مطالعۀ ژنومی ناتوکیناز جدا‌شده از باسیل‌های خاک و کلون‌کردن آن در باکتری اشریشیا کلی به‌منظور استفادۀ دارویی

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 دانش آموخته کارشناسی ارشد گروه زیست شناسی، واحد تهران شرق، دانشگاه آزاد اسلامی، تهران، ایران

2 دانشیار میکروبیولوژی، دانشکده علوم پایه، واحد ساوه، دانشگاه آزاد اسلامی، ساوه، ایران.

3 استادیار گروه زیست شناسی، واحد تهران شرق، دانشگاه آزاد اسلامی، تهران، ایران

10.22108/bjm.2020.120355.1250

چکیده

چکیده
مقدمه: ناتوکیناز، آنزیمی استخراج‌شده از غذایی ژاپنی است که در فرایند تخمیر آن تولید می‌شود؛ این آنزیم آثار مثبت درخور توجهی در درمان بیمار‌ی‌های قلبی عروقی، درمان یا پیشگیری از بیماری‌های آمیلوئیدی همچون آلزایمر و کاهش کلسترول خون دارد. مطالعۀ حاضر در نظر داشته تا به مطالعۀ ژنومی ناتوکیناز جداشده از باسیل‌های خاک مناطق اطراف تهران و کلون‌کردن آن در باکتری اشریشیا کلی به‌منظور استفادۀ دارویی بپردازد.
مواد و روش‏‏ها: در مطالعۀ حاضر، 60 نمونه از عمق 5 تا 10 سانتی‌متری خاک مناطق مختلف اطراف شهر تهران نمونه‌برداری و باکتری‌های باسیلوس آنها به روش‌های مولکولی و بیوشیمیایی جداسازی شدند. باکتری‌های دارای ژن ناتوکیناز به روش PCR مشخص شدند و ژن تکثیر‌شده در باکتری اشریشیا کلی کلون و توالی‌یابی شد؛ سپس بیان ژن به روش Real time PCR بررسی شد و روابط فیلوژنتیکی آن مشخص شدند.
نتایج: درنتیجۀ غربال‌گری نمونه‌های خاک ارسالی به آزمایشگاه، درمجموع 12 کلنی مشکوک به باسیل‌های گرم مثبت جداسازی شدند که بر اساس ویژگی‌های ریخت‌شناختی، میکروسکوپی و آزمون‌های بیوشیمیایی تعیین هویت شدند و مشخص شد 11 گونه ژن هدف را دارند. کلون‌کردن و بیان ژن ناتوکیناز به‌طور موفقیت‌آمیز انجام و همولوژی 99 تا 100 درصدی با سایر آنزیم‌ها مشاهده شد.
بحث و نتیجه‏گیری: در بررسی حاضر، ژن ناتوکیناز از باکتری باسیلوس سوبتیلیس RH5 جداشده از خاک‌های مناطق اطراف تهران با موفقیت در وکتور بیانی PTG19-T کلون شد و بیان موفقیت‌آمیز ژن آن نشان داد با گسترش این روش می‌توان در راستای تولید صنعتی این آنزیم مهم گام برداشت.

کلیدواژه‌ها


عنوان مقاله [English]

The Genomic Study of Nattokinase Isolated from Soil Bacilli and its Cloning in Escherichia Coli for Medicinal Use

نویسندگان [English]

  • Mino Asfia 1
  • Kumarss Amini 2
  • Mahsa Kavousi 3
1 department of biology, east tehran branch, islamic azad university, Tehran, iran
2 Department of Microbiology, School of Basic Sciences, Saveh Branch, Islamic Azad University, Saveh, Iran.
3 Department of biology, Faculty of Basic Sciences, East Tehran Branch, Islamic Azad University, Tehran, Iran
چکیده [English]

