بررسی تنوع ژنتیکی باکتری‏های فراریشه‎ای و درون‎رست محرک رشد گیاه گندم

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 استاد بیولـوژی و بیوتـکنولـوژی خاک، پردیس کشاورزی و منابع طبیعی دانشـــگاه تهـران، کرج-ایـــران

2 دانش آموخته دکتری بیولوژی و بیوتکنولوژی، پردیس کشاورزی و منابع طبیعی، دانشگاه تهران، تهران، ایران

10.22108/bjm.2020.120071.1236

چکیده

چکیده
مقدمه: جامعۀ میکروبی خاک بر حاصلخیزی آن از طریق تجزیه، معدنی‌کردن، ذخیره‌سازی و رهاسازی عناصر غذایی ‌تأثیر می‌گذارد. باتوجه‌به آزادسازی حدود 20 تا 30 درصد مواد فتوسنتزی در فراریشۀ (ریزوسفر‏) گیاه، این محیط شرایط مساعدی را برای حضور جمعیت میکروبی فراهم می‌کند.
مواد و روش‏‏ها: هدف پژوهش حاضر، بررسی پتانسیل جدایه‏های فراریشه‏ای و درون‏رست جداسازی‌شده از گیاه گندم به‌منظور بررسی ویژگی‌های محرک رشد و شناسایی توالی  16S rRNAآنهاست؛ به این منظور، ابتدا باکتری‎ها ازنظر تولید هورمون اکسین در محیط‌کشت حاوی ال- تریپتوفان غربال‎گری شدند و سپس توانایی آنها در انحلال فسفات‌های معدنی و آلی نامحلول ارزیابی شد. در ادامۀ پژوهش، سایر مؤلفه‌های محرک رشد گیاه ازجمله توان تولید سیدروفور و آنزیم ACC- دآمیناز بررسی شدند.
نتایج: از میان جدایه‏های به‌دست‌آمده از فراریشه و درون‌ریشه، تعداد 15 جدایۀ فراریشه‏ای و تعداد 7 جدایۀ درون‎رست بر اساس توانایی آنها در ایجاد ویژگی‌های محرک رشدی انتخاب شدند. درمجموع، 7 جدایه به Bacillus، 4 جدایه به Pseudomonas، 2 جدایه به Staphylococcus، 2 جدایه به Paenibacillus و سایر جدایه‌ها به جنس‎های Sphingobacterium، Lysinibacillus، Advenella، Enterobacter، Variovorax و Plantibacter تعلق داشتند.
بحث و نتیجه‏گیری: باتوجه‌به نتایج، جنس‏های غالب در میان جدایه‎های فراریشه‏ای و درون‏رست محرک رشد گیاه گندم از نوع Pseudomonas و Bacillus بودند. افزایش عملکرد از طریق افزایش زیست‌‌فراهمی عناصر غذایی درنتیجۀ تولید سیدروفور، انحلال فسفات‌های نامحلول آلی و معدنی، تولید عوامل رشد و تولید هورمون‌های محرک رشد گیاهان به‌ویژه ایندول-3- استیک‌اسید است که موجب افزایش شاخص‌های رشد و عملکرد محصول ‌می‌شود و حفظ سلامت محیط‌زیست و گیاه را در پی دارد.

کلیدواژه‌ها


عنوان مقاله [English]

Investigating the Genetic Diversity of Wheat Growth Promoting Rhizosphere and Endophytic Bacteria

نویسندگان [English]

  • Hossein Ali Alikhani 1
  • Somayeh Emami 2
1 Soli Science and Engineering, College of Agriculture & Natural Resources, University of Tehran. Karaj-Iran
2 PhD. Department of soil science, College of agriculture and natural resource, University of Tehran
چکیده [English]

Abstract
Introduction: The soil microbial community affects its fertility through the decomposition, mineralization, storage, and release of nutrients. Given the release of about 20-30% of photosynthetic materials in the rhizosphere, this environment has provided favorable conditions for the presence of microbial populations.
Materials and methods: The aim of this study was to investigate the potential of rhizosphere and endophytic bacterial isolates isolated from the roots of wheat plant in terms of plant growth promoting (PGP) traits to identify their 16S rRNA sequences. To this end, the isolated bacteria were first screened for the production of indole-3-acetic acid (IAA) in the presence of tryptophan in the culture medium, and then they were tested for their ability to dissolve inorganic and organic phosphates. In the next step, other growth promoting factors including siderophore production and ACC-deaminase were investigated.
Results: Among the isolates obtained from rhizosphere and intra-root of wheats, 15 rhizosphere and 7 endophyte isolates were selected based on their ability to induce growth promoting properties. A total of 7 isolates belonged to the Bacillus, 4 isolates to Pseudomonas, 2 isolates to Staphylococcus, 2 isolates to Paenibacillus, and the rest belonged to the genera Sphingobacterium, Lysinibacillus, Advenella, Enterobacter, Variovorax, and Plantibacter.
Discussion and conclusion: According to the obtained results, the dominant genera among the rhizosphere and endophyte isolates were Pseudomonas and Bacillus. Increased yield through increased nutrient bioavailability is the result of siderophore production, dissolution of insoluble inorganic and mineral phosphates, the production of growth factors and plant growth hormones, especially indole acetic acid, which can increase crop growth indices and yield. It also has to protect the environment and the plant.

کلیدواژه‌ها [English]

  • Key words: Rhizospheric and Endophyte Bacteria
  • Wheat
  • Biofertilizer
  • Plant Growth Promoting Traits

مقدمه

فراریشه[1] محل زندگی طیف متنوعی از ریزسازواره‏ها و به‌ویژه باکتری‌هاست که ممکن است برای رشد گیاه مفید، مضر یا بی‌تأثیر باشند. باکتری‌های مفید این منطقه به ریزوباکتری‌های محرک رشد گیاه[2] موسومند که توجه بسیاری از پژوهشگران را به خود جلب کرده‎اند؛ این باکتری‌ها با استفاده از یک یا چند سازوکار خاص سبب بهبود رشد گیاه می‌شوند. جوامع میکروبی این منطقه تفاوت بسیار زیادی ازنظر کمّی و کیفی با جوامع میکروبی تودۀ خاک دارند. این باکتری‌ها در طیف وسیعی از گیاهان زراعی به‌منظور افزایش رشد از طریق افزایش دانه در گیاه، وزن کل اندام‌های گیاهی، عملکرد و کنترل بیماری‌ها استفاده می‌شوند. استفاده از ریزوباکتری‌های محرک رشد در کشاورزی درحال افزایش است و روش مناسبی را برای جایگزینی یا مکمل کودهای شیمیایی و آفت‌کش‌ها در راستای جلوگیری از آلودگی‌های زیست‌محیطی ارائه می‌کند (1).

ساز‎وکارهایی که باکتری‌های محرک رشد از طریق آنها بر رشد گیاه تأثیر می‌گذارند، به آثار مستقیم و غیرمستقیم تقسیم می‌شوند (2): اثر غیرمستقیم بیشتر از طریق تولید متابولیت‏های میکروبی ازجمله آنتی‌بیوتیک‌ها، سیدروفورها، آنزیم‏ها، سیانیدهیدروژن[3] و ... است که اثر منفی بر عوامل بیماری‌زا دارند و با ممانعت از رشد ریزسازواره‏های بیماری‌زا سبب افزایش رشد گیاه می‌شوند؛ اما اثر مستقیم آنها از راه تولید هورمون‌های گیاهی، تسهیل جذب عناصر غذایی، تثبیت نیتروژن مولکولی، کاهش پتانسیل غشای ریشه‌ها، سنتز برخی آنزیم‌ها ازجمله ACC- دآمیناز[4] که آثار سوء اتیلن تنشی در گیاه را تعدیل می‌کنند و همچنین، انحلال فسفات معدنی و آلی به‌شکل قابل‌استفاده برای گیاهان است (3).

