آنالیز ژنتیکی ژنهای پپتید سنتتاز (‏NRPSs‏) در بیوسنتز محصولات طبیعی سیانوباکتری های دریاچه ‏لواسان

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 گروه زیست شناسی، دانشکده علوم، دانشگاه آزاد اسلامی واحد علوم و تحقیقات، تهران، ایران

2 گروه میکروبیولوژی، دانشکده علوم، دانشگاه آزاد اسلامی، واحد تهران شمال، تهران، ایران

چکیده

 



مقدمه‎:‎‏ سیانوباکتری ها، کاندیدای خوبی برای کشف محصولات طبیعی با کاربرد در صنایع داروسازی هستند. امروزه، عمده ‏متابولیتهای بیواکتیو جدا شده از سیانوباکتری ها به صورت پلی کتیدی ، پپتیدهای غیر ریبوزومی و یا هیبریدی از این دو ‏هستند. به رغم مطالعات بسیار در زمینه پراکنش ژنهای ‏NRPS، هیچکدام از آنها در زمینه سویه های سیانوباکتریایی دریاچه ‏لواسان نبوده است. بنابراین، هدف از این مطالعه بررسی همبستگی بین حضور این ژنها با سنتز ترکیبات طبیعی است.‏

مواد و روش ها: در این مطالعه، ده سیانوباکتری آب شیرین از دریاچه لواسان بر اساس توالی ژن ‏‎16SrRNA‎‏ شناسایی شدند. ‏PCR‏ ژن ‏NRPS‏ با استفاده از تکنیکهای مولکولی به منظور آنالیز فیلوژنتیک ژنهای مسئول برای تولید متابولیتهای ثانویه انجام ‏شد. به منظور پیشگویی ترکیب پپتیدی، اسید آمینه فعال شده و توالی های امضای مودول آدنیلیشن ‏NRPS‏ از نرم افزارهای ‏بیوانفورماتیک استفاده گردید. آزمایشات غربال گری آنتی بیوگرام با استفاده از روش دیسک انجام گردید. 

نتایج: نتایج نشان داد که ژنهای ‏NRPS‏ در همه سویه های مطالعه شده موجودند. به علاوه، نتایج حاصل از تجزیه و تحلیل های ‏بیوانفورماتیک، نوع ترکیب طبیعی، توالی های امضا و پیشگویی اسید آمینه فعال شده را نشان داد. خوشه بندی توالی های ‏پروتئینی ‏NRPS‏ نشان داد که هیچ همبستگی فیلوژنتیکی مشخصی بین دمین های آدنیلیشن و نوع اسید آمینه فعال شده وجود ‏ندارد و این نشان از تنوع بالا درون دمین های آدنیلیشن است. علاوه بر آن، نتایج حاصل از آزمایشات آنتی بیوگرام، همبستگی ‏مثبتی بین حضور این ژنها و فعالیت آنتی میکروبی را نشان داد. ‏

بحث‎ ‎و‎ ‎نتیجه‎ ‎گیری‎:‎‏ آنالیز توالی ها نشان داد که آنزیم های رمزگزاری کننده این ژن ها احتمالا مسئول تولید متالبولیتهای ثانویه ‏جدید مانند آنتی بیوتیکها هستند. نتایج حاصل از مطالعه حاضر نشان می دهد که سیانوباکتری های آب شیرین ایران، منبع ‏قابل قبولی برای تولید ترکیبات دارویی هستند. ‏

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Genetic analysis of nonribosomal peptide synthesis genes (NRPSs) in natural ‎product biosynthesis of the cyanobacterial strains of Lavasan Lake

نویسندگان [English]

  • Bahareh Nowruzi 1
  • Abbas Akhavan Sepahi 2
  • Ghazaleh Sadat Soltani Savoji 1
1 Department of Biology, Faculty of Science, Science and Research Branch, Islamic Azad University, Tehran, Iran.‎
2 Department of Microbiology, Faculty of Science, Islamic Azad University, Tehran North Branch, Tehran, Iran.‎
چکیده [English]

Introduction: Cyanobacteria are regarded as good candidates for natural pruduct discovery, with applications in ‎pharmaceuticals industry. The majority of bioactive metabolites have either been polyketides, non-ribosomal ‎peptides, or a hybrid of the two. Despite of several worldwide studies on prevalence of NRPSs, none of them ‎included Iranian cyanobacteria of Lavasan Lake. Therefore, the aim of this study was to show that the presence of ‎these genes correlates with natural product synthesis. ‎

Materials and methods:‎‏ ‏In this study, ten cultured fresh water cyanobacteria strains of the Lavasan Lake were ‎identified based on the sequence of 16SrRNA gene. In order to phylogenetic analysis the genes responsible for the ‎production of secondary metabolites, a NRPS PCR was conducted. Bioinformatics software tools were used in ‎order to prediction of peptide compound, amino acid activated and the signature sequences by a specific unknown ‎NRPS A module. Antibiogram bioassays were conducted to detect the presence of antimicrobial effects. Lastly, ‎studied strains have been deposited at the Cyanobacteria Culture Collection (CCC) of herbarium ALBORZ at the ‎Science and Research Branch, Islamic Azad University, Teheran.‎

Results: the results showed that NRPS genes are presence in all strains. Morover bioinformatics analysis confirmed ‎the type of natural compound, signature sequences and predicted amino acid. In clusterimg of NRPS protein ‎sequences, there was no clear phylogenetic correlation between adenylation domains and activated amino acid and ‎this result emphasize the variety of adenylation domains. Morover the results of antibiogram bioassays showed ‎that there are positive correlation between the presents of those genes and antimicrobial activity.‎

Discussion and conclusion: Sequence analysis indicates the enzymes encoded by these genes may be responsible ‎for the production of different secondary metabolites, such as antibiotics. The presented results prove that fresh ‎water cyanobacterial of Iran are a promising source to yield chemical and pharmaceutical interesting compounds.‎

کلیدواژه‌ها [English]

  • Peptide synthetase genes (NRPSs)
  • Fresh water cyanobacterial
  • Genetic analysis
  • Lavasan Lake
  • Natural product.‎

مقدمه.

سیانوباکتری‌ها، پروکاریوت‌های فتوسنتزی اکسیژنیک با ویژگی‌های مشابه باکتری‌ها (پروکاریوت‌ها) و جلبک‌ها (یوکاریوت‌ها) هستند. تنوع بی‌اندازۀ سیانوباکتری‌ها منعکس‌کنندۀ تولید محدودۀ وسیعی از فراورده‌های طبیعی[1] است که موجب زنده‌ماندن این موجودات در زیستگاه‌های متنوع اکولوژیکی و رقابتی می‌شود. پژوهش‌های اخیر نشان داده‌اند سیانوباکتری‌ها قابلیت تولید بلوم‌های سمی را در بسیاری از آب‌ها دارند و محدودۀ وسیعی از نئوروتوکسین‌ها، هپاتوکسین‌ها و متابولیت‌های ثانویۀ ارتقا‌دهندۀ تومور را تولید می‌کنند (1-4). این فراورده‌های طبیعی نه‌تنها ارزش دارویی دارند، به‌شکل مدل‌های ساختمانی برای ایجاد آنالوگ‌های سنتتیک نیز به کار می‌روند (5-7). تاکنون فراورده‌های طبیعی بسیاری از طیف وسیعی از از تاکسون‌ها[2] جدا و برای فعالیت‌های زیست‌شناختی مختلف آزمایش شده‌اند؛ در میان این تاکسون‌ها، سیانوباکتری‌ها به‌عنوان منابع غنی و جدید ترکیب‌های فعال زیستی شناسایی شده‌اند (8-17).

پپتیدها و دپسیپپتیدها[1] تعداد فراوانی از متابولیت‌های ثانویۀ سیانوباکتری‌ها را تشکیل می‌دهند. ویژگی ترکیب‌های یادشده اینست که شامل آمینواسیدهای غیرپروتئینی و آمینواسیدهای متیله‌شده‌اند و این ویژگی پپتیدهای بیوسنتزشده توسط پپتیدسنتتازهای غیرریبوزومی[3] (NRPSs) است (18). وجود ویژگی‌های ساختمانی متنوع در متابولیت‌های ثانویۀ تولید‌شده پیشنهاد می‌کند این پپتیدها با ماشین ریبوزومی وابسته به نوکلئیک‌اسید سنتز نمی‌شوند و تولید این محصولات حتی در حضور بازدارندههای ریبوزومی یا RNase گواه این ادعاست. درحقیقت، این آنزیم‌ها سوبسترای آمینواسیدی را با صرف ATP به‌شکل آمینوآسیل‌آدنیلات فعال می‌کنند. NRPSها بزرگ‌ترین آنزیم‌های با وزن مولکولی بیش از دو یا سه مگادالتون هستند و از واحدهای کاتالیتیک تکراری به نام مودول تشکیل شده‌اند که هر‌کدام حدود 1000 تا 1500 آمینواسید طول دارند. وظیفۀ مودول‌ها، اضافه‌کردن باقیمانده[4] به درون زنجیرۀ پپتیدی در‌حال رشد است. تعداد و ترتیب مودول‌ها درون یک NRPS با تعداد و توالی آمینواسیدهای تشکیل‌شده درون فراوردۀ پپتیدی منطبق است. یک مودول کامل حداقل سه دمین آنزیمی شامل دمین آدنیله‌شده[5] (A)، دمین تراکمی[6] (C) و دمین تیوله‌شده[7] (T) دارد. هر مودول که مسئول کاتالیز یک چرخۀ کامل طویل‌سازی زنجیره است شامل سه واکنش اساسی تشخیص پیش‌ماده، فعال‌سازی به‌شکل آسیل‌آدنیلات و پیوند کووالانسی به‌شکل تیواستر است؛ این فعالیت‌های آنزیمی به‌شکل دمین‌های کاتالیتیکی مجزا درون هر مودول جاسازی شده‌اند (19). دمین آدنیله‌شده نخستین مراحل سنتز پپتید غیرریبوزومی را کنترل می‌کند و پیش‌مادۀ آمینواسیدی را انتخاب و آن را به‌شکل آمینوآسیل‌آدنیلات فعال می‌کند. آمینواسید غیرپایدار آدنیلات پی‌در‌پی به پایین‌دست[8] دمین T (تیوله‌شده) منتقل می‌شود و به‌همین‌علت، دمین T پروتئین حامل پپتیدیل[9] (PCP) نیز نامیده می‌شود. دمین T نسبتاً کوچک (8 تا 10 کیلودالتون در مقایسه با دمین‌های 50 کیلودالتونی A و C) است. دمین تراکمی حدود 450 آمینواسید طول دارد و تشکیل پیوند پپتیدی را بین یک آمینوآسیل PCP یا peptidyl-PCP از مودول بالادست و باقیماندۀ آمینوآسیل متصل به مودول پایین‌دست مربوطه کاتالیز می‌کند. دمین تیواستراز[10] یا خاتمه[11] نیز حدود 250 باقیمانده دارد که برای آزادسازی فراورده ضروریست و آزادسازی پپتید بیوسنتزی را در شکل خطی، حلقوی یا منشعب کاتالیز می‌کند (20).