Abstract
Introduction: Nattokinase is an enzyme extracted from Japanese food produced in the fermentation process. This enzyme has significant positive effects in the treatment of cardiovascular diseases, the treatment or prevention of amyloid diseases such as Alzheimer disease and the reduction of blood cholesterol. This genomic study aimed to investigate the Nattokinase isolated from soil bacilli in areas around Tehran and its cloning in Escherichia coli bacteria for medicinal use.
Materials and methods: In this study, 60 samples were collected from 5-10 cm depth of soil of different areas around Tehran and their Bacillus bacteria were isolated by molecular and biochemical methods. By the PCR method, the bacteria with the Nattokinase gene were identified and the amplified gene was cloned into E. coli and sequenced. The gene expression was then evaluated by Real Time PCR and its phylogenetic relationships were determined.
Results: As a result of screening soil samples sent to the laboratory, a total of 12 suspected colonies were isolated from Gram-positive bacilli which were identified based on morphological, microscopic, and biochemical tests. Then, 11 species was determined as target genes. The cloning and expression of Nattokinase gene were successfully performed and the homology of 99-100% with other enzymes was observed.
Discussion and conclusion: In the present study, the Nattokinase gene from Bacillus subtilis RH5 isolated from soils around Tehran was successfully cloned into PTG19-T expression vector. The successful expression of its gene showed that it could be expanded by this method for industrial production.

کلیدواژه‌ها [English]

  • Key words: Nattokinase
  • Bacillus
  • Cloning

مقدمه.

بیماری‌های قلبی و عروقی نخستین دلیل مرگ در جامعۀ ایرانی به شمار می‌آیند که 50 درصد علل مرگ‌و‌میر را شامل می‌شوند (1). پیشرفت علم موجب دستیابی به نسل جدیدی از داروها و مواد شبه‌دارویی با عوارض کمتر و فواید بیشتر شده است که تولید صنعتی آنزیم‌ها به‌وسیلۀ باکتری‌ها از مهم‌ترین روش‌های آنهاست. پروتئین ناتوکیناز (Nattokinase) با کد اختصاصی 3,4,21,62 EC:، آنزیمی استخراج‌شده از غذایی ژاپنی به نام Natto است که طی فرایند تخمیر این غذا با باکتری باسیلوس ناتو تولید می‌شود؛ برخلاف نام آن که از اسم ژاپنی باکتری باسیلوس سوبتیلیس[1] گرفته شده است، این آنزیم کیناز نیست، بلکه سرین‌پروتئازی از خانوادۀ سوبتیلیسین است که وزن مولکولی آن 28 کیلودالتون و دارای 275 آمینواسید است (2). مطالعه‌ها نشان داده‌اند این آنزیم در رویارویی با خون و لختۀ دارای منشأ انسانی، خواص بسیار قوی ضدانعقادی (فیبرینولیتیک) را بروز می‌دهد که از طریق غیرفعال‌کردن پروتئین مهارگر فعال‌کنندۀ پلاسمینوژن -1 (1PAI-) اتفاق می‌افتد (2 و 3)؛ علاوه‌بر‌این، بررسی‌ها روی انسان و مدل‌های حیوانی نشان داده‌اند این آنزیم قابلیت ازبین‌بردن بیوفیلم‌ها را دارد.امروزه،ناتوکیناز به اشکال دارویی مختلف برای درمان بیماری‌های قلبی عروقی ازجمله بیماری‌های قلبی، فشار خون زیاد، کلسترول زیاد، سکتۀ مغزی، درد قفسۀ سینه (آنژین)، ترومبوز ورید عمقی (DVT)، آترواسکلروز، هموروئید و بیماری شریانی محیطی استفاده می‌شود؛ همچنین مشخص شده است این آنزیم دارای آثار مثبت درخور توجهی در درمان دیابت، درمان یا پیشگیری از بیماری‌های آمیلوئیدی همچون آلزایمر و کاهش کلسترول خون است (4 و 5). .

اطلاعات بسیار کمی دربارۀ این آنزیم تا سال 1987 منتشر شده بود؛ اما پس‌از‌آن، Sumi و همکاران در مطالعه‌ای اثبات کردند ناتوکیناز می‌تواند عامل ضدانعقادی در نظر گرفته شود (6). مهم‌ترین ویژگی آنزیم یادشده این است که به‌شکل مادۀ غیر‌ترکیبی سبب آثار مثبت چندگانۀ دارویی روی بیماری‌های قلبی عروقی می‌شود که در بین تمام داروها و مواد گیاهی منحصر‌به فرد است. امروزه، عوارض داروهای شیمیایی و برتری‌های این آنزیم نسبت به ضدانعقادهای معمول سبب شده است تولید صنعتی این آنزیم با عنوان نسل جدید داروهای پیشگیری و درمان‌کنندۀ بیماری‌های قلبی عروقی مدنظر پژوهشگران قرار گیرد (7 و 8).