گزارش‌های متفاوتی به توانایی گونه‌های مختلف باکتری در ایجاد ویژگی‌های محرک رشد اشاره کرده‏اند و در بین باکتری‌های دارای این قابلیت، جنس‌های Pseudomonas، Bacillus، Rhizobium، Burkholderia، Agrobacterium، Pantoea، Achromobacter و Flavobacterium مشاهده می‌شوند (3 و 4). رابطۀ گیاهان و باکتری‌های محرک رشد، رابطه‌ای هم‌افزایی یا تشدیدشونده در طبیعت شناخته می‌شود؛ زیرا از یک سو، باکتری شکلِ قابل‌جذب عناصر را برای گیاه فراهم می‌کند و از سوی دیگر، گیاه ترکیبات کربنۀ لازم برای رشد باکتری را از طریق ترشحات ریشۀ خود آزاد می‌کند. ازآنجاکه ریشه عناصر غذایی ضروری گیاه را از خاک جذب می‌کند، توسعۀ سیستم ریشه پیش‌نیاز افزایش رشد و نمو گیاه به‌ شمار می‌آید؛ تعداد زیادی از باکتری‌های محرک رشد گیاه از طریق تولید هورمون‌های گیاهی سبب افزایش رشد ریشۀ گیاه می‌شوند (5). اگر تحریک حداکثری رشد ریشۀ گیاه از طریق باکتری‌های محرک رشد گیاه در مزارع انجام شود، باکتری‌های محرک رشد گیاه می‌توانند روش‌های سودمندی برای افزایش جذب عناصر غذایی باشند (6)؛ ازاین‌رو، باکتری‏های مولد اکسین‏های ایندولی از طریق افزایش رشد طولی ریشه‏ها و گسترش سیستم ریشه‏ای گیاه گندم می‌توانند سطح تماس ریشۀ گیاه با ماتریکس خاک و درنهایت، سطح جذب عناصر غذایی را به‌‌گونه‌ای افزایش دهند که بتوان از آنها در افزایش بهره‏وری کودهای شیمیایی (در خاک‏های نسبتاً حاصلخیز) یا حداقل مکمل کودهای شیمیایی (در خاک‏های فقیر) استفاده کرد.

علاوه‌بر باکتری‌های فراریشه‎ای محرک رشد گیاه، باکتری‌هایی از این نوع وجود دارند که به‌طور اختصاصی به بخش‌ درونی گیاه ازجمله بذر، ریشه، میوه و ساقه نفوذ می‌کنند و در این مکان‌ها مستقر می‌شوند؛ این ریزسازواره‏ها به‌‌طور معمول آنزیم‌های حل‌کنندۀ دیوارۀ سلولی برای نفوذ در این اندام‌ها را دارند (7). جمعیت باکتری‌های درون‏رست[5] ریشه بیشتر از جمعیت آنها در سایر اندام‌های گیاه (ساقه، برگ و ...) است و به‌طور میانگین، جمعیت این باکتری‌ها برای ریشۀ گیاهان مختلف حدود 105 واحد تشکیل‌دهندۀ کلنی (CFU) در گرم خاک برآورد شده است (8).

فراریشۀ گیاه منبع اولیۀ باکتری‌های درون‏رست است؛ به عبارتی، بیشتر باکتری‌های درون‏رست از فراریشه منشأ می‌گیرند و بنابراین، تسلسلی از ریزسازواره‏های همراه با ریشۀ گیاه از فراریشه به محیط اطراف ریشه (ریزوپلن) و از محیط اطراف ریشه به اپیدرم و پوست وجود دارد؛ این پیوستگی از آندودرم به آوندهای چوبی ریشه و از آوندهای چوبی ریشه به آوندهای چوبی ساقه نیز وجود دارد (7) و بنابراین، ترکیب جمعیتی درون‌رست‌ها به ترکیب جمعیتی باکتری‌های مستقر در فراریشۀ گیاه بستگی دارد. معمولاً جمعیت بیشتری از باکتری‌ها در فراریشه نسبت به درون‌رست‌ها وجود دارد و این باکتری‌های درون‏رستی موجب افزایش مقاومت سیستمیک در برابر بیماری‌های گیاهی یا افزایش رشد گیاه می‌شوند. اگرچه ویژگی‌های محرک رشدی بین باکتری‌های فراریشه و درون‏رست ممکن است مشابه باشند، بیشتر پژوهش‌ها در زمینۀ باکتری‌های فراریشه نسبت به درون‌رست انجام شده‌اند (9). با نگاه به توانایی باکتری‏های درون‏رست در بهبود و افزایش رشد گیاه و نیز نبود آگاهی‏های کافی از فراوانی این باکتری‏ها در گیاه گندم، انجام پژوهش در این زمینه ضروری به نظر می‏رسد.

مواد و روشها.

.جداسازی باکتری‌های فراریشهای و درون‌رست ریشۀ گیاه گندم: به‌منظور جداسازی باکتری‎های فراریشه‎ای و درون‎رست محرک رشد گیاه گندم در پژوهش حاضر، نمونه‌برداری از خاک فراریشۀ‎ گندم مزرعۀ دانشکدۀ کشاورزی و منابع طبیعی دانشگاه تهران واقع در محمدشهر کرج انجام شد. تعداد 8 نمونه از گیاهان سالم گندم در مرحلۀ رشد رویشی (مرحلۀ گرده‎افشانی) به‌طور تصادفی از موقعیت‎های مختلف مزرعه جمع‎آوری و در کیسه‏های پلاستیکی به آزمایشگاه انتقال یافتند تا برای جداسازی و خالص‎سازی باکتری‎ها استفاده شوند. به‌منظور جداسازی باکتری‎های درون‌رست ریشه، ابتدا ریشه‎ها کاملاً با آب معمولی شستشو شدند و سپس عمل شستشو چندین بار با آب مقطر تکرار شد تا تمام ذرات خاک باقیمانده از سطح ریشه‎ها حذف شوند؛ درنهایت، ریشه‎ها روی دستمال کاغذی استریل گذاشته شدند تا رطوبت اضافی آنها حذف شود و در ادامه، ریشه‎ها با تیغ به قطعه‌های 2 تا 3 سانتی‏متری استریل بریده شدند. ریشه‎ها با الکل و هیپوکلریت‌سدیم ضد‌عفونی سطحی شدند و سپس به‌منظور حذف هیپوکلریت‌سدیم، ریشه‏ها ده بار با آب مقطر استریل شستشو شدند؛ در تمام مراحل، شرایط استریل حفظ شد. به‌منظور اطمینان‌یافتن از درستی عملیات ضدعفونی سطحی ریشه‎ها، قطعه‌هایی از ریشۀ استریل‌شده روی سطح پلیت‎های حاوی محیط‌کشت نوترینت‌آگار گذاشته شدند و حدود دو قطره از آب شستشوی نهایی نیز روی این ظرف‌های پتری پخش شد و ظرف‌ها به‌مدت 5 روز درون انکوباتور با دمای 28 درجۀ سانتی‌گراد گذاشته شدند. قطعه‌های ریشه به‌مدت 10 دقیقه با هاون استریل در محلول سرم فیزیولوژی (سدیم‌کلرید 85/0 درصد) خرد و له شدند و سپس تمام محتویات خردشده به ارلن حاوی 90 میلی‏لیتر محلول سرم فیزیولوژی استریل منتقل و به‌مدت 45 دقیقه روی شیکر گذاشته شد. پس‌از تهیۀ رقت‎های ده‌دهی از نمونه، 1/0 میلی‎لیتر از هریک از رقت‎های 2-10 تا 7-10 روی پلیت‎های حاوی محیط‌کشت پخش شد. به‌منظور جداسازی باکتری‏های فراریشه‎ای، 10 گرم خاک فراریشه‌ای به ارلن‎های حاوی 90 میلی‎لیتر محلول سرم فیزیولوژی استریل منتقل و به‌مدت 30 دقیقه روی شیکر گذاشته شد. تهیۀ سری‏های رقت برای خاک فراریشه مشابه با سری‎های رقت ریشه‎ها انجام شد (10). پلیت‏های تلقیح‌شده به‌مدت 3 تا 5 روز به‌طور واژگون در دمای 28 درجۀ سانتی‌گراد درون انکوباتور گرماگذاری شدند؛ سپس کلنی‎های ظاهرشده روی ظرف‌های پتری جداسازی و مراحل خالص‎سازی این جدایه‎ها پس‌از کشت دوباره روی همان محیط از طریق بازکشت انجام شدند.