استفاده از سیانوباکتری‌ها در صنایع داروسازی از اواخر دهۀ 1970 میلادی آغاز و به کشف ترکیب‌های جدید با ویژگی‌های ضد‌ویروسی، ضد‌سرطانی، ضد HIV، ضد‌باکتریایی، ضد قارچی و سیتوتوکسیک در کاربردهای کلینیکی منتهی شده است. استفادۀ وسیع از آنتی‌بیوتیک‌ها که بیش از نیم قرن است برای معالجۀ انسان و حیوان به کار می‌روند، کاهش چشمگیر کارآمدی تأثیر تعداد زیادی از آنتی‌بیوتیک‌ها به‌واسطۀ تکامل تحمل باکتری‌ها را در پی داشته است؛ علاوه‌براین، تعداد آنتی‌بیوتیک‌های جدید معرفی‌شده در دنیای امروز کاهش چشمگیری داشته است و ازاین‌رو، جستجو برای یافتن متابولیت‌های دارای ویژگی‌های آنتی‌بیوتیکی جدید اهمیت ویژه‌ای دارد (20).

باوجود مطالعه‌های بسیار در زمینۀ پراکنش ژن‌های NRPS، هیچ‌کدام از آنها دربارۀ سویه‌های سیانوباکتریایی دریاچۀ لواسان نبوده و تاکنون منابع زیست‌فناوری آنها در ایران کمتر بهره‌برداری شده است (21). کشف ترکیب‌های شیمیایی جدید در سیانوباکتری‌ها می‌تواند به تکامل صنعت داروسازی منجر شود (12). مقاومت ایجاد‌شده به آنتی‌بیوتیک‌های فعلی به غربال‌گری ترکیب‌های زیست‌فعال جدید در سیانوباکتری‌ها منجر شده است؛ ازاین‌رو، جستجو برای کشف آنتی‌بیوتیک‌های جدید و بررسی حضور ژن‌های NRPS با سنتز ترکیبات ضدمیکروبی در ده سویۀ آب شیرین جزو نخستین پژوهش‌های انجام‌شده به‌منظور معرفی سویه‌های سیانوباکتریایی در تولید متابولیت‌های با منشأ دارویی است. در این راستا، جستجو برای آشکارسازی حضور ژن‌های پپتید‌سنتتازهای غیر‌ریبوزومی و ارتباط این ژن‌ها با حضور متابولیت‌های ثانویه در سیانوباکتری‌ها در دریاچۀ لواسان اهمیت بسیار زیادی دارد.

 

مواد و روشها

مکان و روش نمونه‌برداری: ‌نمونه‌های ‌آب ‌از ‌سطح تا عمق 10 سانتی‌متری دریاچۀ لواسان با بطری‌های پلاستیکی جمع‌آوری شدند؛ به این منظور، ظرف‌های جمع‌آوری به‌دقت و به‌آرامی چرخانده شدند تا از آب، گل‌و‌لای و جلبک‌ها پر شوند. هنگام نمونه‌برداری دقت شد تا بخش بالایی ظرف‌ها خالی بماند تا هوا به ‌میزان کافی وجود داشته باشد. نمونه‌برداری از ایستگاه‌های مختلف انجام شد و سپس نمونه‌ها به آزمایشگاه منتقل شدند (22 و 23).

تهیۀ محیط‌کشت BG-110: محیط‌کشت مایع استوک[12] BG-110 (بدون نمک‌های نیتروژنه) برای کشت و خالص‌سازی سیانوباکتری‌های راستۀ نوستوکالز[13] آماده شد. به‌منظورآماده‌سازی این محیط به‌شکل استوک، 500 میلی‌لیتر آب به‌مدت 15 دقیقه با CO2 هوادهی و سپس 1 میلی‌لیتر از محلول‌های استوک به آن اضافه و با آب به حجم 1 لیتر رسانده شد؛ درنهایت، محیط به‌مدت 15 دقیقه در 121 درجۀ سانتی‌گراد استریل شد. پس‌از استریل‌ و سردشدن محیط، اسیدیتۀ آن در حد 1/7 تنظیم شد (جدول 1) (22 و 23).

 

 

جدول 1- محیط‌کشت مایع BG-110 (استوک) برای رشد سیانوباکتری‌های راستۀ نوستوکالز (22)

محلول عناصر کمیاب

0/4 گرم‌در100میلی‌‌لیتر

K2HPO4 3H2O

86/2 گرم‌در‌لیتر

H2BO3

5/7 گرم‌در100میلی‌‌لیتر

MgSO4 7H2O

81/1 گرم‌در‌لیتر

MnSO4.4H2O

6/3 گرم‌در100میلی‌‌لیتر

CaCl2 2H2O

222/0 گرم‌در‌لیتر

ZnSO47H2O

6/0 گرم‌در100میلی‌‌لیتر

Citric acid

079/0 گرم‌در‌لیتر

CuSO45H2O

0/4 گرم‌در100میلی‌‌لیتر

Na2CO3

6/0 گرم‌در100میلی‌‌لیتر

Ferric ammonium citrate

1/0 گرم‌در100میلی‌‌لیتر

EDTA (disodium magnesium)

390/0 گرم‌در‌لیتر

Na2MoO42H2O

1 میلی‌لیتر

محلول عناصر کمیاب

0494/0 گرم‌در‌لیتر

Co(NO3)26H2O

1 لیتر

آب الکترودیونیزیشن  (Elix)

1 لیتر

آب الکترودیونیزیشن  (Elix)

 


اتاقک کشت سیانوباکتری‌های هتروسیست‌دار: پس‌از آماده‌سازی محیط‌کشت استریل، 20 میلی‌لیتر از آن زیر لامینار فلو به داخل ظرف‌های پتری حاوی 5 گرم خاک افزوده شد؛ سپس ظرف‌های پتری حاوی اینوکولوم سیانوباکتری‌ها داخل اتاقک رشد با شدت روشنایی 40 تا 60 میکرومول فوتون بر مترمربع بر ثانیه[14] و دمای 28 تا 30 درجۀ سانتی‌گراد قرار داده شدند (23). پس‌‌از دو ‌‌هفته، تعداد زیادی از ‌کلنی‌های سیانوباکتری‌ها در هر ظرف پتری دیده شدند.

تهیۀ محیط‌کشت جامد: به‌منظور جداسازی و خالص‌سازی سیانوباکتری‌های هتروسیست‌دار لازم است کشت و جداسازی در محیط‌کشت اختصاصی جامد انجام شود؛ به این منظور باید مقدار 10 گرم آگار به هر لیتر محیط‌کشت مایع BG-110 اضافه شود. پس‌از تهیۀ محیط‌کشت و جامدشدن آن، مقداری از هر کلنی با رنگ‌های مختلف به‌وسیلۀ لوپ برداشته و به‌شکل زیگزاگ روی محیط‌کشت جامد کشت شد؛ این کار در شرایط استریل و زیر لامینار فلو انجام شد. به‌منظور اطمینان از خالص‌بودن سیانوباکتری‌ها، سه تا پنج بار از کشت‌های به‌دست‌آمده کشت مجدد تهیه شد. ظرف‌های پتری پس‌از تلقیح در اتاقک مخصوص کشت قرار داده شدند و مدت انکوباسیون بین یک تا چهار هفته در نظر گرفته شد (22 و 23).