Nguyen و همکاران طی مطالعه‌ای در سال 2013 به کلون‌کردن ژن این آنزیم در باسیلوس‌های جدا‌شده از خاک ویتنام پرداختند؛ ناتوکیناز تولید‌شده دارای شباهت 99 درصدی با سایر ناتوکینازهای گزارش‌شده بود و مقادیر پروتئین تولیدی برابر با 600 میلی‌گرم‌بر‌لیتر محیط کشت گزارش شدند (9). Ni و همکاران در مطالعۀ دیگری طی سال 2017، این آنزیم را در باکتری اشریشیا کلی[2] تکثیر و تولید کردند (10)؛ علاوه‌بر‌این، Cui و همکاران تغییراتی به‌منظور بهینه‌سازی ژنتیک تولید این آنزیم به‌شکل ترشحی در باسیلوس سوبتیلیس انجام دادند (11). محمدی[3] و همکاران طی مطالعه‌ای جامع در سال 2018 به تولید خارج‌سلولی آنزیم ناتوکیناز مقاوم ازنظر شیمیایی و دارای پتانسیل زیاد در اشریشیا کلی پرداختند و اعلام کردند روش آنها می‌تواند به تولید آنزیم بیشتر منجر شود (12).

مطالعه‌های بر پایۀ روش کلون‌کردن و انتقال ژن پیشینه‌ای طولانی در فرایند تکثیر سریع و ارزان آنزیم‌های کاربردی به‌منظور تولید صنعتی آنها دارند؛ در این بین، TA-Cloning روشی برای کلون‌کردن محصولات PCR است که از آنزیم‌های محدودالاثر در آن استفاده نمی‌شود و نسبت به روش‌های معمول کلون‌کردن سریع‌تر و ساده‌تر است (13). مطالعۀ حاضر می‌کوشد با یافتن آنزیم دارای کارایی بهتر به شناسایی مولکولی آنزیم ناتوکیناز در باسیلوس‌های بومی ایران بپردازد و با کلون‌کردن آن به روش TA-Cloning در باکتری اشریشیا کلی، گامی در راستای تولید مقرون‌به‌صرفۀ آن و کاهش وابستگی به واردات این آنزیم بردارد.

 

مواد و روش‌ها

جداسازی باکتری: به‌منظور جداسازی باکتری‌های هدف، 60 نمونه از عمق 5 تا 10 سانتی‌متری خاک مناطق مختلف اطراف شهر تهران نمونه‌برداری و به آزمایشگاه منتقل شد. محیط skim milk برای غربال‌گری ریزموجودات دارای فعالیت پروتئولیتیک استفاده و شناسایی باکتری‌های باسیلوس به روش‌های بیوشیمیایی ادامه یافت. پس‌از اینکه باکتری باسیلوس بر اساس ویژگی‌های ظاهری کلنی، ویژگی‌های میکروسکوپی و آزمون‌های بیوشیمیایی تأیید شد، شناسایی مولکولی برای تأیید نهایی گونۀ باسیلوس انجام شد.