.غربال‏گری جدایه‏ها ازنظر فعالیتهای محرک رشد گیاه: جدایه‏های فراریشه‏ای و درون‎رستی جداسازی‌شده از گیاه گندم به‌منظور تعیین ویژگی‌های محرک رشد گیاه ارزیابی شدند. اندازه‌گیری کمّی تولید ایندول‌استیک‌اسید (اکسین) به روش بریک[6] و همکاران (1991) در محیط‌کشت مایع رنگی در‌نتیجۀ استفاده از محلول سالکوفسکی و با خواندن عدد دستگاه اسپکتروفتومتر انجام شد (11). به‌منظور انجام این آزمون، مقدار 20 میلی‎لیتر محیط‌کشت مایع نوترینت‌براث حاوی 1 میلی‎گرم‌بر‌میلی‎لیتر ال- تریپتوفان درون هر ارلن ریخته شد و پس‌از استریل‌کردن آن، محتوای هر ارلن با یکی از جدایه‎های مدنظر تلقیح شد. ارلن‎های یادشده با ورقۀ آلومینیومی پوشانده شدند و به‌مدت 72 ساعت برای باکتری‎های تندرشد و تا 120 ساعت (برای انواع کندرشد) در دمای 30 درجۀ سانتی‌گراد روی شیکر با سرعت چرخش 120 دوردردقیقه گرماگذاری شدند. پس‌از گذشت این مدت، سوسپانسیون‎های یادشده سانتریفیوژ شدند و سپس محلول رویی به نسبت 1:1 با معرف سالکوفسکی مخلوط و محلول حاصل به‌مدت 20 دقیقه در دمای اتاق نگهداری و سپس میزان جذب نور در طول موج 530 نانومتر با اسپکتروفتومتر خوانده شد. مقدار تولید اکسین هر جدایه از مقایسۀ جذب نور آن با منحنی استاندارد تهیه‌شده از غلظت‎های صفر تا 100 میکروگرم‌بر‌میلی‎لیتر محاسبه شد.

در مرحلۀ بعد، محیط‌کشت اسپربر[7] (1958) شامل 10 گرم‌در‌لیتر گلوکز، 5/0 گرم‌در‌لیتر عصارۀ مخمر، 32/0 گرم‌در‌لیتر سولفات‌منیزیم، 14/0 گرم‌در‌لیتر کلرید‌کلسیم، 5/2 گرم‌در‌لیتر تری‏کلسیم‌فسفات، 1000 میلی‎لیتر آب مقطر و اسیدیتۀ 2/7 برای بررسی توان جدایه‎های فراریشه‏ای و درون‎رستی در انحلال فسفات‎های معدنی نامحلول استفاده شد (12). ابتدا باکتری‎ها به‌مدت 48 ساعت در محیط نوترینتبراث کشت شدند. به‌منظور تشخیص نیمه‌کمّی توان حل فسفات، 7 میکرولیتر از سوسپانسیون تازۀ باکتری به روش قطره‎گذاری[8] روی ظرف‌های پتری حاوی محیط جامد اسپربر کشت شد و ظرف‌های پتری تلقیح‌شده در دمای 28 درجۀ سانتی‌گراد نگهداری شدند. ایجاد هالۀ شفاف پیرامون کلنی باکتری نشانۀ حل فسفات در نظر گرفته شد. قطر کلنی رشدیافته و قطر هالۀ شفاف حاصل از انحلال فسفات در اطراف هر کلنی به‌دقت اندازه‎گیری شد. (12). توان انحلال فسفات‌های نامحلول آلی با استفاده از محیط‌کشت اصلاح‌شدۀ اسپربر تعیین شد که در آن به‌‌جای ترکیب شیمیایی ‌تری‎کلسیم فسفات از منبعی آلی به نام اینوزیتول‌هگزا‌فسفات استفاده شد. به‌منظور انجام آزمون کمّی انحلال فسفات‎های معدنی نامحلول از محیط‌کشت اسپربر مایع استفاده شد. پس‌از یکسان‌کردن جمعیت باکتری‌ها در محیط مایع نوترینت‌براث، 50 میکرولیتر از سوسپانسیون هـر باکتری به 25 میلی‌لیتر محیط اسپربر مایع منتقل شد و سپس نمونه‌های مایع به‌مدت 120 سـاعت روی شیکر انکوباتور (120 دوردردقیقه) قرار داده شدند؛ در مرحلۀ بعد، اسیدیتۀ نمونه‌ها تعیین و بی‌درنگ سوسپانسیون باکتری‌ها بـه‌مـدت 10 دقیقـه در 15000 دوردردقیقه سـانتریفیوژ شد و سپس 1 میلی‌لیتر از محلول رویی با 3 میلی‌لیتر آب مقطر و 1 میلی‌لیتر معـرف آمونیـوم‌مولیبـدات- وانـادات مخلوط شد. پس‌از گذشت 20 دقیقه، میزان جذب نور در طول ‌موج 470 نانومتر با دستگاه اسپکتروفتومتر خوانده و مقدار فسفر آزادشده (محلول) از هر جدایه با استفاده از منحنی استاندارد تهیه‌شده از غلظت‌های مختلف KH2PO4 محاسبه شد (12).

توان تولید سیدروفور روی محیط‌کشت پایه‎ای به نام کروم آزول- اس[9] (CAS) بررسی شد (13). محیط‌کشت پایۀ کروم آزول- اس که به‌طور جامد درون ظرف‌های پتری استفاده می‌شود، از این پس با نام محیط CAS- آگار نشان داده می‎شود. به‌منظور تهیۀ محیط یادشده، چهار محلول زیر به‌طور مجزا تهیه، استریل و سپس باهم مخلوط شدند.

1-     محلول معرف رنگی: به‌منظور تهیۀ این محلول، 10 میلی‎لیتر از محلول حاوی آهن (1 میلی‎مول FeCl3.6H2Oدر10 میلی‌مول HCl)با50میلیلیتر از محلولCAS(21/1 میلیگرم‌در‌میلی‎لیتر آب) به‌آرامی مخلوط می‎شود. این مخلوط که به رنگ ارغوانی تیره است، به‌آهستگی و درحال هم‌زدن مداوم به 40 میلی‎لیتر از محلول [10]HDTMA (28/1 میلی‎گرم‌در‌میلی‎لیتر آب) اضافه می‎شود. محلول حاصل با رنگ آبی تیره و پایدار به‌طور مجزا اتوکلاو و تا دمای حدود 50 درجۀ سانتی‌گراد سرد می‎شود. تمام محلول‎های لازم برای ساخت این معرف رنگی باید تازه تهیه شوند.

2-     محلول بافر: به‌منظور تهیۀ این محلول، 24/30 گرم از بافر [11]Pipes در 750 میلی‎لیتر از محلول حاوی 3/0 گرم KH2PO4، 5/0 گرم NaCl و 1 گرم NH4Cl حل می‎شود. اسیدیتۀ محیط با محلول KOH 50 درصد روی 8/6 تنظیم ‎و حجم بافر با اضافه‌کردن آب به 800 میلی‎لیتر رسانده می‎شود. پس‌از اضافه‌کردن 15 گرم آگار به این محیط بافر و استریل‌کردن آن در اتوکلاو، دمای آن به حدود 50 درجۀ سانتی‌گراد رسانده می‎شود.