خالص‌سازی و تهیۀ کشت‌های تک ‌جلبکی به‌منظور بررسی تاکسونومیک مولکولی: حضور فیلامنت‌های متحرک یا هورموگونیوم با قابلیت سر‌خوردن روی ظرف پتری از ویژگی‌های راستۀ نوستوکالز است که برای جداسازی و خالص‌سازی این راسته استفاده می‌شود. ابتدا از روش رقیق‌سازی درون لوله استفاده شد و زیر لامینار فلو، رقت‌های متفاوتی از کشت مایعِ متعلق به هر گونه درون لوله آماده شد؛ به این منظور، ابتدا کلنی‌های نوستوک با سونیکیتور حمام آب (Sonorex Digital 10P) جدا شدند تا به‌شکل فیلامنت درآمدند و سپس با میکروسکوپ معکوس مشاهده شدند. لوله‌ای انتخاب شد که حاوی تعداد زیادی تک‌فیلامنت بود و سپس 1 میلی‌لیتر از آن زیر لامینار فلو به درون ظرف پتری حاوی محیط‌کشت جامد منتقل و در سراسر ظرف پتری منتشر شد؛ دور ظرف پتری با پارافیلم مسدود شد. پس‌از گذشت نیم ساعت که محیط مایع جذب شد، دوباره زیر میکروسکوپ مشاهده و هر مکانی که تک‌فیلامنت مشاهده شد با مارکر دائمی پشت و روی ظرف پتری مشخص شد. پس‌از گذشت دو هفته، فیلامنت‌های متحرک یا هورموگونیا روی سطح ظرف پتری حرکت و با این کار تا حدی خود را از دسترس باکتری‌ها و سایر موجودات تک‌یاخته‌ای دیگر رها کردند. گاهی ممکن است تراکم باکتری‌ها و سایر عوامل آلوده‌کننده به‌قدری زیاد شود که موجب نابودی تک‌فیلامنت شود و در مواردی هر تک‌فیلامنت و یا هورموگونیا پس‌از گذشت دو هفته، کلنی تشکیل دهد. باتوجه‌به اینکه کلنی رشدیافته روی سطح ظرف پتری حاصل رشد تک‌فیلامنت است، انتقال کلنی‌ها به درون محیط‌کشت تازۀ دیگر علاوه‌بر ایجاد کشت‌های تک‌جلبکی موجب خلوص و آکزنیک‌شدن[15] کشت‌ها می‌شود. انتقال کلنی‌ها به درون محیط‌کشت جامد تازه تا حد زیادی از تراکم عوامل آلوده‌کننده می‌کاهد. مراحل انتقال گاهی 5 یا 6 بار تکرار شد تا از خالص‌ و آکزنیک‌بودن کشت اطمینان حاصل شود (24-29).

آزمایش نمونه‌های آکزنیک توسط تلقیح[16] در محیط‌کشت R2ALAB163)(R2A: محیط R2Aبه‌طور آماده خریداری شد و ترکیبات آن در جدول 2 آورده شده است. 18 گرم از این محیط در 1 لیتر آب (الکترودیونیزیشن (Elix به کمک همزن مغناطیسی حل و سپس استریل شد. اسیدیتۀ محیط حدود 2/7 تنظیم شد؛ سپس 15 میلی‌لیتر محیط‌کشت درون هر ظرف پتری ریخته شد و پس‌از آماده‌شدن هر محیط، مقداری از نمونه‌کشت‌های آکزنیک‌شده با سر سرنگ استریل و زیر لامینار فلو به‌شکل نقطه‌نقطه دور‌تا‌دور ظرف پتری تلقیح شد. سعی شد از تمام سطح کشت آکزنیک نمونه‌برداری شود و سپس ظرف‌های پتری تلقیح شده به‌مدت 5 تا 7 روز در 22 درجۀ سانتی‌گراد یا به‌مدت 3 روز در30 درجۀ سانتی گراد قرار داده شدند. پس‌از رشد، وجودداشتن یا نداشتن کلنی در اطراف هر نقطه بررسی شد (30).

جدول 2- محیط‌کشت جامد R2A برای آزمایش نمونه‌های آکزنیک

عصارۀ مخمر

5/0 گرم

Meat peptone

5/0 گرم

Casamino acids

5/0 گرم

گلوکز

5/0 گرم

نشاسته

5/0 گرم

دی پتاسیم هیدروزن فسفات

3/0 گرم

منیزیم سولفات

05/0 گرم

سدیم پیروات

3/0 گرم

آگار

15/0 گرم

آب الکترودیونیزیشن  (Elix)

1 لیتر

 

شناسایی بر اساس ویژگی‌های ریخت‌شناختی نمونه‌ها: شناسایی ریخت‌شناختیسیانوباکتری‌ها با میکروسکوپ نوری مجهز به میکرومتر مدرج انجام شد. چندین نمونه برای شناسایی مطمئن آزمایش ‌شدند و شناسایی بر اساس کلیدهای شناسایی انجام شد (31-40). شاخص‌های مختلف شامل طول و قطر سلول‌های رویشی، هتروسیست و آکینت، ریخت‌شناسی سلول انتهایی، مسافت بین هتروسیست‌ها و مسافت بین هتروسیست و نزدیک‌ترین آکینت (محاسبه‌شده به‌عنوان تعداد سلول‌ها)، حضور یا نبود هتروسیست‌های انتهایی، شکل فیلامنت‌ها و تجمع در کلنی‌ها طی بررسی‌های ریخت‌شناختی مطالعه شدند.

شناسایی مولکولی سویه‌های سیانوباکتریایی بر اساس توالی 16S rRNA

استخراج DNA: استخراج DNA به روش دستی [17]CTAB انجام و برای تعیین کیفیت DNA از روش کیفی به کمک لودکردن روی ژل الکتروفورز (شکل 1) و روش کمی به کمک دستگاه نانودراپ (Thermo Scientific) spectrophotometer استفاده شد. کیفیت مطلوب DNA استخراج‌شده کیفیت مناسب باندها را تضمین می‌کند.

 

   

شکل 1- الکتروفورز DNA استخراج‌شده روی ژل آگارز 1 درصد (w/v)

 


تکثیر توالی ژن16S rRNA: به‌منظور تکثیر توالی ژن 16S rRNA، واکنش زنجیره‌ای پلیمراز (PCR) در حجم 50 میکرولیتر انجام شد. مخلوط اولیه در 9 تکرار (3 تکرار برای هر نمونه، 1 تکرار برای شاهد مثبت، 1 تکرار برای شاهد منفی و 1 تکرار برای جلوگیری از خطا) تهیه شد. از آغازگرهای رفت 27F1: 5'- AGAGTTTGATCCTGGCTCAG (8-27) (41) و برگشت 30–52)) 23S30Ra: 5'- CTTCGCCTCTGTGTGCCTAGGT (42) برای تکثیر توالی ژن 16S rRNA استفاده شد. برنامۀ PCR برای تکثیر ژن 16S rRNA در چهار چرخه طراحی شد:

چرخۀ اول (مرحلۀ شروع) در 94 درجۀ سانتی‌گراد به‌مدت 5 دقیقه انجام شد؛

چرخۀ دوم شامل سه مرحله بود: مرحلۀ اول شامل بازشدن[18] دو رشتۀ DNA در 94 درجۀ سانتی‌گراد به‌مدت 30 ثانیه بود؛ در مرحلۀ دوم (اتصال[19]) آغازگرها به تک‌رشته‌ای DNA الگو متصل شدند و این مرحله در 56 درجۀ سانتی‌گراد به‌مدت 30 ثانیه انجام شد؛ مرحله سوم (طویل‌شدن[20]) در 72 درجۀ سانتی‌گراد به‌مدت 2 دقیقه انجام شد؛.

چرخۀ سوم (طویل‌شدن نهایی[21]) در 72 درجۀ سانتی‌گراد به‌مدت 15 دقیقه انجام شد؛

چرخۀ چهارم (مرحلۀ نگهداری نهایی[22]) در 4 درجۀ سانتی‌گراد حفظ شد (شکل 2).

 

 

 

شکل 2- تصویر الکتروفورز محصولات PCR ژن 16S rRNA


غربال‌گری حضور ژنNRPS  در نمونه‌های سیانوباکتری شناسایی‌شده: تکثیر ژن NRPS با استفاده از آغازگرهای الیگونوکلئوتیدی دجنریت[23] MTF2/MTR MTF2 (5'-GCNGGYGGYGCNTAYGTNCC-3')  و MTR (5'-CCNCGDATYTTNACYTG-3') با هدف تکثیر دمین‌های آدنیله‌شده انجام شد (43). واکنش PCR در حجم 50 میکرولیتر و با استفاده از PCR Primus (MWG, Germany) انجام شد. تمام مواد لازم برای انجام واکنش PCR و آغازگرها از شرکت سیناژن خریداری شدند و درنهایت، PCR با شیب دمایی 35 تا 55 درجۀ سانتی‌گراد برای تعیین نقطۀ اتصال آغازگر به DNA انجام شد (شکل 3).

 

 

 

شکل 3- الکتروفورز فراورده‌های PCR 1 کیلو جفت‌ بازی NRPS متعلق به ده سویۀ سیانوباکتری

 


الکتروفورز ژل آگارز: به‌منظور انجام الکتروفورز، میزان 10 میلی‌لیتر از محلول 50X TAE با آب الکترودیونیزیشن (Elix) به حجم 500 میلی‌لیتر رسانده و برای بافر الکتروفورز استفاده شد. دو رنگ الکتروفورز (برومو فنل بلو و زایلن سیانول FF) برای تهیۀ لودینگ بافر استفاده و درنهایت، لودینگ بافر شامل 10 میلی‌مولار Tris-HCl (اسیدیتۀ 6/7)، برومو فنل بلو 03/0 درصد، گلیسرول 60 درصد، گزیلن سیانول 03/0 درصد و 60 میلی‌مولار EDTA آماده شد. 5 میکرولیتر از فراورده‌های PCR با 2 میکرولیتر لودینگ بافر مخلوط و با میکروپیپت درون چاهک ژل 1 درصد ریخته شد. ژل از تانک خارج و باند مدنظر با روشناییUV و دستگاه transilluminator .(Molecular Imager® Gel DocTM XR system (Bio-Rad)) ردیابی شد. عکس دیجیتالی با نرم‌افزار .QUANTITY ONE® 1-D V 4.6.7 analysis گرفته شد.

قطعۀ تقریباً 1 کیلوبایتی دمین آدنیله‌شدۀ NRPS و 1500 جفت بازی ژن 16S rRNAتوالی‌یابی شد. عمل ترادف‌گیری فراورده‌های PCR با توالی‌یاب خودکار مدل Beckman توسط شرکت Microgene (کره جنوبی) انجام شد.