شناسایی مولکولی: به‌منظور تمایز باکتری‌های دارای ژن ناتوکیناز از روش‌های مولکولی استفاده شد. استخراج DNA به کمک کیت اختصاصی (QIAamp DNA Mini Kit, Germany) و با‌توجه‌به دستورعمل سازنده انجام شد. پس‌از تأیید کیفیت با دستگاه نانودراپ (اپندورف، آلمان)، آغازگرهای اختصاصی ژن ناتوکیناز با نرم‌افزار Gene runner طراحی و در سایت NCBI بلاست شدند تا اختصاصیت آنها تأیید شود. آغازگرهای استفاده‌شده در مطالعۀ حاضر در جدول 1 دیده می‌شوند. مقادیر مواد PCR برای هر واکنش شامل 10 میکرولیتر PCR Master Mix 2x (Amplicon, USA)، 1 میکرولیتر از هر‌کدام از آغازگرها با غلظت 10 پیکومول‌بر‌میکرولیتر، 4 میکرولیتر از DNA الگو (150 نانوگرم) و 4 میکرولیتر آب مقطر بود. مراحل دمایی واکنش PCR به ترتیب زیر انجام شد: مرحلۀ دناتوراسیون اولیه در دمای 95 درجۀ سانتی‌گراد به‌مدت 5 دقیقه، 35 چرخه شامل دناتوراسیون در 95 درجۀ سانتی‌گراد به‌مدت 30 ثانیه، مرحلۀ اتصال آغازگر در دمای 56 درجۀ سانتی‌گراد به‌مدت 30 ثانیه و مرحلۀ تکثیر در دمای 72 درجۀ سانتی‌گراد به‌مدت 1 دقیقه و پس‌از 35 چرخه، مرحلۀ تکثیر نهایی در دمای 72 درجۀ سانتی‌گراد به‌مدت 10 دقیقه. محصولات PCR در حضور شاهد مثبت و منفی روی ژل آگارز 5/1 درصد الکتروفورز شدند و پس‌از رنگ‌آمیزی با اریتروژل، عکس‌برداری از آنها به کمک دستگاه ژل داک انجام شد.

 

 

جدول 1- آغازگرهای استفاده‌شده در مطالعۀ حاضر

اندازۀ باند (جفت باز)

توالی آغازگر  (5’ to 3’)

آغازگر

255

CGGATCCGTGAGAGGCAAAAAGGTG

Natto F

TGAATTCTTAATGTGCTGCTGCTTGTCC

Natto R

970

AGAGTTTGATCCTGGCTCAG

16s-F

 

AAGGAGGTGATCCAGCCGCA

16s-R

 


کلون‌کردن ژن ناتوکیناز: کیت PCR TA-Cloning شرکت سیناژن برای کلون‌کردن سریع‌تر و مؤثرتر محصول PCR استفاده شد و محصول تکثیرشده طبق دستورعمل کیت در حضور 2 میکرولیتر وکتور PTG19-T، 1 میکرولیتر آنزیم T4 Ligase، 1 میکرولیتر بافر، 5/1 میکرولیتر محصول PCR و 5/4 میکرولیتر آب مقطر استریل به وکتور منتقل (Ligate) شد؛ سپس وکتور به میزبان Escherichia coli XL-1 blue (انستیتو پاستور ایران) ترانسفورم شد. پس‌از سانتریفیوژ باکتری‌ها به‌مدت 10 دقیقه به میزان 10 هزار g، محلول رویی دور ریخته شد و رسوب باکتری همراه با 100 میکرولیتر بافر S موجود در کیت به‌مدت 1 دقیقه در در 12000 دوردردقیقه سانتریفیوژ و دوباره با استفاده از پیپت با بافر مخلوط شد. مقدار 100 میکرولیتر از محلول حاصل به محلول Ligation اضافه و به‌مدت 30 دقیقه در یخ قرار داده شد. مقدار 400 میکرولیتر از محیط‌کشت LB مایع همراه با محلول یادشده در حضور آمپی‌سیلین و 20 میلی‌گرم‌درمیلی‌لیتر X-Gal به‌مدت یک ساعت در 37 درجۀ سانتی‌گراد انکوبه و سپس در 650 دوردردقیقه سانتریفیوژ شد. پس‌از دور‌ریختن محلول رویی، رسوب باکتری روی پلیت LB مایع کشت و به‌مدت 24 تا 48 ساعت در 37 درجۀ سانتی‌گراد انکوبه شد. کلون‌کردن ژنی با غربال‌گری کلنی‌های سفید (حاوی ژن نوترکیب) و کلنی‌های آبی با اتصال (Ligation) ناموفق و ژن غیرنوترکیب تأیید و توالی یادشده برای توالی‌یابی به آزمایشگاه Bioneer فرستاده شد.

