3/3

2

0

0

96

58

کولیستین

86

52

0

0

6/11

7

سفتریاکسون

80

48

0

0

3/18

11

سیپروفلوکساسین

3/83

50

3/3

2

6/11

7

پیپیراسیلین

6/91

55

6/1

1

5

3

آمیکاسین

3/3

2

5

3

6/91

55

آمپی‌سیلین

3/83

50

0

0

6/16

10

سفوتاکسیم

3/93

56

0

0

66/6

4

سفتازیدیم

90

54

0

0

10

6

سفیکسیم

3/83

50

3/3

2

6/11

7

مروپنم

86

52

6/11

7

0

0

ایمی‌پنم

               

 


نتایج آزمون Multiplex PCR: نتایج آزمون Multiplex PCR نشان دادند از مجموع 60 سویۀ استینوباکتر بومانی ، 15 درصد سویه‌ها (9 سویه) ژن arn B و 10 درصد سویه‌ها (6 سویه) ژن arn T را دارند. بررسی آماری نشان داد سویه‌های مقاوم به کولیستین دارای ژن‌های arnB و arnT هستند که ازنظر آماری در مقایسه با سایر سویه‌ها معنادار تلقی می‌شود (P<0.05) (شکل 1).

 

 

شکل 1- نتیجۀ آزمایش Multiplex-PCR روی تعدادی از جدایه‌ها که به‌ترتیب از چپ به راست عبارتند از: M. نشانگر DNA 100 جفت بازی، ستون 1. شاهد مثبت، ستون 2. شاهد منفی، ستون‌های 3 تا 14. محصولات PCR نمونه‌ها

 


بحث

گسترش مقاومت به آنتی‌بیوتیک‌ها و عفونت‌های بیمارستانی از مهم‌ترین مشکلاتی است که ساختارهای بهداشتی در جهان را درگیر کرده است و پیش‌بینی می‌شود به مشکل اول سازمان بهداشت جهانی طی سال‌های آینده تبدیل شود. اسینتوباکتر بومانی، باکتری مقاوم در برابر شرایط سخت محیطی و بیماری‌زای فرصت‌طلبی است که از مهم‌ترین عوامل عفونت‌های بیمارستانی به شمار می‌آید (12) و گسترش ژن‌های مقاومت آنتی‌بیوتیکی چندگانه، مشکل مهمی در درمان عفونت‌های حاصل از این باکتری است (2). در مطالعۀ حاضر با تعیین میزان شیوع مقاومت آنتی‌بیوتیکی، توزیع ژن تنظیم‌گر مقاوم به کولیستین (arn) در باکتری اسینتوباکتر بومانی جداشده از نمونه‌های بالینی بررسی شد. نتایج نشان دادند جدایه‌های بررسی‌شده مقاومت چندگانه به آنتی‌بیوتیک‌های اختصاصی این مطالعه دارند، اما حساسیت آنها به‌طور معناداری نسبت به کولیستین بیشتر از سایر آنتی بیوتیک‌ها است.

مطالعه‌های بسیاری به بررسی سطح حساسیت و مقاومت اسینتوباکتر بومانی نسبت به آنتی‌بیوتیک‌های رایج همچون مروپنم، کلرامفنیکل و نیتروفورانتوئین در ایران و جهان پرداخته‌اند و نتایج تقریباً یکسانی را به دست آورده‌اند (13). برخی مطالعه‌ها نیز آنتی‌بیوتیک‌های مشابه با مطالعۀ حاضر را بررسی کرده‌اند. در مطالعۀ Ayan و همکاران، 52 سویه مطالعه شدند (14) و تمام جدایه‌ها به پیپراسیلین، سیپروفلوکساسین و سفتریاکسون مقاوم بودند و حساسیت نسبت به آمیکاسین در 74 درصد جدایه‌ها مشاهده شد. در مطالعۀ حاضر، مقاومت به پیپراسیلین، سیپروفلوکساسین و سفتریاکسون بیش از 80 درصد بود، اما مقاومت به آمیکاسین در 91 درصد نمونه‌ها مشاهده شد؛ تفاوت در حساسیت نسبت به آمیکاسین را می‌توان به تفاوت جغرافیایی نسبت داد. Yun و همکاران طی مطالعه‌ای در سال 2016، مقاومت به کولیستین را در حیوانات و جمعیت انسانی چینی مشاهده و اثبات کردند (15). در مطالعه‌ای که Smolyakov و همکاران به‌منظور بررسی عفونت‌های ناشی از اسینتوباکتر بومانی با مقاومت دارویی چندگانه انجام دادند، مشخص شد 93 درصد سویه‌ها به ایمی‌پنم و تمام سویه‌ها به کولسیتین و آمپی‌سیلین- سولباکتام حساس هستند (16). در مطالعۀ حاضر نیز حساسیت سویه‌ها به آمپی‌سیلین اثبات شد، اما مقاومت 86 درصدی نسبت به ایمی‌پنم مشاهده شد که در تضاد با مطالعۀ یادشده است و به نظر می‌رسد زمان و جغرافیای نمونه‌برداری در این تفاوت مؤثر باشند.