.پیشگویی آمینواسید فعال‌شده به‌وسیلۀ مودول آدنیله‌شده و شناسایی نوع ترکیب احتمالی: آمینواسیدفعال‌شده به‌وسیلۀ مودول NRPS A با نرم‌افزار بر‌گرفته از سایت http://www.tigr.org/jravel/nrps  پیشگویی شد. ازآنجاکه توالی‌های به‌دست‌آمده از ژن NRPS به دمین حفاظت‌شدۀ آدنیله‌شده تعلق داشتند، ساختار سه‌بعدی آنها با استفاده از سایت جستجوی دمین‌های محافظت‌شده به آدرس http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi به دست آمد (44 و 45).

رسم درختان فیلوژنتیک و ثبت ژن: جستجوی بلاست نوکلئوتید[24] برای یافتن توالی‌های مشابه ژن 16S rRNA موجود در پایگاه داده‌های GenBank™ در NCBI انجام شد. توالی ژن 16S rRNA حاصل در بررسی حاضر به همراه توالی‌های مشابه گرفته‌شده از GeneBank با استفاده از برنامۀ CLUSTAL W (46) هم‌ردیف و سپس به‌طور دستی در برنامه‌های BioEdit نسخۀ 7 (47) و MEGA نسخۀ 7 (48) ویرایش شدند (شکاف‌های موجود در توالی‌ها پس‌از هم‌ردیف‌سازی حذف شدند). درخت فیلوژنی با استفاده از تجزیه‌وتحلیل Maximum Likelihood و مدل Kimura two-parameter رسم شد.

جستجوی بلاست X برای یافتن توالی‌های مشابه ژن NRPS موجود در پایگاه داده‌های GenBank™ در NCBI انجام شد. توالی‌های ژن NRPS به‌دست‌آمده در بررسی حاضر به همراه دیگر توالی‌های مشابه گرفته‌شده از GeneBank با استفاده از برنامۀ MUSCLE (49) هم‌ردیف شدند. به‌منظور رسم درخت از برنامۀ IQ-Tree و تجزیه‌وتحلیل maximum likelihood استفاده شد؛ سپس ویرایش درخت به کمک برنامۀ figtree انجام شد.

عملیات ثبت ژن با استفاده از نرم‌افزار bankit واقع در سایت http://www.ncbi.nlm.nih.gov/WebSub/?tool=genbank انجام شد. به‌منظور گرفتن کد دسترسی[25]، توالی‌های نوکلئوتیدی توالی‌یابی‌شدۀ دو سویه در پایگاه داده‌های (DDBJ)[26] ثبت شدند و به آنها رمز یا شمارۀ مخصوص آن توالی تعلق گرفت.

بررسی آثار ضدمیکروبی با استفاده از روش انتشار[27]:در روش انتشار (50)از عصارۀ سیانوباکتریایی حل‌شده در حلال متانولی به‌عنوان بازدارندۀ رشد باکتری‌ها و قارچ‌ها استفاده و نتیجه به‌شکل هالۀ حاوی ریزموجودات رشدنکرده ظاهر شد. اندازۀ هاله نشان‌دهندۀ غلظت و قدرت بازدارندگی عصارۀ نمونۀ موردآزمایش است و درحقیقت، ارتباطی خطی بین اندازۀ هاله و غلظت مادۀ آزمایش‌شده وجود دارد که با اندازه‌گیری فاصله‌ای که مادۀ آزمایش‌شده در آن منتشر شده است و به‌شکل رشدکردن یا نکردن میکروب آزمایش‌شده مشخص می‌شود. در انتشار، مادۀ آزمایش‌شده به‌شکل افقی از مرکز به اطراف منتشر می‌شود و هاله‌های رشد یا عدم‌رشد را ایجاد می‌کند و درنهایت، قطر هاله اندازه‌گیری می‌شود.

انتخاب دیسک‌های کاغذی: روش دیسک کاغذی بیشترین کاربرد را دارد و محلول‌های مورد‌آزمایش با سمپلر روی دیسک‌های کاغذی قرار می‌گیرند. کاغذ مورداستفاده برای تهیۀ دیسک ویژگی‌های مناسبی ازنظر ضخامت، مقاومت در محلول عصاره، قدرت جذب محلول عصاره، بافت شبکۀ فیبری، مقاومت در برابر حرارت استریل‌شدن، دوام و استحکام مناسب و عدم‌پرزدهی دارد. دیسک‌های استفاده‌شده در پژوهش حاضر از شرکت پادتن طب تهیه شدند و شرایط استاندارد برای تبدیل به دیسک‌های آنتی‌بیوتیکی را داشتند. قطر هر دیسک 8/6 میلی‌متر بود.

آماده‌سازی عصاره‌ها: آماده‌سازی عصاره‌های سیانوباکتریایی در فاز ایستایی رشد (روز 15) انجام شد؛ به‌این‌ترتیب که زیتودۀ حاصل به کمک کاردک پلاستیکی از سطح هر ظرف پتری جمع‌آوری و به‌مدت 1 ساعت در گرمخانۀ 60 درجۀ سانتی‌گراد قرار داده شد (51). 500 میلی‌گرم از زیتودۀ خشک‌شده در دمای 60 درجۀ سانتی‌گراد داخل چندین میکروتیوب‌ تقسیم شد (هرکدام 100 میلی‌گرم) و به هر‌کدام 300 میلی‌گرم میلۀ شیشه‌ای 5/0 میلی‌متری (Scientific Industries Disruptor Beads) و 1 میلی‌لیتر حلال اضافه شد؛ ورتکس به‌مدت نیم ساعت انجام شد تا دیوارۀ اسکلتی عصاره‌ها کاملاً از بین برود. مخلوط به‌مدت 5 دقیقه در 10000 دوردردقیقه سانتریفیوژ و سپس بخش رویی برای بررسی ویژگی‌های ضدمیکروبی در 4 درجۀ سانتی‌گراد نگهداری شد.

ریزموجودات آزمایش‌شده به‌منظور بررسی ویژگی‌های ضدمیکروبی: دو باکتری گرم مثبتStaphylococcus aureus (PTCC 1112) ، Bacillus cereus (PTCC 1015)، دو باکتری گرم منفی Escherichia coli (PTCC 1047) و Enterobacter sp. 638، یک مخمر Candida albilancs (ATCC 10231) و قارچ‌های پاتوژنیک Aspergillus niger (ATCC 16404) و Fusarium sp.در این بررسی استفاده شدند.

تهیۀ محیط‌کشت باکتریایی: برای کشت 24ساعتۀ باکتری‌ها از محیط‌کشت مولر- هینتون آگار[28] استفاده شد؛ به‌این‌ترتیب که 34 گرم پودر مولر هینتون آگار و 5/0 میکروگرم متیلن‌بلو در 1 لیتر آب مقطر به کمک همزن مغناطیسی روی هیتر حل شد. متیلن‌بلو کمک می‌کند قطر منطقه بازدارندگی[29] (IZ) پس‌از جامدشدن محیط و قراردادن دیسک‌های کاغذی با وضوح بیشتر مشاهده و اندازه‌گیری شود. به‌منظور تهیۀ محیط آبگوشت غذایی برای باکتری‌ها و سنجش حداقل غلظت بازدارندگی، 13 گرم پودر نوترینت‌براث[30] به 1 لیتر آب مقطر اضافه و به همراه همزن مغناطیسی روی هیتر قرار داده شد. پس‌از شفاف‌شدن محیط، استریل‌‌کردن انجام شد.

تهیۀ محیط‌کشت قارچی: محیط سابرو دکستروز آگار[31] برای بررسی اثر ضدقارچی انتخاب و به میزان 25 گرم‌در‌لیتر به همراه 5/0 میکروگرم متیلن‌بلو بر اساس دستور یاد‌شده برای محیط‌کشت مولر تهیه شد. محیط تهیه‌شده پس‌از استریل‌شدن و در مجاورت شعله درون ظرف‌های پتری استریل‌شده پخش شد. به‌منظور تهیۀ سوسپانسیون قارچی برای سنجش حداقل غلظت بازدارندگی از محیط‌کشت مایع سابرو دکستروز براث[32] 30 گرم‌در‌لیتر استفاده شد. استریل‌کردن محیط‌کشت‌ها در اتوکلاو با دمای 121 درجۀ سانتی‌گراد و فشار 5/1 اتمسفر به‌مدت 15 تا 20 دقیقه انجام شد.

آماده‌سازی باکتری‌ها و قارچ‌ها پیش‌از آغاز آزمایش: پیش‌از آغاز آزمایش، باکتری‌ها و قارچ‌ها آماده‌سازی شدند؛ به‌این‌ترتیب کهCandida albicans در محیط سابرو دکستروز آگار به‌مدت 24 ساعت در 28 درجۀ سانتی‌گراد و Aspergillus niger در محیط سابرو دکستروز آگار به مدت 7 روز در 28 درجۀ سانتی‌گراد رشد داده شدند. باکتری‌ها در محیط مولر هینتون آگار به‌مدت 24 ساعت در 35 درجۀ سانتی‌گراد رشد داده شدند. کلنی‌های رشد‌یافتۀ C. albicans و باکتری‌ها به 2 میلی‌لیتر محلول نمکی )سدیم‌کلرید 145/0 مولار) منتقل شدند تا سوسپانسیون تشکیل شود و سپس کدورت هر سوسپانسیون با استاندارد مک‌‌فارلند[33] 5/0 تنظیم شد. به‌منظور تهیۀ لولۀ 5/0 مک‌فارلند، 175/1 درصد کلریدباریوم به 95/9 میلی‌لیتر سولفوریک‌اسید 1 درصد اضافه شد؛ کدورت ایجاد‌شده تقریباً معادل 108×5/1 واحد تشکیل‌دهنده کلنی در میلی‌لیتر باکتری بود. کلنی‌های رشد‌یافتۀ A. flavus به محلول نمکی با همان غلظت منتقل شدند و کدورت سوسپانسیون مربوطه با دستگاه اسپکتروفوتومتر میکروپلیت (Infinite M200, Tecan) در طول موج 530 نانومتر بین 09/0و 11/0 تنظیم شد.