.تعیین میزان بیان ژن ناتوکیناز به روش Real time PCR: پیش از بررسی میزان بیان ژن با Real time PCR، باکتری نوترکیب انکوبه شد. پس‌از 15 ساعت انکوبه‌گذاری (Late log phase)، استخراج RNA به کمک کیت اختصاصی (QIAamp RNA Mini Kit, Germany) و با‌توجه‌به دستورعمل آن انجام شد. پس‌از تأیید کیفیت RNA استخراج‌شده با دستگاه نانودراپ، سنتز cDNA با استفاده از آنزیم Reverse AMV با غلظت 25 میکرولیتربرواحد به کمک کیت اختصاصی آن (Roche, Germany) انجام شد. واکنش PCR در حجم 20 میکرولیتر با استفاده از کیت شرکت (Genet bio CAT. NO: Q9210) کرۀ جنوبی به ‌ترتیب زیر انجام شد: 10 میکرولیتر از Prime Qmaster mix (2x) with Syber green، 5 میکرولیتر از Depc water، 1 میکرولیتر از آغازگر رفت، 1 میکرولیتر از آغازگر برگشت، 1 میکرولیتر از Rox dyeو2 میکرولیتر از cDNA استفاده شد. تکثیر قطعه‌های مدنظر در دستگاه Corbet (Corbet, Australia) با برنامۀ دناتوراسیون اولیه در 95 درجۀ سانتی‌گراد به‌مدت 1 دقیقه و تکثیر شامل 95 درجۀ سانتی‌گراد برای مدت 30 ثانیه، 59 درجۀ سانتی‌گراد برای مدت 40 ثانیه و 72 درجۀ سانتی‌گراد برای مدت 60 ثانیه در 35 چرخه انجام شد. ژن خانگی بتا اکتین برای کنترل داخلی آزمون استفاده شد.

رسم درخت فیلوژنتیکی: نتایج توالی‌یابی توالی‌های به‌دست‌آمده با نرم‌افزار Bio Edit بررسی شدند. پس‌از اطمینان از درستی توالی‌هـای بـه‌دسـت‌آمـده، رشتة واحدی (از'5 به '3) از دو رشتۀ توالی‌یابی‌شدة مسـتقیم و معکـوس با نـرم‌‌ا‌فـزار DNA Baser مرتب شد. تـوالی‌هـای حاصـل بـا جدایه‌های ثبت‌شده در NCBI مقایسه شـدند. هـر تـوالی بـه‌طـور جداگانـه با نـرم‌افـزار n Blast در بانـک ژن جسـتجو شـد و توالی‌های حاصل از بلاست با نرم‌افزار W Clustal هم‌ردیـف شدند. تجزیه‌و‌تحلیل فیلوژنتیکی پس‌از هم‌ردیف‌کردن توالی‌ها با نرم‌افزار W Clustal انجام شد و درخت‌های فیلوژنتیکی بـا برنامۀ MEGA 7 ترسـیم شدند. به‌منظور ترسیم هیستوگرام مربـوط بـه نمـایش فواصـل درون‌گونه‌ای، نمودار مربوطه پس‌از تعیین فواصـل نوکلئوتیـدی بـه‌دسـت‌آمـده بـا نرم‌افزار Excel رسم شد.

 

نتایج

نتایج جداسازی باکتری: در‌نتیجۀ غربال‌گری 15 نمونه خاک ارسالی به آزمایشگاه، درمجموع 12 کلنی مشکوک به باسیل‌های گرم مثبت جداسازی و بر اساس ویژگی‌های ریخت‌شناختی، میکروسکوپی و آزمون‌های بیوشیمیایی تعیین هویت شدند. در مطالعۀ حاضر، باسیل‌های گرم مثبت، MR-VP، سیمون‌سیترات، کاتالاز، TSI مثبت و آزمون‌های احیای نیترات، ایندول، اوره‌آز و اکسیداز منفی با عنوان باسیلوس در نظر گرفته شدند و برای شناسایی مولکولی انتخاب شدند.