در مطالعۀ دیگری، Tavakol و همکاران به ردیابی شایع‌ترین ژن‌های مقاومت آنتی‌بیوتیکی در جدایه‌های اسینتوباکتر بومانی جداشده از عفونت‌های بیمارستانی پرداختند و در راستای داده‌های به‌دست‌آمده در این مطالعه تأیید کردند استفاده از روش‌های مولکولی به‌ویژه Multiplex PCR در کنار آزمون آنتی‌بیوگرام، روش مناسبی برای تعیین الگوی مقاومت آنتی‌بیوتیکی و کنترل عفونت اسینتوباکتر بومانی است (10، 12 و 17)؛ از‌این‌رو، Multiplex PCR استفاده شد که در مطالعه‌های مختلف نشان داده شده است توانایی تولید اطلاعات بیشتر با کمترین میزان نمونه را نسبت به روش‌های سنتی و PCR معمولی دارد، زمان بسیار کمتری مصرف می‌کند، مقرون‌به‌صرفه است و موجب افزایش دقت در تحلیل داده‌ها می‌شود (18 و 19). مطالعۀ حاضر نشان داد وجود ژن‌های دستۀ ژنی arn می‌تواند به بروز مقاومت نسبت به کولیستین در اسینتوباکتر بومانی منجر شود که در راستای مطالعه‌های دیگر است، اما تاکنون این موضوع به‌طور اختصاصی در مطالعه‌ای بررسی نشده است. ارتباط بین فنوتیپ مقاومت و حضور توالی نوکلئوتیدی در جدایه‌ها بررسی و مشاهده شد اختلافی بین آنها وجود ندارد. مطالعۀ دانشمندان روی جمعیت ایرانی نشان داده‌ است بیشتر جدایه‏های اسینتوباکتر به سفالوسپورین‏های نسل سوم، تیکارسیلین- آزترونام و تیکارسیلین- کلاولانیک‌اسید مقاوم و به کولیستین حساس هستند و مطالعۀ حاضر در تأیید مطالعه‌های پیشین در این زمینه است (12 و 20-22). گفتنی است باوجود حساسیت باکتری‌ها به کولسیتین (آخرین خط درمان)، مقادیری از مقاومت در این گونه‌ها مشاهده می‌شود؛ علاوه‌بر‌این، ژن‌های مقاومت چندگانه می‌توانند روی ‏ژن‌های حدت arn قرار گیرند و برای نمونه، از باکتری های روده‌ای به سویه‌های دیگر همچون اسینتوباکتر بومانی منتقل شوند.

 

نتیجه‌گیری

ازآنجاکه کولیستین در آخرین خط درمان استفاده می‌شود، افزایش مقاومت به آن زنگ خطری برای سیستم‌های بهداشتی به‌ویژه در ردۀ دامپزشکی است. باتوجه‌به مصرف این دارو در دامپزشکی، به نظر می‌رسد انتقال مقاومت از باکتری‌های روده‌ای به اسینتوباکتر سبب نگرانی بیشتری است و از‌این‌رو، به‌کارگیری رژیم‌های درمانی جدید و حساسیت بیشتر در تشخیص به‌موقع و کنترل عفونت‌های بیمارستانی و دامپزشکی امری ضروری به نظر می‌رسد.

(1)              Harding CM., Hennon SW., Feldman MF. Uncovering the mechanisms of Acinetobacter baumannii virulence. Nature Reviews Microbiology 2018; 16(2): 91-102.
(2)              Mirshekar M., Shahcheraghi F., Azizi O., Solgi H., Badmasti F. Diversity of class 1 integrons, and disruption of carO and dacD by insertion sequences among Acinetobacter baumannii isolates in Tehran, Iran. Microbial Drug Resistance 2018; 24(4): 359-366.
(3)              Soltani B., Heidari H., Ebrahim-Saraie HS., Hadi N., Mardaneh J., Motamedifar M. Molecular characteristics of multiple and extensive drug-resistant Acinetobacter baumannii isolates obtained from hospitalized patients in Southwestern Iran. Le infezioni in medicina: rivista periodica di eziologia, epidemiologia, diagnostica, clinica e terapia delle patologie infettive 2018; 26(1): 67-76.
 