روش تلقیح سوسپانسیون آماده‌شده: تلقیح سوسپانسیون آماده‌شده به این شکل انجام شد کهسواپ در مجاورت شعله و در شرایط کاملاً استریل زیر لامینار فلو درون لولۀآزمایش حاوی سوسپانسیون باکتریایی یا قارچی با کدورت تنظیم‌شده وارد شد و مایع اضافی با فشار محکم سواپ به داخل لوله از بالای سطح محیط‌کشت خارج شد؛ سپس سواپ به‌شکل یکنواخت در تمام سطح محیط‌کشت آگار و در سه جهت با چرخش 60 درجه کشیده شد.

آماده‌سازی دیسک‌های کاغذی با عصاره‌های سیانوباکتریایی: پس‌از آماده‌سازی محیط‌کشت باکتری‌ها و قارچ‌ها و تلقیح‌کردن هر ظرف پتری با سوسپانسیون باکتریایی و قارچی با کدورت تنظیم‌شده، برای شاهد مثبت هر دیسک با 100 میکرولیتر عصارۀ سیانوباکتریایی با حلال مربوطه تلقیح شد. ظرف‌های پتری با پارافیلم بسته شدند و به‌مدت 24 ساعت در گرمخانۀ 37 درجۀ سانتی‌گراد برای باکتری‌ها و به‌مدت 24 تا 48 ساعت در 27 درجۀ سانتی‌گراد برای قارچ‌ها قرار داده شدند. قطر مناطق بازدارندۀ رشد شامل قطر دیسک کاغذی با خط‌کش اندازه‌گیری و به میلی‌متر بیان شد.

روش‌های آماری: تجزیه‌وتحلیل‌های آماری داده‌های هر آزمایش با نرم‌افزار SPSS (نسخۀ 22) انجام شد؛ تمام داده‌ها حاصل 3 تکرار بودند. تفاوت معنادار بین عوامل اندازه‌گیری‌شده با تجزیه‌وتحلیل واریانسیک‌طرفهبا حدود اطمینان 95 درصد انجام شد. به‌منظور مقایسۀ میانگین‌ها، پس‌از انجام چندین بار تجزیه‌وتحلیل‌ و مطالعۀ چندین مقاله از آزمون توکی استفاده شد.

 

نتایج

.نتایج بررسی تاکسونومی به روش ریخت‌شناسی و مولکولی سیانوباکتری‌های واقع در دریاچۀ لواسان: درکل، 22 سویۀ سیانوباکتری مختلف متعلق به سه خانوادۀ Nostocaceae، Scytonemataceae و Rivulariaceae و جنس‌های Nostoc، ScytonemaوCalothrixگزارش شدند.نتایجِ سه بار تکرار تکثیر ژن NRPS نشان دادند 6 سویه متعلق به جنس Nostoc، 1 سویه متعلق به Calothrixو سه سویه متعلق به Scytonemaاز 22 سویه این ژن را دارند. شکل 4 عکس‌های میکروسکوپی ده سویۀ خالص‌شده را نشان می‌دهد.

 

 

 

     

C

B

A

     

F

E

D

     

I

H

G

 

 

 

 

 

J

شکل 4- سویه‌های سیانوباکتریایی بومی یافت‌شده در دریاچۀ لواسان؛ A. Nostoc sp. F3، B. Nostoc sp. F4، C. Nostoc sp. F19، D. Nostoc sp. F25، E. Nostoc sp. F17، F. Nostoc sp. Ft salt، G. Calothrix sp. F6، H. Scytonema sp. F18، I. Scytonema sp. F12، J. Scytonema sp. Ft11


نتایج تعیین غلظت DNA:نتایج تعیین غلظت DNA از طریق لودکردن روی ژل الکتروفورز (شکل 1) نشان دادند کیفیت مطلوب DNA استخراج‌شده کیفیت مناسب باندها را تضمین می‌کند. اندازه‌گیری شدت جذب DNA با استفاده از نانودراپ در طول موج‌های 260 و 280 نانومتر نشان داد میزان 280/260 حدود 8/1 است که این میزان، خلوص DNA استخراج‌شده را نشان می‌دهد. میزان 230/260 برای اندازه‌گیری ثانویۀ خلوص نوکلئیک‌اسید استفاده شد. ارزش‌های 230/260 بین 0/2 تا 2/2 گزارش شد؛ البته اگر این میزان کمتر از حد انتظار بود، حضور آلوده‌کننده‌ها را نشان می‌داد که در 230 نانومتر جذب می‌شوند.

نتایج تکثیر ژن 16S rRNA:مطابق شکل 2، اندازۀ باندها در همۀ نمونه‌ها با‌توجه‌به مارکر (M)، 1500 جفت باز است. همان‌طور که مشخص است، باند حاصل از فراوردۀ PCR کیفیت زیادی دارد و این کیفیت، ترادف‌گیری موفقیت‌آمیز توالی‌ها را تضمین می‌کند.

نتایج تجزیه‌وتحلیل درخت فیلوژنتیک ژن16S rRNAده سویۀ ‌بررسی‌شده: شکل 5 درخت فیلوژنتیک بدون ریشۀ حاصل از برنامۀ MEGA نسخۀ 7 را نشان می‌دهد. پس‌از هم‌ردیف‌سازی تمام توالی‌های گرفته‌شده از بانک ژن، درخت فیلوژنتیک با استفاده از روش Maximum Likelihood، برنامۀ MEGA نسخۀ 7 و مدل Kimura two-parameter ترسیم شد. اعداد کنار هر گرۀ انشعابی نشان‌دهندۀ فراوانی حاصل از تجزیه‌وتحلیل Bootstrap برای 1000 تکرارند. با‌توجه‌به درخت فیلوژنتیک رسم‌شده، هر شاخه روابط بین تاکسون‌ها را ازنظر نسل یا جد (نیاکان) معین می‌کند. طول شاخه بیان‌کنندۀ میزان تفاوت‌ها نسبت به نیای مشترک است؛ درحقیقت، طول شاخه تعداد تغییرهایی را نشان می‌دهد که در یک شاخه رخ داده‌اند. درخت رسم‌شده به روش Maximum Likelihood نشان می‌دهد سویۀ Calotrix sp. F6 با حمایت زیاد Bootstrap (100 درصد) با سویۀ Calatrix derestica خوشه‌بندی می‌شود و در یک کلاد[34] قرار می‌گیرد؛ به بیان دیگر، سویۀ مطالعه‌شده بیشترین نزدیکی را با سویۀ Calatrix derestica دارد. سویه‌های Scytonema sp. Ft11 و Scytonema sp. F12 با حمایت زیاد Bootstrap به‌ترتیب 80 و 85 درصد در یک کلاد خوشه‌بندی می‌شوند. سویۀ Scytonema sp. F18 با حمایت زیاد Bootstrap (99 درصد) با سویۀ HAN3- 2.Scytonema sp. خوشه‌بندی می‌شود و در یک کلاد قرار می‌گیرد. سویۀ Nostoc sp. F19 با حمایت زیاد Bootstrap (74 درصد) با سویۀ Nostoc calcicda خوشه‌بندی می‌شود و در یک کلاد قرار می‌گیرد. سویه‌های Nostoc sp. F17 و Nostoc sp. F25 با حمایت زیاد Bootstrap به‌ترتیب 70 و 74 درصد، کلاد جداگانه‌ای را تشکیل می‌دهند که فاصلۀ فیلوژنیتکی بین آنها و سویه‌های دیگر را ازنظر تکاملی نشان می‌دهد. مقیاس نشان‌داده‌شده در شکل 5، 2/0 جهش به‌ازای هر نوکلئوتید را نشان می‌دهد.

 

 

شکل 5- درخت فیلوژنتیک بدون ریشۀ حاصل از برنامۀMEGA   نسخۀ 7

 


.نتایج تکثیر قطعۀ یک کیلو جفت بازی ژن NRPS: تکثیر قطعۀ تقریباً یک کیلو جفت بازی دمین آدنیله‌شدۀ NRPS از DNA الگوی سویه‌های مطالعه‌شده به‌طور موفقیت‌آمیز انجام شد (شکل 3). پس‌از انجام توالی‌یابی، جستجوی BLASTX تأیید کرد توالی‌های به‌دست‌آمده با دمین‌های آدنیله‌شدۀ سویه‌های دیگر سیانوباکتریایی موجود در بانک ژن مشابهند.

.تجزیه‌وتحلیل فیلوژنی دمین‌های آدنیله‌شدۀ ژن NRPS ده سویه سیانوباکتری: تکثیر دمین‌های آدنیله‌شدۀ NRPS از DNA الگوی ده سویۀ سیانوباکتریایی به‌طور موفقیت‌آمیز انجام شد (شکل 3). به‌منظور تأیید اینکه فراورده‌‌های تکثیر‌شده دمین‌های آدنیله‌شدۀ NRPS هستند، توالی‌یابی انجام شد. قطعۀ تقریباً یک کیلو جفت بازی دمین آدنیله‌شدۀ NRPS ترادف‌گیری شد. جدول 3 توالی امضا[35]، نام ترکیب و آمینواسید پیش‌بینی‌شده برای ده سویه را نشان می‌دهد؛ علاوه‌براین، ساختمان سه‌بعدی توالی‌های به‌دست‌آمده از ژن NRPS، متعلق به دمین حفاظت‌شدۀ آدنیله‌شدۀ ده سویۀ بررسی‌شده با استفاده از سایت جستجوی دمین‌های حفاظت‌شده رسم شد (شکل 6). شکل 7 درخت فیلوژنتیک رسم‌شده با استفاده از برنامۀ IQtree server و روش Maximum Likelihood را نشان می‌دهد. پس‌از هم‌ردیف‌کردن توالی‌های گرفته‌شده از بانک ژن با BLASTx، درخت فیلوژنتیک رسم‌شده به کمک برنامۀ fig tree تصحیح شد. درستی روابط بین تاکسون‌ها با تجزیه‌وتحلیل Bootstrap انجام‌شده برای 1000 تکرار تأیید شد. سویه‌های مطالعه‌شده در درخت فیلوژنتیک با حمایت زیاد با سویه‌های هم‌نام خود در یک کلاستر قرار گرفتند که نزدیکی فیلوژنتیک آنها را نشان می‌دهد (جدول 4).