نتیجۀ آزمون PCR به‌منظور شناسایی باکتری‌های دارای ژن هدف: واکنش PCR برای ژن‌های ناتوکیناز با آغازگرهای یادشده انجام شد. تعداد 11 سویه از 12 سویه باسیلوس جداشده دارای ژن ناتوکیناز بودند (شکل 1). به‌منظور تعیین هویت مولکولی جنس باسیلوس حامل ژن ناتوکیناز از آغازگرهای عمومی 16s استفاده شد (شکل 2).

 

 

 

شکل 1- نتیجۀ آزمون PCR به‌منظور شناسایی ژن آنزیم ناتوکیناز؛ M: ladder, +: Positive Control, -: Negative control و 1 تا 12: شمارۀ نمونه‌ها

 

 

شکل 2- نتیجۀ آزمون PCR با آغازگرهای عمومی 16s به‌منظور تعیین هویت مولکولی جنس باسیلوس


نتایج کلون‌کردن و بیان ژن ناتوکیناز: پس‌از کلون‌کردن سویۀ حامل ژن ناتوکیناز در فرایند انتخاب کلنی (آبی/سفید)، سویه‌های کلون‌شده جداسازی شدند (شکل 3)؛ در این حالت، چنانچه ژن هدف وارد وکتور شده باشد، ژن Lacz تخریب می‌شود و درنتیجه، باکتری نمی‌تواند از X-gal استفاده کند و کلنی‌های سفید در محیط‌کشت تشکیل می‌شوند؛ بنابراین کلنی‌های سفید، باکتری‌هایی با DNA نوترکیب هستند.

به‌منظور تأیید نتایج کلون، DNA از کلنی‌های مشکوک استخراج و ورود ژن‌های ناتوکیناز به باکتریEscherichia coli XL-1 blueبا آزمون PCRو از طریق توالی‌یابی محصول PCR تأیید شد (شکل 4)؛ درنهایت، محصول PCR برای توالی‌یابی به شرکت Bioneer ارسال و بلاست شد (شکل 5). بیان ژن یادشده به‌شکل موفقیت‌آمیز با Real time PCR سنجیده و مشخص شد ژن ناتوکیناز در باکتری میزبان بیان می‌شود (شکل 6).

نتایج درخت فیلوژنتیکی: ‌پس‌از توالی‌یابی، بررسی فیلوژنتیکی به روش پیوند هم‌جوار (Neighbor Joining) انجام شد و نتایج آن نشـان دادند سویه‌هـایباسیلوس سوبتیلیس بــا بـوت اسـترپ 40 درصد با کلستریدیوم[4] در یک کلاد (خوشــه) قرار می‌گیرند که بیان‌کنندۀ رابطۀ خویشاوندی نزدیک آنها با‌هم است (شکل 7). داده‌ها نشان دادند یکی از باکتری‌های دارای ژن هدف با بیشترین بیان ژن ناتوکیناز در مطالعۀ حاضر، باسیلوس سوبتیلیس RH5 شناسایی شد.

 

 

شکل 3- نتایج کلون ژن آنزیم ناتوکیناز؛ کلنی‌های سفید حاوی ژن نوترکیب هستند.

 

 

شکل 4- الکتروفورز برای تأیید کلون‌کردن به‌وسیلۀ PCR با آغازگرهای M13 وکتور

 

 

شکل 5- نمونه نتایج توالی‌یابی ژن ناتوکیناز

 

 

شکل 6- منحنی بیان ژن ناتوکیناز در باکتری میزبان در تکرارهای مختلف آزمون Real time PCR

 

 