(4)              Logan LK., Gandra S., Trett A., Weinstein RA., Laxminarayan R. Acinetobacter baumannii resistance trends in children in the United States, 1999–2012. Journal of the Pediatric Infectious Diseases Society 2018; 8(2): 136-142.
(5)              Bhamidimarri SP., Zahn M., Prajapati JD., Schleberger C., Söderholm S., Hoover J., et al. A multidisciplinary approach toward identification of antibiotic scaffolds for Acinetobacter baumannii. Structure 2019; 27(2): 268-280.
(6)              Mertins S., Higgins PG., Rodríguez MG., Borlon C., Gilleman Q., Mertens P., et al. Generation and selection of antibodies for a novel immunochromatographic lateral flow test to rapidly identify OXA-23-like-mediated carbapenem resistance in Acinetobacter baumannii. Journal of Medical Microbiology 2019; 1021-1032.
(7)              Correa A., del Campo R., Escandón-Vargas K., Perenguez M., Rodríguez-Baños M., Hernandez-Gomez C., et al. Distinct genetic diversity of carbapenem-resistant Acinetobacter baumannii from Colombian hospitals. Microbial Drug Resistance 2018; 24(1): 48-54.
(8)              Yagnik KJ., Kalyatanda G., Cannella AP., Archibald LK. Outbreak of Acinetobacter baumannii associated with extrinsic contamination of ultrasound gel in a tertiary centre burn unit. Infection Prevention in Practice 2019; 1(2): 100009.
(9)              Wood CR., Mack LE., Actis LA. An update on the Acinetobacter baumannii regulatory circuitry. Trends in Microbiology 2018; 26(7): 560-562.
(10)          Tavakol M., Momtaz H., Mohajeri P., Shokoohizadeh L., Tajbakhsh E. Genotyping and distribution of putative virulence factors and antibiotic resistance genes of Acinetobacter baumannii strains isolated from raw meat. Antimicrobial Resistance and Infection Control 2018; 7(1): 120-126.
(11)          Córdova-Espinoza MG., Arana EDH., Giono-Cerezo S., Atanacio EGS., Tapia EC., Vázquez LIC., et al. First report of new clonal groups ST706 and ST1088 from MDR Klebsiella pneumoniae Mexican strains. bioRxiv 2019: 616334.
(12)          Moradi J., Hashemi FB., Bahador A. Antibiotic resistance of Acinetobacter baumannii in Iran: a systemic review of the published literature. Osong public Health and Research Perspectives 2015; 6(2): 79-86.
(13)          Kulengowski B., Burgess DS. Imipenem/relebactam activity compared to other antimicrobials against non-MBL-producing carbapenem-resistant Enterobacteriaceae from an academic medical center. Pathogens and disease 2019; 77(4): ftz040.
(14)          Ayan M., Durmaz R., Aktas E., Durmaz B. Bacteriological, clinical and epidemiological characteristics of hospital-acquired Acinetobacter baumannii infection in a teaching hospital. Journal of Hospital Infection 2003; 54(1): 39-45.
(15)          Liu Y-Y., Wang Y., Walsh TR., Yi L-X., Zhang R., Spencer J., et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. The Lancet Infectious Diseases 2016; 16(2): 161-168.
(16)          Smolyakov R., Borer A., Riesenberg K., Schlaeffer F., Alkan M., Porath A., et al. Nosocomial multi-drug resistant Acinetobacter baumannii bloodstream infection: risk factors and outcome with ampicillin-sulbactam treatment. Journal of Hospital Infection 2003; 54(1): 32-38.
(17)          Ostadi Y., Rezai AA., Moghadampour M., Faghri J. The involvement of drug efflux system in amikacin resistance of multiple drug resistant Acintobacter baumannii isolates in Isfahan, Iran. Journal of Medical Bacteriology 2019; 8(1, 2): 13-20.
(18)          Edwards MC., Gibbs RA. Multiplex PCR: advantages, development, and applications. Genome Research 1994; 3(4): S65-S75.
(19)          Barratt K., Anderson TP., Fahey JA., Jennings LC., Werno AM., Murdoch DR. Comparison of the fast track diagnostics respiratory 21 and Seegene Allplex multiplex polymerase chain reaction assays for the detection of respiratory viruses. British Journal of Biomedical Science 2017; 74(2): 85-89.
(20)          Peymani A., Nahaei M-R., Farajnia S., Hasani A., Mirsalehian A., Sohrabi N., et al. High prevalence of metallo-b-lactamase-producing acinetobacter baumannii in a teaching hospital in Tabriz, Iran. Japanese Journal of Infectious Diseases 2011; 64(1): 69-71.
(21)          Safari M., Saidijam M., Bahador A., Jafari R., Alikhani MY. High prevalence of multidrug resistance and metallo-beta-lactamase (MβL) producing Acinetobacter baumannii isolated from patients in ICU wards, Hamadan, Iran. Journal of Research in Health Sciences 2013; 13(2): 162-167.
(22)          Beigverdi R., Sattari-Maraji A., Emaneini M., Jabalameli F. Status of carbapenem-resistant Acinetobacter baumannii harboring carbapenemase: First systematic review and meta-analysis from Iran. Infection, Genetics and Evolution 2019; 73: 433-443.