3-     محلول غذایی: این محلول حاوی 2 گرم گلوکز، 2 گرم مانیتول، 493 میلی‏گرم MgSO4.7H2O، 11 میلی‎گرم MnSO4.H2O، 4/1 میلی‎گرم H3BO3، 04/0 میلی‎گرم CuSO4.5H2O، 2/1 میلی‏گرم ZnSO4.7H2O و 1 میلی‏گرم Na2MoO4.2H2O در 70 میلی‏لیتر آب است که پس‌از اتوکلاو به دمای 50 درجۀ سانتی‌گراد رسانده می‎شود.

4-     محلول کازامینو‌ اسید: 30 میلی‎لیتر از محلول کازامینو‌ اسید (10 درصد) به روش صاف‌کردن روی صافی غشایی با قطر منافذ 45/0 میکرومتر استریل می‎شود.

پس‌از آماده‌شدن چهار محلول یادشده، محلول‌های غذایی 3 و 4 به محلول بافر شمارۀ 2 اضافه می‎شوند و ضمن هم‌زدن آرام و مداوم مخلوط آنها و بدون ایجاد حباب، محلول معرف رنگی به‌آهستگی به آنها اضافه می‏شود. مخلوط چهار محلول پس‌از یکنواخت‌شدن و بر حسب شیوۀ کشت در ظرف‌های استریل توزیع می‏شود.

پلیت‏های حاوی محیط CAS- آگار پس‌از انجماد به چهار بخش مساوی تقسیم شدند. مقدار 5 میکرولیتر از سوسپانسیون تازۀ هر‌یک از جدایه‏های مطالعه‌شده با جمعیت تنظیم‌شده (108×5 واحد تشکیل‌دهندۀ کلنی (CFU) در میلی‌لیتر) به روش قطره‏گذاری در وسط هر بخش تلقیح شد؛ هم‌زمان با تلقیح این جدایه‌ها، تلقیح از جدایه‏های شناخته‌شدۀ تولیدکنندۀ سیدروفور برای شاهد مثبت در همان محیط‌کشت انجام شد. پلیت‏های تلقیح‌شده در دمای 28 درجۀ سانتی‌گراد نگهداری شدند. توانایی تولید سیدروفور باتوجه‌به تغییر رنگ محیط CAS- آگار از آبی به نارنجی و با اندازه‏گیری قطر هالۀ نارنجی‌رنگ تشکیل‌شده اطراف کلنی باکتری‎ها در فواصل زمانی 24، 48، 72 و 96 ساعت ارزیابی شد؛ همچنین قطر کلنی باکتری و نسبت قطر هاله به کلنی تعیین شد.

توانایی تولید آنزیم ACC- دآمیناز[12] به‌طور کیفی و به روش پنروز[13] و گلیک[14] (2003) تعیین شد (14). باتوجه‌به اینکه قابلیت ماندگاری ACC در دمای محیط بسیار کم است، پیش‌ از آغاز آزمایش، محلول ACC با غلظت 3/0 مولار تهیه و از صافی 25/0 میکرومتر استریل عبور داده شد؛ سپس مقدار 100 میکرولیتر از محلول استریل‌شدۀ ACC درون لوله‌های اپندورف (5/0 میلی‌لیتری استریل) توزیع شد و بی‌درنگ درون فریزر (در دمای منفی 20 درجۀ سانتی‌گراد) نگهداری شد. پس‌از افزودن آگار به محیط‌کشت DF[15] (ﺷﺎﻣﻞ 4 ﮔﺮم‌در‌ﻟﯿﺘﺮ KH2PO4، 6 ﮔﺮم‌در‌ﻟﯿﺘﺮ Na2HPO4، 2/0 ﮔﺮم‌در‌ﻟﯿﺘﺮ MgSO47H2O، 2 ﮔﺮم‌در‌ﻟﯿﺘﺮ ﮔﻠﻮﮐﺰ، 2 ﮔﺮم‌در‌ﻟﯿﺘﺮ ﮔﻠﻮﮐﻮﻧﯿﮏ‌اﺳﯿﺪ، 2 ﮔﺮم‌در‌ﻟﯿﺘﺮ ﺳﯿﺘﺮﯾﮏ‌اﺳﯿﺪ و ﻋﻨﺎﺻﺮ رﯾﺰﻣﻐﺬی ﺷﺎﻣﻞ 1 ﻣﯿﻠﯽﮔﺮم‌در‌ﻟﯿﺘﺮ FeSO47H2O، 10 ﻣﯿﮑﺮوﮔﺮم‌در‌ﻟﯿﺘﺮ H3BO3، 10 ﻣﯿﮑﺮوﮔﺮم‌در‌ﻟﯿﺘﺮ MnSO4H2O، 6/124 ﻣﯿﮑﺮوﮔﺮم‌در‌ﻟﯿﺘﺮ ZnSO47H2O، 2/78 ﻣﯿﮑﺮوﮔﺮم‌در‌ﻟﯿﺘﺮ CuSO45H2O و 10 ﻣﯿﮑﺮوﮔﺮم‌در‌ﻟﯿﺘﺮ MoO3 و اسیدیتۀ نهایی 2/7) و استریل‌کردن آن درون اتوکلاو به‌مدت 20 دقیقه در دمای 120 درجۀ سانتی‌گراد و فشار 2/1 بار، محیط‌کشت ضدعفونی‌‌شده درون ظرف‌های پتری 8 سانتی‌متری توزیع و به چهار بخش مساوی تقسیم شد. سه سری پلیت دارای محیط‌کشت DF برای انجام این آزمایش استفاده شد:

1- ظرف‌های پتری دارای محیط‌کشت DF و ACC؛

به‌این‌ترتیب که در آخرین مرحلۀ انجام کار و دقیقاً پیش از مایه‌زنی، مقدار 100 میکرولیتر از محلول ACC (3/0 مولار) به‌عنوان تنها منبع نیتروژنی به سطح هر ظرف پتری حاوی محیط‌کشت DF اضافه شد.

2- شاهد مثبت: ظرف‌های پتری دارای محیط‌کشت DF و سولفات‌آمونیوم ((NH4)2SO4

در این مرحله نیز مقدار 100 میکرولیتر از محلول 3/0 مولار سولفات‌آمونیوم به‌عنوان منبع نیتروژنی پایه به سطح هر ظرف پتری حاوی محیط‌کشت DF اضافه شد.

3- شاهد منفی: ظرف‌های پتری دارای محیط‌کشت DF بدون هرگونه منبع نیتروژنی (بدون ACC و (NH4)2SO4).

پشت هـر ظـرف پتـری، چهار نقطـه بـا فواصـل یکـسان از هـم نشانه‌گذاری شدند و در هر نقطه، مقدار 7 میکرولیتر از سوسپانسیون جدایه‎ها با دسـتگاه میکروسمپلر در سه تکرار مایه‌کوبی شد. محیط‌های مایه‌کوبی‌شـده بـه‌مـدت 5 روز در دمـای 28 درجۀ سانتی‌گراد درون انکوباتور قرار داده شدند و پس‌از 5 روز، میزان رشد جدایه‎ها ارزیـابی شد.