شکل 7- درخت فیلوژنتیکی رسم‌شده بر اساس توالی ژن 16S rDNA


بحث

بیماری‌های قلبی عروقی نخستین علت مرگ در جوامع پیشرفته و جهان سوم به شمار می‌آیند؛ از‌این‌رو، رویکرد دارویی نسبت به پیشگیری و درمان آنها از طریق داروهای با عوارض کمتر از اولویت‌های سازمان جهانی بهداشت است (14 و 15). با‌توجه‌به مزیت‌های تولید پروتئین‌های ضروری از طریق عوامل باکتریایی، جداسازی آنزیم‌های راهبردی در صنایع دارویی و غذایی از مهم‌ترین زمینه‌های پژوهشی دانشمندان طی سال‌های اخیر است. آنزیم ناتوکیناز طی فرایند تخمیر سویا در غذایی ژاپنی تولید می‌شود و مطالعه‌های مختلف اثبات کرده‌اند آثار بسیار مؤثر ضدانعقادی و ضدبیوفیلمی دارد (10 و 16). این آنزیماز منابع محدودی ازجمله باسیلوس‌ها استخراج می‌شود؛ بنابراین، نیاز به تکثیر ژن این آنزیم در منابع باکتریایی تولیدکنندۀ آن اهمیت ویژه‌ای دارد (10). در مطالعه‌های مختلف، این آنزیم از باکتری‌های باسیلوس ساپروفیت موجود در خاک مناطق مختلف جهان جداسازی شده است (17). با‌توجه‌به تغییرات ویژگی‌های آنزیمی و اهمیت ژنتیکی سویه‌های بومی از این نظر، مطالعۀ حاضر به جداسازی ژن ناتوکیناز از باسیلوس‌های جداشده از خاک مناطق اطراف تهران و کلون‌کردن آن پرداخت. Li Min و همکاران در مطالعه‌ای به کلون‌کردن ژن ناتوکیناز و بیان آن در Escherichia coli BL21 (DE3) پرداختند و نتایج آنها نشان دادند ژن یادشده در باکتری ترانسفورم‌شده بیان می‌شود. قاسمی[v] و همکاران نیز طی مطالعۀ مشابهی در ایران، تولید سوبتیلیسین مشابه با سایر ناتوکینازها را گزارش کردند. در مطالعه‌های یادشده از روش‌های سنتی کلون‌کردن ژن استفاده شده است (18 و 19). مطالعۀ حاضر در تأیید امکان بیان ژن هدف در اشریشیا کلی نشان داد روش TA-Cloning می‌تواند روش مناسبی برای کلون‌کردن این ژن باشد. توالی‌یابی ژنوم نوترکیب به‌ترتیب مشابهت 100 درصدی، 91/99 درصدی و 78/99 درصدی را با سوبتیلیسین NAT، E و J جداسازی‌شده از باسیلوس سوبتیلیس در مطالعه‌های پیشین نشان داد.

Weng و همکاران در سال 2017 طی مطالعه‌ای در زمینۀ کلون‌کردن و تولید صنعتی ناتوکیناز اثبات کردند روش کلون‌کردن، رویکرد امیدوار‌کننده‌ای برای تولید ناتوکیناز با خلوص زیاد برای استفاده از آن در برنامه‌های ضدانعقادی است؛ این بررسی، سود، امنیت و تولید ناتوکیناز را نیز اثبات کرد (20) که در راستای پژوهش حاضر است.

 

نتیجه‌گیری

در مطالعۀ حاضر، ژن ناتوکیناز از باکتری باسیلوس سوبتیلیس RH5 جداشده از خاک‌های مناطق اطراف تهران با موفقیت در وکتور بیانی PTG19-T کلون شد و بیان ژن آن نشان داد با گسترش این روش می‌توان گام مهمی در راستای تولید صنعتی این آنزیم مهم برداشت.

References
(1)              Ritchey MD., Wall HK., Owens PL., Wright JS. Vital signs: State-level variation in nonfatal and fatal cardiovascular events targeted for prevention by Million Hearts 2022. Morbidity and Mortality Weekly Report 2018; 67(35): 974.
(2)              Selvarajan E., Bhatnagar N. Nattokinase: an updated critical review on challenges and perspectives. Cardiovascular and Hematological Agents in Medicinal Chemistry (Formerly Current Medicinal Chemistry-Cardiovascular and Hematological Agents) 2017; 15(2): 128-35.
 