 

جدول 3- آمینواسید فعال‌شده توسط دمین‌های آدنیله‌شدۀ توالی‌های NRPS؛ تجزیه‌وتحلیل توالی‌های NRPS یافت‌شده با BLASTx، همراه با کد دسترسیدر بانک ژن، شناسایی آمینواسید فعال‌شده به‌وسیلۀ مودول آدنیله‌شدۀNRPS و نام احتمالی ترکیب تولید‌شده به همراه توالی امضا دیده می‌شود.

نام سویه

ترکیب

توالی امضا

آمینواسید پیش‌بینی‌شده

Nostoc sp.F3

tyrocidine synthetas...

D A W T V A G I

TycB-M3-D-/L-Phe/Trp

Nostoc sp.F4

tyrocidine synthetas...

D A W I V A G V

TycB-M3-D-/L-Phe/Trp

Calothrix sp.F6

Microcistin synthetase A

D L F N N A L T

McyA-M2-Gly

Scytonema sp.Ft11

Nostopeptolide synthetase

D V W H I S L I

NosA-M2-Ser

Scytonema sp.F12

Surfactin synthetase B

D L T K I G H V

SrfAB-M2-Asp

Nostoc sp.F17

Nostopeptolide synthetase

D V W H I S L I

NosA-M2-Ser

Scytonema sp.F18

Microcistin synthetase A

D L F N N A L T

McyA-M2-Gly

Nostoc sp.F19

Microcistin synthetase A

X X X N N A L T

McyA-M2-Gly

Nostoc sp.F25

Nostopeptolide synthetase

D V W H I S L I

NosA-M2-Ser

Nostoc sp.Ftsalt

tyrocidine synthetase..

D A W T V A G V

TycB-M3-D-/L-Phe/Trp

 

       

D

C

B

A

       

H

G

F

E

 

 

   

 

 

J

I

شکل 6- ساختار سه‌بعدی توالی‌های به‌دست‌آمده از ژن NRPS، متعلق به دمین حفاظت‌شدۀ آدنیله‌شدۀ ده سویۀ بررسی‌شده؛ A. Nostoc sp. F3، B. Nostoc sp. F4، C. Nostoc sp. F19، D. Nostoc sp. F25، E. Nostoc sp. F17، F. Nostoc sp. Ft salt، G. Calothrix sp. F6، H. Scytonema sp. F18، I. Scytonema sp. F12، J. Scytonema sp. Ft11

 

شکل 7- درخت فیلوژنتیک ژن NRPS ده سویۀ ‌بررسی‌شده؛ مقیاس نشان‌داده‌شده در شکل، 1/0 جهش را به‌ازای هر وضعیت آمینواسید نشان می‌دهد.

جدول 4- نوع ترکیب و آمینواسید پیش‌بینی‌شده با بیشترین نزدیکی فیلوژنتیک به سویه‌های بررسی‌شده

نمونه

آمینواسید

ترکیب

WP_096687816_1

Asp

surfactin synthetase B

WP_096589775_1

Asp

surfactin synthetase B

Scytonema_sp_F12

Asp

surfactin synthetase B

WP_073634571_1

Asp

surfactin synthetase B

WP_069068160_1

Gly

Microcistin synthetase A

ASA69432_1

Hty

Anabaenopeptilide synthetase B

ASR75188_1

NO HIT

 

WP_069068162_1

Trp

tyrocidine synthet...

Nostoc_sp_F3

Trp

tyrocidine synthet...

WP_094341259_1

Trp

tyrocidine synthet...

WP_073640236_1

Asn

Nostopeptolide synthetase

WP_073640234_1

Trp

tyrocidine synthet...

Nostoc_sp_Ftsalt

Trp

tyrocidine synthet...

Nostoc_sp_F4

Trp

tyrocidine synthet...

WP_041033271_1

Gly

Microcistin synthetase A

Scytonema_sp_F18

Gly

Microcistin synthetase A

WP_096562233_1

Gly

Microcistin synthetase A

Calothrix_sp_F6

Gly

Microcistin synthetase A

WP_096647410_1

Gly

Microcistin synthetase B

WP_073643010_1

Gly

Microcistin synthetase A

WP_096537455_1

Gly

Microcistin synthetase A

ACV53800_1

Gly

Microcistin synthetase A

Nostoc_sp_F19

Gly

Microcistin synthetase A

ACV53799_1

Gly

Microcistin synthetase A

WP_073629400_1

Ser

Phosphitricin synthetase

WP_096549593_1

Ser

Phosphitricin synthetase

WP_063779441_1

Ser

Phosphitricin synthetase

WP_096562230_1

Ser

Phosphitricin synthetase

WP_073629390_1

Ser

Phosphitricin synthetase

WP_015217385_1

Ser

Nostopeptolide synthetase

Scytonema_sp_Ft11

Ser

Nostopeptolide synthetase

WP_073634573_1

Ser

Nostopeptolide synthetase

BAB74347_1

Ser

Nostopeptolide synthetase

WP_015139593_1

Ser

Nostopeptolide synthetase

Nostoc_sp_F25

Ser

Nostopeptolide synthetase

Nostoc_sp_F17

Ser

Nostopeptolide synthetase

WP_066382496_1

Ser

Nostopeptolide synthetase

WP_096681347_1

Ser

Nostopeptolide synthetase

WP_067767842_1

Ser

Pyoverdin synthetase

 


.نتایج ثبت توالی نوکلئوتیدی و پروتئینی ژن‌های تکثیر‌شده: توالی‌های نوکلئوتیدی توالی‌یابی‌شدۀ ده سویه بر اساس توالی ژن 16S rRNA و NRPS به همراه توالی پروتئینی دمین آدنیله‌شده در پایگاه داده‌های DDBJ ثبت شدند (جدول 5).

.نتایج بررسی اثر ضدباکتریایی و ضدقارچی عصاره‌های متانولی ده سویۀ بررسی‌شده: بررسی فعالیت ضدقارچی ده سویۀ بررسی‌شده نشان داد تنها عصاره‌های sp. F17 Nostoc، sp. F18 Scytonema و Nostoc sp. Ft salt فعالیت ضدقارچی دارند (شکل 8، A-C). قطر منطقۀ بازدارندگی بر حسب میلی‌متر و به‌شکل Means ± SE در جدول 6 نشان داده شده است. بر اساس نتایج تجزیه‌وتحلیل آماری (آزمون توکی)، تفاوت معناداری ازنظر فعالیت ضدقارچی در برابر قارچ Fusariumبین sp. F18 Scytonemaوsp. F17 Nostocو استانداردوجود ندارد ((P<0.01؛ علاوه‌براین، تنها عصارۀ به‌دست‌آمده از گونۀ sp. Ft saltNostoc تأثیر ضدمیکروبی بر قارچ Aspergillus flavusنشان داد و عصاره‌های به‌دست‌آمده از سایر گونه‌ها تأثیر ضد‌میکروبی بر این قارچ نداشتند. هیچ‌کدام از عصاره‌ها تأثیر ضد‌میکروبی بر مخمر Candida albicansنشان ندادند (شکل 8، D-F). .نتایج تجزیه‌وتحلیل آماری (آزمون توکی) قطر منطقۀ بازدارندگی حاصل از فعالیت ضدباکتریایی در برابر Staphylococcus aureusنشان دادند تنها سه سویۀ Nostoc sp. F17، Scytonema sp. F18 وNostoc sp. Ft salt خواص ضدباکتریایی دارند؛ در این میان، تفاوت معناداری ازنظر فعالیت ضدباکتریایی بین دو سویۀ  sp.F18 Scytonema و sp.Ft salt Nostocمشاهده نشد ((PNostoc با سویه‌های sp.F18 Scytonema و sp.Ft salt Nostoc معنادار بود ((P. نتایج تجزیه‌وتحلیل آماری (آزمون توکی) قطر منطقۀ بازدارندگی حاصل از فعالیت ضدباکتریایی در برابر Enterobacter sp. نشان دادند تنها دو سویۀ sp.F19 Nostoc و sp.F25 Nostocخواص ضدباکتریایی دارند؛ در این میان، تفاوت معناداری ازنظر فعالیت ضدباکتریایی بین دو سویۀ Nostoc sp.F19، Nostoc sp.F 25و استاندارد یافت نشد ((PBacillus cereus نشان دادند تنها دو سویۀNostoc sp. F3 و Nostoc sp. F4 خواص ضدباکتریایی دارند؛ در این میان، تفاوت بین سویه‌های Nostoc sp. F3 و Nostoc sp. F4 معناداری بود، اما تفاوت بین sp. F3 Nostoc و استاندارد معنادار نبود ((P

 

 

جدول 5- کدهای دسترسی توالی‌های نوکلئوتیدی و پروتئینی توالی ژن 16S rRNA و NRPS

 

توالی نوکلئوتیدی (16S rRNA)

توالی نوکلئوتیدی (NRPS)

توالی پروتئینی (NRPS)