شناسایی مولکولی جدایه‏ها: DNA باکتری با استفاده از کیت شرکت کیاژن استخراج و PCR[16] به‌منظور تکثیر توالی ژن رمزکنندۀ 16S rRNA انجام شد. آغازگرهای 27F و 1520R برای دستیابی به ناحیۀ بارکد ژن رمزکنندۀ 16S rRNA باکتری‏های مطالعه‌شده استفاده شدند (جدول 1). به‌منظور تکثیر این جایگاه‌ها طی واکنش PCR با حجم نهایی 50 میکرولیتر از ترکیبات مندرج در جدول 2 بر اساس اصول و قوانین استاندارد PCR بدون وجود آلودگی بین‌نمونه‏ای استفاده شد؛ در این راستا، ابتدا به‌منظور یکسان‌سازی شرایط تکثیر برای تمام نمونه‌ها، مخلوط اصلی حاوی تمام ترکیبات به‌جز DNA نمونه‌ها ساخته شد و درنهایت، مقدار حداقل 100 نانوگرم DNA در واکنش استفاده شد. برنامۀ دمایی به‌کاررفته برای PCR هرکدام از سه جایگاه در جدول 3 آورده شده است.

محصول PCR برای بررسی الگوی باندی و ارزیابی نتایج روی ژل آگارز 1 درصد الکتروفورز شد؛ به این منظور و برای تعیین توالی قطعه‌های تکثیرشده، محصول PCR درون چاهک‎های ژل آگارز 1 درصد قرار داده شد و پس‌از استخراج باند مدنظر از ژل به روش سامبورک[17] و همکاران (2001)، به‌منظور تعیین توالی دوطرفه با استفاده از BigDye terminator دستگاه Sequencer استفاده شد (15). توالی‌های به‌دست‌آمده پس‌از مشاهده با نرم‌افزار Chromas 2.1 اصلاح و تأیید شدند. این توالی‌ها با نرم‌افزار ClustalW هم‌ردیف‌سازی و با نرم‌افزار Bioedit 7.0.9 به فرمت‎های قابل‌استفاده تبدیل شدند (16). توالی نوکلئوتیدهای محصولات PCR با توالی نوکلئوتیدهای موجود در GenBank مقایسه و درخت فیلوژنیک به روش Neighbor Joining با نرم‌افزار Mega 5 رسم شد. توالی‏های نوکلئوتیدهای موجود در GenBank که شباهت زیادی با توالی نوکلئوتیدهای جدایه‏های مطالعه‌شده داشتند، گزارش شدند. توالی‏های نوکلئوتیدی تعیین‌شده در مطالعۀ حاضر به پایگاه داده‏های GenBank ارسال و با شماره دسترسی‏های مختلف ثبت شد.

 

 

جدول 1- اطلاعات جایگاه و آغازگرهای استفاده‌شده در پژوهش حاضر

نام جایگاه

محصول PCR (جفت باز)

نام آغازگر

توالی آغازگر (5´-3´)

16S rRNA

1400

27F

AGAGTTTGATCCTGGCTCAG

1520R

AAGGAGGTGATCCAGCCGCA

 

جدول 2- غلظت مواد شیمیایی به‌کاررفته در PCR

مواد شیمیایی

غلظت اولیه

مقدار هر واکنش

غلظت نهایی

10X PCR buffer

10X

5μl

1X

MgCl2

25 mM

4μl

2mM

dNTP mix

1.25 mM

4μl

100μM

Forward Primer

10 μM

2.5 μl

0.5 μM

Reverse Primer

10 μM

2.5 μl

0.5 μM

Taq DNAPolymerase

1 unit/μl

1 μl

0.02 units/μl

Template DNA

30 - 60 ng/μl

1 μl

0.6 –1.2 ng/μl

Sterile ddH20

-----

30 μl

-----

 

جدول 3- برنامۀ دمایی تکثیر جایگاه 16S rRNA در جدایه‏های مطالعه‌شده

جایگاه

برنامۀ دمایی PCR

توضیحات

16S rRNA

95°C for 5 min

35 cycles: 95°C for 40s

60°C for 40s

72°C for 2 min

72°C for 5 min

باند 1400 جفت بازی تکثیر می‌شود.

 


نتایج

از میان جدایه‏های به‌دست‌آمده از فراریشه و درون‎رست ریشه، تعداد 15 جدایۀ فراریشه‏ای و تعداد 7 جدایۀ درون‎رست بر اساس توانایی آنها در ایجاد ویژگی‌های محرک رشدی انتخاب شدند. نتایج ارزیابی توانایی باکتری‏های برگزیده ازنظر داشتن ویژگی محرک رشد گیاه در جدول 4 و شکل 1 نشان داده شده‌اند. تمام سویه‏های منتخب ویژگی‌های محرک رشد گیاه را داشتند، اگرچه میزان توانایی آنها باهم متفاوت بود. باکتری‏های فراریشه‏ای و درون‏رست ازنظر مقدار تولید هورمون اکسین با یکدیگر تفاوت داشتند و این سویه‎‎ها توانستند هورمون اکسین را در محدودۀ 9/4 تا 6/22 میکروگرم‌بر‌میلی‌لیتر تولید کنند؛ بیشترین مقدار تولید این هورمون در سویۀ فراریشه‏ای R193 (6/22 میکروگرم‌بر‌میلی‌لیتر) تعیین شد.

 

 

جدول 4- ویژگی‌های محرک رشدی جدایه‏های برتر فراریشه‏ای و درون‏رست محرک رشد گیاه گندم

جدایه

اکسین

(میکروگرم‌برمیلی‌لیتر)

حلالیت فسفات معدنی نامحلول (قطر هاله به قطر کلنی)

حلالیت فسفات آلی نامحلول (قطر هاله به قطر کلنی)

تولید سیدروفور (قطر هاله به کلنی)

تولید ACC- دآمیناز (قطر کلنی، میلی‌متر)

میزان انحلال فسفات نامحلول معدنی (میکروگرم ‌برمیلی‌لیتر)