(3)              Kurosawa Y., Nirengi S., Homma T., Esaki K., Ohta M., Clark JF., et al. A single-dose of oral nattokinase potentiates thrombolysis and anti-coagulation profiles.Scientific Reports 2015; 5: 11601.
(4)              Yan Y., Wang Y., Qian J., Wu S., Ji Y., Liu Y., et al. Nattokinase crude extract inhibits hepatocellular carcinoma growth in Mice. Journal of Microbiology and Biotechnology 2019; 29(8): 1281-1287.
(5)              Chen H., McGowan EM., Ren N., Lal S., Nassif N., Shad-Kaneez F., et al. Nattokinase: A promising alternative in prevention and treatment of cardiovascular diseases. Biomarker Insights 2018; 13: 1177.
(6)              Sumi H., Hamada H., Tsushima H., Mihara H., Muraki H. A novel fibrinolytic enzyme (nattokinase) in the vegetable cheese Natto; a typical and popular soybean food in the Japanese diet. Experientia 1987; 43(10): 1110-1111.
(7)              Jensen GS., Lenninger M., Ero MP., Benson KF. Consumption of nattokinase is associated with reduced blood pressure and von Willebrand factor, a cardiovascular risk marker: results from a randomized, double-blind, placebo-controlled, multicenter North American clinical trial. Integrated Blood Pressure Control 2016; 9: 95.
(8)              Pan X., Liang P., Teng L., Ren Y., Peng J., Liu W., et al. Study on molecular mechanisms of nattokinase in pharmacological action based on label‐free liquid chromatography–tandem mass spectrometry. Food science and Nutrition 2019; 7(10): 3185-3193.
(9)              Nguyen TT., Quyen TD., Le HT. Cloning and enhancing production of a detergent-and organic-solvent-resistant nattokinase from Bacillus subtilis VTCC-DVN-12-01 by using an eight-protease-gene-deficient Bacillus subtilis WB800. Microbial Cell Factories 2013; 12(1): 79.
(10)          Ni H., Guo P-C., Jiang W-L., Fan X-M., Luo X-Y., Li H-H. Expression of nattokinase in Escherichia coli and renaturation of its inclusion body. Journal of Biotechnology 2016; 231: 65-71.
(11)          Cui W., Suo F., Cheng J., Han L., Hao W., Guo J., et al. Stepwise modifications of genetic parts reinforce the secretory production of nattokinase in Bacillus subtilis. Microbial Biotechnology 2018; 11(5): 930-942.
(12)          Mohammadi F., Nezafat N., Berenjian A., Negahdaripour M., Zamani M., Ghoshoon MB., et al. Extracellular production of a potent and chemically resistant nattokinase in immobilized Escherichia coli using response surface methodology. Current Pharmaceutical Biotechnology 2018; 19(11): 856-868..
(13)          Motohashi K. A novel series of high-efficiency vectors for TA cloning and blunt-end cloning of PCR products. Scientific Reports 2019; 9(1): 6417.
(14)          Roth GA., Johnson CO., Abate KH., Abd-Allah F., Ahmed M., Alam K., et al. The burden of cardiovascular diseases among US states, 1990-2016. JAMA Cardiology 2018; 3(5): 375-389.
(15)          McNeil JJ., Wolfe R., Woods RL., Tonkin AM., Donnan GA., Nelson MR., et al. Effect of aspirin on cardiovascular events and bleeding in the healthy elderly. The New England Journal of Medicine 2018; 379(16): 1509-1518.
(16)          Wu S-M., Feng C., Zhong J., Huan L-D. Enhanced production of recombinant nattokinase in Bacillus subtilis by promoter optimization. World Journal of Microbiology and Biotechnology 2011; 27(1): 99-106.
(17)          Tan H., Zhang G., Xu M., ZHANG H-w. Cloning, expression of the nattokinase gene and the activity assay. Science and Technology of Food Industry 2012; 33(18): 195-198.
(18)          Li M., Chen L., Zhang C., Zeng X., Liu F., Chen S., et al. Cloning and expression of nattokinase gene in Escherichia coli. Acta Agriculturae Jiangxi 2012; 24(12): 144-146.
(19)          Ghasemi Y., Dabbagh F., Ghasemian A. Cloning of a fibrinolytic enzyme (subtilisin) gene from Bacillus subtilis in Escherichia coli. Molecular Biotechnology 2012; 52(1): 1-7.
(20)          Weng Y., Yao J., Sparks S., Wang KY. Nattokinase: An oral antithrombotic agent for the prevention of cardiovascular disease. International Journal of Molecular Sciences 2017; 18 (3): 523.