Nostoc sp.F3

MG549314.1

MG548370.1

AUZ99711.1

Nostoc sp.F4

MG549315.1

MG548371.1

AUZ99811.1

Calothrix sp.F6

MG549308.1

MG548365.1

AUZ99707.1

Scytonema sp.Ft11

MG549309.1

MG548366.1

AUZ99708.1

Scytonema sp.F12

MG549312.1

MG548368.1

AUZ99709.1

Nostoc sp.F17

MG549310.1

MG548367.1

AUZ99800.1

Scytonema sp.F18

MG549319.1

MG548373.1

AUZ99713.1

Nostoc sp.F19

MG549313.1

MG548369.1

AUZ99710.1

Nostoc sp.F25

MG549317.1

MG548372.1

AUZ99712.1

Nostoc sp.Ftsalt

MG549320.1

MG548374.1

AUZ99714.1

 

     

C

B

A

     

F

E

D

     

I

H

J

 

 

 

 

 

J

شکل 8- وجود هاله در نمونه‌های Nostoc sp.F17 (B) و Scytonema sp.F18 (A) در برابر قارچ Fusarium sp. و Nostoc sp. Ft salt C)) در برابر قارچ Aspergillus niger، وجود هاله در نمونه‌های Nostoc sp.F17 (D)، Scytonema sp.F18 (E) و sp.F saltNostoc(F) در برابرStaphylococcus aureus، وجود هاله در نمونه‌های Nostoc sp.F19(G) و Nostoc sp.F25 (H) در برابر Enterobacter sp.، وجود هاله در نمونه‌های Nostoc sp.F3 (I) و Nostoc sp.F4 (J) در برابرBacillus cereus

جدول 6- میزان فعالیت ضدقارچی عصاره‌های Nostoc sp.F17، Scytonema sp.F18 و Nostoc sp.salt در شرایط فتوتروف؛ قطر منطقۀ بازداری‌شده بر حسب میلی‌متر و به‌شکل Means ±SE نشان داده شده است. حرف‌های b و ab نشان می‌دهند عصاره‌های بررسی‌شده تفاوت معناداری ازنظر فعالیت ضدقارچی ندارند.

Nostoc sp. Ft salt

Scytonema sp. F18

Nostoc sp. F17

Fusarium sp.

-

1.1±0.05(ab)

0.9±0.05(b)

Aspergillus niger

1.23±0.08

-

-

 

جدول 7- میزان فعالیت ضدباکتریایی عصاره‌های بررسی‌شده. قطر منطقۀ بازدارندگی بر حسب میلی‌متر و به‌شکل Means±SE نشان داده شده است. حرف‌های a، b و c تفاوت معنادار در فعالیت ضدباکتریایی را نشان می‌دهند؛ به‌این‌ترتیب که سویه‌هایی که حرف‌های مشابه دارند، تفاوت معناداری در این زمینه ندارند و سویه‌های که حرف‌های مشابه ندارند، تفاوت معنادار دارند.

 

Nostoc sp. Ft salt

Nostoc sp. F25

Nostoc sp. F19

Scytonema sp. F18

Nostoc sp. F17

Nostoc sp. F4

Nostoc sp. F3

Staphylococcus aureus

1±0(c)

-

-

1.03 ±0.03(c)

0.03 ± 0.83(b)

-

-

Enterobacter sp

-

1.36±0.06(a)

1.3±0.05(a)

-

-

-

-

Bacillus cereus

-

-

-

-

-

0.9±0.1(b)

2.23±0.39(a)

 


بحث

فراوانی اکوسیستم‌های طبیعی در ایران، انجام پژوهش‌های علمی در زمینه‌های مختلف را در این مناطق ضروری کرده است. در پژوهش حاضر، نمونه‌برداری از آب‌های جاری شهر لواسان واقع در دامنه‌های جنوبی کوه‌های البرز انجام و برای افزایش تعداد و رشد سیانوباکترها از محیط BG110 استفاده شد. نخستین‌بار Stainer و همکارانش در سال 1971 از این محیط برای کشت سیانوباکترها استفاده کردند و از آن به بعد، این محیط‌کشت به‌عنوان محیط مغذی برای رشد و جداسازی سیانوباکترها معرفی و به کار گرفته شد (22). در پژوهش حاضر، تعداد ده سیانوباکتر با استفاده از محیط‌کشت یادشده جدا و خالص‌ شدند و سپس برای جستجوی ژن‌های تولید‌کنندۀ ترکیبات آنتی‌بیوتیکی و ژن‌های NRPS با فعالیت ضد‌میکروبی غربال‌گری شدند. آثار پزشکی درمانی سیانوباکتری‌ها نخستین‌بار در اوایل 1500 پیش‌از میلاد با استفاده از گونه‌های Nostocبرای درمان نقرس و انواع مختلف سرطان آشکار شدند و سپس پژوهشگران دانشگاه Hawaii طی سال‌های دهۀ 1990، جداسازی سویه‌های سیانوباکتریایی Microcystis و  Anabaenaرا با هدف کشف فعالیت‌های زیستی گوناگون آغاز کردند؛ پس‌ازآن، تقریباً 4000 سویه سیانوباکتری دریایی و آب شیرین طی پژوهش Leflaive و Ten-Hage در سال 2007 جدا شدند؛ نتایج این پژوهش (6 درصد فعالیت ضدسرطانی و ضدتکثیر‌شوندگی) سیانوباکتری‌ها را منابع غنی از فراورده‌های طبیعی مفید معرفی کردند (52-57). سال‌ها بعد، چندین آزمایش دیگر با هدف شناسایی ویژگی‌های ضدباکتریایی، ضدقارچی، ضدویروسی (AIDS)، ضدسرطانی، فعالیت ضدمالاریایی، فعالیت بازدارندگی پروتئازی، فعالیت سیتوتوکسیک، فعالیت ضدپروتوزوال و فعالیت‌های دیگر انجام شدند؛ درحقیقت، جستجوی سیانوباکتری‌ها به‌عنوان منابع جدید آنتی‌بیوتیک‌ها، افق تازه‌ای را برای کشف داروهای جدید گشوده است (58-65). ترکیب‌های فعال‌ زیستی در سیانوباکتری‌ها محدودۀ وسیعی از فعالیت‌های زیستی مانند فعالیت‌های ضد‌باکتریایی، ضد‌قارچی، ضد‌ویروسی و سیتوتوکسیک و گاهی فعالیت‌ بازدارندگی پروتئاز را دارند (66-70). بررسی‌های مختلفی در زمینۀ آثار ضد‌میکروبی عصاره‌های Nostoc(71)، Phormidium (72)، Anabaena،Oscillatoria،Pseudoanabaena و Synechocystis(73-75)، Oscillatoria anguistisima وCalothrix parietina(76)روی موجودات مختلف بیماری‌زا و در زمینۀ آثار ضد‌باکتریایی عصاره‌های Fischerella sp.، Spirulina platensis، Anabaena variabilis، Nostoc sp. CCC537، Oscillatoria، Anabaena، Nostoc،Synechocystis، Synechococcus و دیگر گونه‌های متعلق به راسته‌های Chroococales، Pleurocapsales، Oscilatoriales، Nostocales و Stigonematales انجام شده‌اند (77-87).