اسیدیتۀ محیط‌کشت حاوی تری‌کلسیم ‌فسفات

شاهد

-

-

-

-

-

1 ± 16

6/6 ± 2/0

R19

g3/0 ± 0/12

j-i2/0 ± 3/2

j1/0 ± 0/2

b-d2/0 ± 5/1

de4/0 ± 5/2

a6 ±326

3/4 ± 1/0g

R23

f5/0 ± 6/13

cd1/0 ± 2/3

cd0/0 ± 0/3

cd1/0 ± 2/1

b2/0 ± 4/3

d4 ± 252

e1/0 ± 2/5

R93

e4/0 ± 5/15

c1/0 ± 3/3

d-f1/0 ± 7/2

cd1/0 ± 3/1

cd2/0 ± 8/2

e3 ± 243

e1/0 ± 3/5

R97

bc3/0 ± 3/18

f-h1/0 ± 4/2

e-g1/0 ± 6/2

a-c1/0 ± 6/1

f00/0

l5 ± 84

a1/ 0±5/6

R 101

k5/0 ± 9/4

ef1/0 ± 7/2

ij1/0 ± 1/2

cd1/0 ± 3/1

e1/0 ± ½

j1 ± 145

bc1/0 ±0/6

R 117

g5/0 ± 1/12

de0/0 ± 9/2

fh1/0 ± 5/2

cd1/0 ± 4/1

b2/0 ± 3/3

g5 ± 189

cd1/0 ± 8/5

R 126

cd3/0 ± 2/17

cd1/0 ± 2/3

d1/0 ± 9/2

a-c1/0 ± 6/1

a2/0 ± 1/4

f5 ± 226

e1/0 ± 4/5

R 135

b3/0 ± 3/19

c1/0 ± 3/3

d-f1/0 ± 7/2

b-d1/0 ± 5/1

a1/0 ± 3/4

h2 ± 176

c1/0 ± 8/5

R 154

i1/0 ± 3/9

f-h1/0 ± 4/2

j0/0 ± 0/2

cd0/0 ± 4/1

f00/0

i2 ± 157

bc1/0 ± 9/5

R 185

b1/0 ± 2/19

b2/0 ± 0/4

a1/0 ± 8/3

a1/0 ± 8/1

a3/0 ± 4

b2 ± 299

fg1/0 ± 5/4

R 191

h4/0 ± 5/10

ih1/0 ± 1/2

kl2/0 ± 6/1

cd1/0 ± 3/1

f00/0

f2 ± 224

e1/0 ±4/5

R 193

a9/0 ± 6/22

b1/0 ± 9/3

bc2/0 ± 2/3

a-c1/0 ± 6/1

b3/0 ± 4/3

c5 ± 290

f1/0± 7/5

R209

j3/0 ± 8/7

ig1/0 ± 0/2

l1/0 ±  3/1

cd1/0 ± 2/1

f00/0

h5 ± 174

cd1/0 ± 7/5

R 228

hg4/0 ± 6/11

g-i0/0 ± 3/2

hi1/0 ± 4/2

cd1/0 ± 2/1

f00/0

k4 ± 128

b1/ 0± 2/6

R 236

ed7/0 ± 0/16

cd1/0 ± 1/3

de1/0 ± 8/2

b-d1/0 ± 5/1

bc2/0 ± 2/3

i3 ± 157

bc2/0 ± 6

E 119

b6/0 ± 2/19

cd1/0 ± 1/3

b1/0 ± 3/3

a-c1/0 ± 7/1

a1/0 ± 3/4

a4 ± 323

g1/0 ± 3/4

E 133

ij3/0 ± 2/8

kj1/0 ± 7/1

kl1/0 ± 6/1

cd1/0 ± 3/1

b-d2/0 ± 9/2

j2 ± 148

bc1/0±6

E 157

ed2/0 ± 3/16

e-g1/0 ± 6/2

ij1/0 ± 2/2

b-d1/0 ± 5/1

f00/0

f4 ± 223

de2/0 ±5/5

E 193

ji5/0 ± 9/8

k1/0 ± 6/1

l1/0 ± 4/1

cd1/0 ± 2/1

f00/0

k4 ± 132

b1/0 ± 2/6

E 204

b2/0 ± 1/19

ji1/0 ± 1/2

k1/0 ± 7/1

d1/0 ± 1/1

f00/0

i3 ± 163

c1/0 ± 8/5

E 221

K2/0 ± 6/5

fg1/0 ± 5/2

ij1/0 ± 1/2

cd1/0 ± 3/1

e1/0 ± 1/2

f2 ± 221

de1/0 ± 5/5

E 240

a3/0 ± 0/22

a2/0 ± 0/5

a1/0 ± 7/3

a1/0 ± 8/1

a2/0 ± 2/4

a3 ± 330

g1/0 ± 2/4

* ستون‎های دارای یک حرف مشابه اختلاف معنا‏داری در سطح 5 درصد ندارند.

 

شکل 1- نقشۀ حرارتی (Heat Map) ویژگی‌های محرک رشدی جدایه‏های برتر فراریشه‏ای و درون‏رست محرک رشد گیاه گندم؛ IAA: تولید اکسین، IPS: حلالیت فسفات معدنی، OPS: حلالیت فسفات آلی، SP: تولید سیدروفور، ACC. d: تولید آنزیم ACC- دآمیناز، PS: انحلال کمّی فسفات معدنی

 

 

باکتری‎های E240 و R185 برترین سویه‎ها ازنظر شاخص انحلال فسفر (قطر هاله به قطر کلنی) در ارزیابی کیفی توان حل‌کنندگی فسفات آلی و معدنی بودند و سویۀ R193 در رتبۀ بعدی قرار داشت (جدول 4). نتایج توان کمّی انحلال فسفات نامحلول کاملاً مشابه با اندازه‎گیری کیفی روی محیط کشت جامد اسپربر نبود (شکل 1)؛ باوجوداین، سویه‎ها روند کلی مشابه و توانایی زیادی در انحلال فسفات‌های نامحلول معدنی داشتند. پس‌از 7 روز گرماگذاری، سویه‌های E240، E119 و R19 میزان حلالیت تری‌کلسیم‌فسفات را به‌ترتیب به 330، 323 و 326 میکروگرم‌بر‌میلی‎لیتر رساندند؛ همچنین رشد جدایه‎ها سبب کاهش معنا‌دار اسیدیتۀ محیط مایع اسپربر شد. اسیدیتۀ نهایی محیط در پایان آزمایش از 2/7 به 2/4، 3/4 و 3/4 به‌ترتیب برای E240، E119 و R19 کاهش یافت. همان‌طور که در جدول 4 دیده می‏شود، رابطۀ معکوسی بین مقدار فسفر آزادشده و اسیدیتۀ محیط‌کشت وجود دارد؛ این مطلب نشان می‏دهد کاهش اسیدیته می‎تواند سازوکار این جدایه‏ها در انحلال فسفات‏های نامحلول معدنی باشد.

 

تمام جدایه‏هایی که هالۀ نارنجی اطراف کلنی‏ را روی محیط CAS نشان دادند، ازنظر توان تولید سیدروفور برگزیده شدند. متوسط میزان تولید سیدروفور (نسبت قطر هاله به قطر کلنی) 42/1 و دامنۀ آن از 1/1 تا 8/1 متغیر بود. نتایج نشان دادند جدایه‏های منتخب توان تولید مقدار مناسبی از ACC- دآمیناز و استفاده از ACC به‌عنوان تنها منبع نیتروژن را دارند. ریزسازواره‎های خاک با تولید آنزیم ACC- دآمیناز سبب تخریب ACC به آمونیاک و آلفاکتوبوتیرات می‎شوند و از این طریق، سطح اتیلن در گیاهان را کم و از آثار منفی اتیلن بر رشد گیاه هنگام تنش جلوگیری می‎کنند.

به‌منظور شناسایی اولیۀ این جدایه‏ها، صفت‌های ریخت‌شناختی پس‌از رنگ‌آمیزی گرم، شکل و آرایش آنها با میکروسکوپ نوری مطالعه و در ادامه، پایگاه‌های اطلاعاتی در بانک ژن برای توالی‏های مشابه توالی ژن 16S rRNA این جدایه‎ها بررسی شدند. نمودار مربوطه (به روش Neighbour-joining) با استفاده از توالی‏های این جدایه‏ها و توالی‏های نماینده از پایگاه‌های اطلاعاتی رسم شد (شکل‌های 2 و 3). توالی‏های نوکلئوتیدی تعیین‌شده در مطالعۀ حاضر به پایگاه اطلاعاتی بانک ژن فرستاده و با شمارۀ دسترسی یادشده در جدول‌های 5 و 6 برای جدایه‏های فراریشه و درون‎رست ثبت شد.

درخت فیلوژنتیک بر اساس توالی‏های 16S rRNA نشان داد جدایه‏های فراریشه‏ای R23، R93، R117، R126، R135، R191، R209، R236 و E133 ارتباط نزدیکی با سویه‎های Bacillusبه‌دست‌آمده بر اساس بانک اطلاعات NCBI دارند و جدایه‏های R185، R193، E119 و E240 نیز ارتباط نزدیک‌تری با جنس Pseudomonasدارند. به نظر می‏رسد جنس‏های Pseudomonasو Bacillusاز غالب‎ترین جدایه‎ها در میان جدایه‎های فراریشه‏ای و درون‏رست محرک رشد گیاه گندم در مزرعۀ پژوهشی باشند.

 

 

جدول 5- توالی‏های نوکلئوتیدی تعیین‌شده و شمارۀ دسترسی مربوط به جدایه‏های فراریشه‏ای

16S rRNA شناسایی ژن

شمارۀ شناسایی

جدایه

Gammaproteobacteria bacterium

MK100915

R19

Bacillus thuringiensis

MK100916

R23

Bacillus cereus

MK100918

R93

Sphingobacterium faecium

MK100919

R97

Staphylococcus sciuri

MK100920

R101

Bacillus safensis

MK100921

R117

Bacillus sp.

MF579597

R126

Bacillus atrophaeus

MK100922

R135

Lysinibacillus macroides

MK100923

R154

Pseudomonas sp.

MF579599

R185

Paenibacillus polymyxa

MK100924

R191

Pseudomonas fluorescens

MK100925

R193

Paenibacillus ehimensis

MK100926

R209

Advenella incenata

MK100927

R228

Bacillus toyonensis

MK100928

R236

 

 

 

شکل 2- درخت فیلوژنتیکی جدایه‏های فراریشه‎ای بر اساس روش Neighbor Joining منتج از تحلیل توالی‎های ژن 16S rRNA. عدد نشان‌داده‌شده در گره‎ها نشان‌دهندۀbootstrap 1000 است.

 

جدول 6- توالی‎های نوکلئوتیدی تعیین‌شده و شمارۀ دسترسی مربوط به جدایه‏های درون‏رست

شناسایی ژن 16S rRNA

شمارۀ شناسایی

جدایه

Pseudomonas fluorescens

MK100909

E119

Bacillus simplex

MK100910

E133

Enterobacter hormaechei

MK100911

E157

Variovorax boronicumulans

MK100912

E193

Plantibacter flavus

MK100913

E204

Staphylococcus sciuri

MK100914

E221

Pseudomonas sp.

MF579598

E240

 

شکل 3- درخت فیلوژنتیکی جدایه‏های درون‎رست بر اساس روش Neighbor Joining منتج از تحلیل توالی‎های ژن16S rRNA. عدد نشان‌داده‌شده در گره‎ها نشان‌دهندۀbootstrap 1000 است.

 


بحث و نتیجه‏گیری

باکتری‌های محرک رشد گیاه از مهم‌ترین ریزوباکتری‎های مفید خاک‌زی‌اند و با داشتن ویژگی‌های محرک رشدی متعدد که راهبرد مهمی برای رسیدن به کشاورزی پایدار است، رشد و عملکرد گیاهان را افزایش می‌دهند. در مطالعۀ حاضر، تعداد 15 جدایۀ فراریشه‏ای و 7 جدایۀ درون‎رست به‌ترتیب از فراریشه و ریشۀ گیاه گندم جداسازی شدند. غربال‌گری این جدایه‏ها ازنظر ویژگی‌های محرک رشدی مانند توان تولید آنزیم ACC- دآمیناز، ایندول-3- استیک‌اسید، سیدروفور، انحلال فسفات‌های نامحلول معدنی و آلی انجام شد. تمام جدایه‏های فراریشه‏ای و درون‎رست ویژگی‌های محرک رشد گیاه را داشتند، اگرچه میزان توانایی آنها باهم متفاوت بود. در پژوهش سوریواستا[xviii] و همکاران (2014) روی 25 جدایۀ P. fluorescens مشخص شد متوسط میزان تولید اکسین برابر با 44/2 میکروگرم‌بر‌میلی‏لیتر است و تمام جدایه‏ها قابلیت تولید اکسین را دارند و دامنۀ آن از 3/1 تا 5/4 میکروگرم‌بر‌میلی‏لیتر متغیر است (17). نتایج خاکی‏پور[xix] و همکاران (2008) نشان دادند مقدار اکسین تولیدی در P. fluorescens از صفر تا 6/31 و در P. putida از صفر تا 08/24 میلی‏گرم‌در‌‏لیتر متغیر است (18). ساتیاپراکش[xx] و همکاران (2017) گزارش کردند با افزایش جمعیت باکتری‏های حل‌کنندۀ فسفات، مقدار اسیدیتۀ محیط‌کشت 3/2 تا 4 واحد کاهش نشان می‌دهد. احتمالاًً کاهش اسیدیته از تولید اسیدهای آلی طی دورۀ رشد باکتری‏ها ناشی می‌شود و این اسیدها با کلاته‌کردن کاتیون‏های پیوند‌شده با فسفات از طریق گروه‌های هیدروکسیلی و کربوکسیلی و همچنین اسیدی‌کردن خاک (کاهش اسیدیته) سبب انحلال مقدار درخور توجهی فسفر می‌شوند (19). باتول[xxi] و اقبال[xxii] (2018) تعداد 30 جدایه با قابلیت حل‌کنندگی فسفات نامحلول و سایر ویژگی‌های محرک رشدی (تولید هورمون و تثبیت نیتروژن) را از فراریشۀ گیاهان مختلف جداسازی کردند. شاخص کیفی حلالیت فسفر از 4 تا 7 در محیط جامد و میزان حلالیت فسفر در محیط مایع (به‌طور کمّی) از 30 تا 246 میکروگرم‌در‌میلی‏لیتر متغیر بود. شرایط بهینه برای حلالیت فسفات نامحلول شامل دمای 35 درجۀ سانتی‏گراد، اسیدیتۀ 7، استفاده از گلوکز و آمونیوم‌نیترات به‌ترتیب به‌عنوان منبع کربن و نیتروژن بود (20). پاندی[xxiii] و پوتندا[xxiv] (2018) تعداد 10 جدایه از فراریشۀ سیب‌زمینی جداسازی کردند و از میان این جدایه‎ها، Enterobacter cancerogenus D-m-2 با توانایی بیشتر (37/8 میکروگرم‌بر‌میلی‌لیتر فسفر) در انحلال فسفات نامحلول شناسایی شد (21). چن[xxv] و همکاران (1994) نشان دادند سیدروفوری که P. putida تولید می‌کند، حلالیت آهن، مس، منگنز و روی را افزایش می‎دهد (22). نتایج عباس‌زاده[xxvi] و همکاران (2010) در زمینۀ ارزیابی توان تولید سیدروفور نشان می‌دهد تمام سویههایPseudomonas  می‌توانند هالۀ نارنجی‌رنگ را که دلیلی بر تولید سیدروفور است، روی محیط‌کشت CAS‌- آگار ایجاد کنند و متوسط نسبت قطر هاله به قطر کلنی در سویهها بین 37/0 تا 73/2 متغیر است (23). اتیلن یکی از هورمون‎های گیاهی است که فرایند گره‏زایی را در لگوم‏ها تنظیم می‎کند و در بسیاری از فرایندهای چرخۀ زندگی گیاه دخیل است؛ این هورمون از گره‏سازی لگوم‏ها و طویل‌شدن ریشه جلوگیری می‎کند و در پاسخ به تنش‎های غیرزیستی ساخته می‎شود. مادۀ ACC پیش‎مادۀ ساخت اتیلن در گیاهان است که در واکنشی که آنزیم ACC- اکسیداز کاتالیز می‎کند به اتیلن و دی‌اکسیدکربن تبدیل می‎شود (24)؛ بنابراین، مطالعه‌های بسیاری انجام شده‌اند تا باکتری‎های مولد آنزیم ACC- دآمیناز را جداسازی کنند (25).

نتایج نشان دادند جنس‏های غالب در میان جدایه‎های فراریشه‏ای و درون‏رست محرک رشد گیاه گندم از نوعPseudomonas و Bacillus هستند. درمجموع، 7 جدایه به جنس Bacillus، 4 جدایه به Pseudomonas، 2 جدایه به Staphylococcus، 2 جدایه به Paenibacillus و سایر جدایه‌های به جنس‎هایGammaproteobacteria، Sphingobacterium، Lysinibacillus، Advenella، Enterobacter، Variovorax و Plantibacter تعلق داشتند. پندی[xxvii] و همکاران (2017) تعداد 8 جدایۀ باکتریایی با قابلیت حل‌کردن فسفر از محیط‌کشت حاوی تری‌کلسیم‌فسفات نامحلول جداسازی کردند و تشکیل هالۀ روشن اطراف کلنی باکتری نشانۀ حلالیت فسفات در نظر گرفته شد. از 8 جدایۀ باکتریایی، 3 جدایه با شاخص حلالیت فسفات زیاد از 69/0±88/4 تا 3/0±48/4، کاهش اسیدیته از 08/0±08/3 تا 12/0±82/3 و حلالیت فسفات زیاد در محیط مایع از 10±49/305 تا 45/1±72/277 میکروگرم‌بر‌میلی‎لیتر مشاهده شدند. بر اساس تجزیه‌و‌تحلیل ژن 16S rRNA، 2 جدایه به جنس Alacaligenes تعلق داشتند و 1 جدایه به B. cepacia نزدیک بود (26). گولاتی[xxviii] و همکاران (2010) گزارش کردند جدایۀ BIHB 723 متعلق به Acinetobacter حل‌کنندۀ فسفات می‌تواند سایر متابولیت‏های محرک رشدی نظیر ACC- دآمیناز، اکسین و سیدروفور را تولید کند (27). رودریگز[xxix] و فراگا[xxx] (1999) گزارش کردند بیشترین باکتری‏های حل‌کنندۀ فسفات نامحلول شامل جنس‌های Enterobacter،Serratia،Alacaligenes،Acinetobacter وFlavobacterium هستند (28). بر اساس نتایج مطالعۀ حاضر می‌توان نتیجه گرفت فراریشه و ریشۀ گیاه گندم حاوی باکتری‌های مفید با پتانسیل زیاد برای بهبود رشد گیاه هستند که با جداسازی، انتخاب و کاربرد انواع برتر می‌توان موجب بهبود شاخص‌های رشد گیاه شد.

References

(1)              Ashrafuzzaman M., Faridakhtar HM., Raziismail M., Anamulhoque M., Zahurulislam S., Shahidullah M., Sariah M. Efficiency of plant growth-promoting rhizobacteria (PGPR) for the enhancement of rice growth. African Journal of Biotechnology 2009; 8: 1247-1252.

(2)              Zaidi A., Khan M., Ahemad M., Oves M. Plant growth promotion by phosphate solubilizing bacteria. Acta Microbiologica et Immunologica Hungarica 2009; 56(3): 263-284.

(3)              Mhatre PH., Karthik C., Kadirvelu K., Divya K., Venkatasalam E., Srinivasan S., Shanmuganathan R. Plant Growth Promoting Rhizobacteria (PGPR): A potential alternative tool for Nematodes bio-control. Biocatalysis and Agricultural Biotechnology 2018; 17: 119-128.

(4)              Sharma SB., Sayyed RZ., Trivedi MH., Gobi TA. Phosphate solubilizing microbes: sustainable approach for managing phosphorus deficiency in agricultural soils. Springer Plus 2013; 2(1): 587.

(5)              Gopalakrishnan S., Sathya A., Vijayabharathi R., Varshney RK., Gowda CL., Krishnamurthy L. Plant growth promoting rhizobia: challenges and opportunities. 3 Biotech 2015; 5(4): 355-377.

(6)              Glick BR. Plant growth-promoting bacteria: mechanisms and applications. Scientifica 2012; 1-15.

(7)              Santoyo G., Moreno-Hagelsieb G., del Carmen Orozco-Mosqueda M., Glick BR. Plant growth-promoting bacterial endophytes. Microbiological Research 2016; 183: 92-99.

(8)              Wani ZA., Ashraf N., Mohiuddin T., Riyaz-Ul-Hassan S. Plant-endophyte symbiosis, an ecological perspective. Applied Microbiology and Biotechnology 2015; 99(7): 2955-2965.

(9)              Emami S., Alikhani HA., Pourbabaei AA., Etesami H., Motashare Zadeh B., Sarmadian F. Improved growth and nutrient acquisition of wheat genotypes in phosphorus deficient soils by plant growth-promoting rhizospheric and endophytic bacteria. Soil Science and Plant Nutrition 2018; 64(6): 719-727.

(10)          Johnson LF., Curl EA. Methods for research on the ecology of soil-borne plant pathogens. Minneapolis, MN: Burgess Publishing Company; 1972.

(11)          Bric JM., Bostock RM., Silverstone SE. Rapid in situ assay for indoleacetic acid production by bacteria immobilized on a nitrocellulose membrane. Applied and Environmental Microbiology 1991; 57(2): 535-538.

(12)          Sperber JI. The incidence of apatite-solubilizing organisms in the rhizosphere and soil. Australian Journal of Agricultural Research 1958; 9(6): 778-781.

 

(13)          Schwyn B., Neilands J. Universal chemical assay for the detection and determination of siderophores. Analytical Biochemistry 1987; 160(1): 47-56.

(14)          Penrose DM., Glick BR. Methods for isolating and characterizing ACC deaminase‐containing plant growth‐promoting rhizobacteria. Physiologia Plantarum 2003; 118(1): 10-15.

(15)          Sambrook J., Russell DW., Russell DW. Molecular cloning: a laboratory manual (3-volume set). Immunol 2001; 49: 895-909.

(16)          Hall TA. BioEdit: A user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symposium Series 1999; 41: 95-98.

(17)          Srivastava N., Bhandari B., Bhatt A. PGPR isolated from rhizospheric soil of Zanthoxylum armatum DC in Garhwal Himalaya. International Journal of Herbal Medicine 2014; 2(1): 100-108.

(18)          Khakipour N., Khavazi K., Mojallali H., Pazira E., Asadirahmani H. Production of auxin hormone by fluorescent pseudomonads. American-Eurasian Journal of Agricultural and Environmental Sciences 2008; 4(6): 687-692.

(19)          Satyaprakash M., Nikitha T., Reddi E., Sadhana B., Vani SS. Phosphorous and phosphate solubilising bacteria and their role in plant nutrition. International Journal of Current Microbiology and Applied Sciences 2017; 6(4): 2133-2144.

(20)          Batool S., Iqbal A. Phosphate solubilizing rhizobacteria as alternative of chemical fertilizer for growth and yield of Triticum aestivum (Var. Galaxy 2013). Saudi Journal of Biological Sciences 2019; 26(7):1400-1410.

(21)          Pandey D., Putatunda C. Isolation and characterization of phosphate solubilizing bacteria from the rhizosphere of potato plant. International Journal of Current Microbiology and Applied Sciences 2018; 7(01): 967-975.

(22)          Chen Y., Jurkevitch E., Bar-Ness E., Hadar Y. Stability constants of pseudobactin complexes with transition metals. Soil Science Society of America Journal 1994; 58(2): 390-396.

(23)          Abbas-Zadeh P., Saleh-Rastin N., Asadi-Rahmani H., Khavazi K., Soltani A., Shoary-Nejati AR., Miransari M. Plant growth-promoting activities of fluorescent pseudomonads, isolated from the Iranian soils. Acta Physiologiae Plantarum 2010; 32(2): 281-288.

(24)          Lin Z., Zhong S., Grierson D. Recent advances in ethylene research. Journal of Experimental Botany 2009; 60(12): 3311-3336.

(25)          Duan J., Müller KM., Charles TC., Vesely S., Glick BR. 1-aminocyclopropane-1-carboxylate (ACC) deaminase genes in rhizobia from southern Saskatchewan. Microbial Ecology 2009; 57(3): 423-436.

(26)          Pande A., Pandey P., Mehra S., Singh M., Kaushik S. Phenotypic and genotypic characterization of phosphate solubilizing bacteria and their efficiency on the growth of maize. Journal of Genetic Engineering and Biotechnology 2017; 15(2): 379-391.

(27)          Gulati A., Sharma N., Vyas P., Sood S., Rahi P., Pathania V., Prasad R. Organic acid production and plant growth promotion as a function of phosphate solubilization by Acinetobacter rhizosphaerae strain BIHB 723 isolated from the cold deserts of the trans-Himalayas. Archives of Microbiology 2010; 192(11): 975-983.

(28)          Rodrı́guez H., Fraga R. Phosphate solubilizing bacteria and their role in plant growth promotion. Biotechnology Advances 1999; 17: 319-339.