فعالیت ضدمیکروبی ترکیب‌های سیانوباکتریایی راستۀ کروکوکال‌ها[xxxvi] (برای نمونه، Synechoccystis و Synechoccocus) کمتر بررسی شده است. Martins و همکاران در سال 2008، پتانسیل این جنس‌ها را به‌عنوان منابع درخور توجهی از ترکیب‌های آنتی‌بیوتیکی با آثار بازدارندگی روی سلول‌های پروکاریوتیک و یوکاریوتیک اثبات کردند (75). ترکیب‌های فعال زیستی‌ای که تاکنون شناسایی ‌شده‌اند ساختمان‌های متنوعی ازجمله اسیدهای چرب، فنولیک‌ها، بروموفنول‌ها، ترپنوئیدها، N- گلوکوزیدها، دپسی‌پپتیدهای[xxxvii] حلقوی، لیپوپپتیدها، پپتیدهای حلقوی و آلکالوئیدهای ایندولی‌اند. بسیاری از ترکیب‌های فعال زیستی شناسایی‌شده در گونه‌های نوستوک به رده‌های شیمیایی پپتیدهای سیکلیک و آلکالوئیدها تعلق دارند (88 و 89). نتایج بررسی حاضر نشان دادند عصاره‌های جلبکی برخی از سویه‌ها خواص ضدمیکروبی درخور توجهی در برابر باکتری‌های گرم مثبت، باکتری‌های گرم منفی و قارچ ها نشان می‌دهند (شکل 8 و جدول‌های 6 و 7). تنوع فعالیت‌های ضدقارچی و ضدباکتریایی عصاره‌های ده سویه ممکن است به‌علت تفاوت در نفوذپذیری ترکیب‌های فعال زیستی درون سیانوباکتری آزمایش‌شده و همچنین تفاوت در واکنش‌پذیری سویه‌های مختلف قارچی و باکتریایی در برابر ترکیب‌های فعال زیستی موجود در عصارۀ جلبکی باشد (90). همان‌طور که نتایج نشان می‌دهند قطر مناطق بازدارندگی عصاره‌های حاصل با یکدیگر متفاوت است و این تنوع متابولیت‌های ثانویه را نشان می‌دهد. تولید ترکیب‌های فعال زیستی و فعالیت ضد‌میکروبی به عوامل فیزیولوژیکی مختلف مانند حضور ترکیب‌های آلی، مراحل رشد و شرایط کشت وابسته است؛ شرایط محیطی مختلف ممکن است موجب بیان متفاوت فعالیت‌های زیستی شود (91). پژوهش‌های Radhakrishnan و همکاران در سال 2009 نشان دادند در تیمار گونه‌ای از Anabaena. sp.، قطر منطقۀ بازدارندگی در دمای 2±40 درجۀ سانتی‌گراد و40 میکرومول فوتون بر متر مربع بر ثانیه حداکثر است؛ درحالی‌که در Synechococcus sp.  هیچ فعالیتی در دمای کمتر از 20 درجۀ سانتی‌گراد مشاهده نمی‌شود (92). پژوهش مشابهی در زمینۀ ارزیابی فعالیت قارچی، قطر منطقه بازدارندگی را محدوده‌ای از 6 تا 14 میلی‌متر نشان داد (93)؛ همچنین نتایج پژوهش حاضر هالۀ عدم‌رشد را در مقابل باکتری‌ها و قارچ‌های آزمایش‌شده نشان دادند. در مقالۀ Zarrini و همکاران (2011)، برخی سیانوباکترها مانند Anabaena sp.، Nodularia sp.وLeptolyngbya sp.به‌عنوان یکی از منابع تولید ترکیبات ضدمیکروبی مطرح شده‌اند و نتایج نشان داده‌اند سیانوباکترها ترکیبات مؤثری را علیه باکتری‌های گرم مثبت و قارچ‌های مخمری تولید می‌کنند (94). نتایج آزمایش‌های آنتی‌بیوگرام و تکثیر ژن NRPS در ده سویهسیانوباکتر مطالعه‌شده، ارتباط بین حضور ژن تولید‌کنندۀ فرا‌ورده‌های طبیعی NRPS با سنتز فراورده‌های طبیعی (ویژگی‌های ضدمیکروبی) را اثبات کردند. بررسی‌های وسیع پژوهشگران دیگر نشان دادند ظاهراً سویه‌های هتروسیست‌دار بیشترین احتمال حضور فراورده‌های طبیعی فعال ازنظر بیوشیمیایی را دارند. متابولیت‌های ثانویۀ سیانوباکتری‌ها از طریق کمپلکس‌های چند‌آنزیمی بزرگ متشکل از مودول‌های NRPS مسئول اضافه‌کردن یک آمینواسید در مراحل طویل‌سازی زنجیرۀ پپتیدی تشکیل می‌شوند (95 و 96). پژوهشگران بسیاری به جستجوی ژن NRPS در سیانوباکتری‌ها پرداخته‌اند (97-108). در بررسی حاضر به تکثیر ژن NRPS با استفاده از آغازگرهای دجنریت در ده سویه سیانوباکتر رودخانۀ لواسان پرداخته شد. سویه‌های مطالعه‌شده در درخت فیلوژنتیک با حمایت زیاد همراه با سویه‌های هم‌نام خود در یک کلاستر قرار گرفتند و این نزدیکی فیلوژنتیک آنها را نشان می‌دهد (شکل 7). خوشه‌بندی دمین‌های NRPS فقدان وابستگی‌های تاکسونومیک بین دمین‌های آدنیله‌شدۀ جنس‌ها و سویه‌های سیانوباکتریایی را نشان می‌دهد؛ برای نمونه، نمونه‌های اندکی روابط نزدیک بین وضعیت تاکسونومیک و ترکیب پیش‌بینی‌شده دارند؛ به این معنا که نوع ترکیب خاص تولیدشده نمی‌تواند نوع جنس را نشان دهد (شکل 7). درخت فیلوژنتیک رسم‌شده با توالی دمین آدنیله‌شدۀ ده سویه همراه با دیگر توالی‌های آمینواسیدها، تفاوت بین نوع جنس و نوع ترکیب رمزگذاری‌کننده را نشان می‌دهد؛ برای نمونه، ترکیب Phosphitricin synthetase و آمینواسید سرین که توسط دمین آدنیله‌شدۀ یک سویه تولید می‌شوند، به یک جنس معین اختصاص ندارند و ممکن است در جنس‌های دیگر سیانوباکتری نیز یافت شود. خوشه‌بندی می‌تواند بر اساس خصوصیت پیوند با پیش‌مادۀ آمینواسیدی (آمینواسید فعال‌شده) نیز انجام شود (جدول 4). در میان جنس‌های یافت‌شده با BLASTx، آمینواسیدهای گلایسین،هوموتیروزین، تریپتوفان، اسپارژین و سرین به‌عنوان پیش‌مادۀ آمینواسیدی برای پیوند با دمین آدنیله‌شدۀ پپتید‌سنتتازهای غیرریبوزومی شناخته شده‌اند (شکل 7 و جدول 4).

اگرچه نتایج کلی بررسی ژنوم رمزگذاری‌کنندۀ فراورده‌های طبیعی ده سویه سیانوباکتر دریاچه لواسان حضور ژن‌های NRPS را آشکار کرد، فعالیت بیوشیمیایی مرتبط با فعالیت ضد‌باکتریایی و ضدقارچی در همۀ سویه‌ها یافت نشد؛ همچنین نتایج پژوهش Ehrenreich و همکاران در سال 2005 نشان داده‌اند دو سویۀ Lyngbya sp. PCC7419 و Cyanothece sp. WH8904 باوجود فعالیت درخور توجه زیستی، ژن‌های رمز‌گذاری‌کنندۀ فراورده‌های طبیعی را ندارند. این نتایج پیشنهاد می‌کنند سیستم‌هایی غیر از ژن‌های NRPS و PKS فعالیت‌های زیستی مشاهده‌شده را کنترل می‌کنند (43).

 

نتیجه‌گیری

تأیید نهایی روابط بین حضور ژن NRPS و فعالیت‌های زیستی به آزمایش‌های بیان ژن نیاز دارد تا ارتباط بین فعالیت‌های بیوشیمیایی با این ژن‌های ویژه و همچنین سیستم پیام‌رسانی مؤثر بر بیان این ژن‌ها شناخته شوند (109)؛ درحقیقت، خلاقیت و استفاده از روش‌های مختلف موجب تکامل روش‌های جدید برای به‌دست‌آوردن حداکثر بهره‌بری از ترکیب‌های فعال زیستی می‌شود. گفتنی است اگرچه در گذشته، بررسی‌ها و پژوهش‌های بسیاری در زمینۀ جستجوی اثر بازدارندگی ترکیب‌های ضدمیکروبی انجام شده‌اند، در مراجع هیچ اطلاعاتی دربارۀ فعالیت ضدمیکروبی و ارتباط آن با ژن‌های NRPS در دریاچۀ لواسان در دسترس نیست و پژوهش حاضر جزو نخستین بررسی‌های انجام‌شده در این زمینه در ایران است.



[1] Natural product

[2] Taxon

[3] Non-ribosomal peptide synthetases (NRPSs)

[4] Residue

[5] Adenylation          

[6] Condensation

[7] Thiolation

[8] Downstream

[9] Pepridyl carrier protein    

[10] Thioesterase

[11] Termination

[12] Stock media culture 

[13] Nostocales

[14] µmol m-2 s-1

[15] Axenic

[16] Incubation

[17] cetyl trimethylammonium bromide

[20] Extension

[21]Elongation step

[22] Final hold

[23] Degenerate primers

[24] Blast N

[27] The disk diffusion method

[28]Mueller-Hinton agar

[29] Inhibition zone

[30] Nutrient broth

[31] Saboraud Dextrose Agar

[32] Saubouraud’s dextrose Broth

[33] McFarland

[34] Cladeواحد سیستماتیکی تک‌نیایی است و گروهی از تاکسون‌ها را نشان می‌دهد که یک نیای مشترک دارند.

[35] Signature Sequence

[xxxvi] Chroococales

[xxxvii] Depsipeptides

References

(1)              Nowruzi B., Khavari-Nejad RA., Sivonen K., Kazemi B., Najafi F., Nejadsattari T. Identification and toxigenic potential of a NOSTOC sp. Algae 2012; 27(4): 303-313.

(2)              Nowruzi B., Khavari-Nejad RA., Sivonen K., Kazemi B., Najafi F., Nejadsattari T. Identification and toxigenic potential of a Cyanobacterial strain (Anabaena sp.). Progress in Biological Sciences 2013; 3: 79-85.

(3)              Sivonen K., Börner T. Bioactive compounds produced by Cyanobacteria. In: Herrero A., Flores E. editors. The Cyanobacteria: molecular biology, genomics and evolution. Norfolk: Caister Academic Press; 2008: 159-197.

(4)              Whitton BA., Potts M. Introduction to the Cyanobacteria. In: Whitton BA., Potts M. editoes. The ecology of Cyanobacteria. Their diversity in time and space. Dordrecht: Kluwer Academic Publishers; 2000: 1-11.

(5)              Newman DJ., Cragg GM. Natural products as sources of new drugs over the last 25 years. Journal of Natural Products 2007; 70: 461-477.

(6)              Quinn RJ., Taylor C., Suganuma M., Fujiki H. The conserved acid binding domain model of inhibitors of protein phosphatases 1 and 2A: molecular modelling aspects. Bioorganic and Medicinal Chemistry Letters 1993; 3: 1029-1034.

(7)              Harvey AL. Natural products in drug discovery. Drug Discovery Today 2008; 13: 894-901.

(8)              Wiegand C., Pflugmacher S. Ecotoxicological affects of selected cyanobacterial secondary metabolites a short review. Toxicology and Applied Pharmacology 2005; 203: 201-218.

(9)              Bhadury P., Wright PC. Exploitation of marine algae: biogenic compounds for potential antifouling applications. Planta 2004; 219: 561-578.

(10)          Shimizu Y. Microalgal metabolites. Current Opinion in Microbiology 2003; 6: 236-243.

(11)          Burja AM., Banaigs B., Abou-Mansour E., Grant Burgess J., Wright PC. Marine cyanobacteria-a prolific source of natural products. Tetrahedron 2001; 46: 9347-9377.

(12)          Tan LK., Chang YY., Ashootosh T. Besarhanamides A and B from the marine Cyanobacterium Lyngbya majuscula. Phytochemistry2008; 69: 2067-2069.

(13)          Gademann K., Portmann C. Secondary metabolites from cyanobacteria: complex structures and powerful bioactivities. Current Organic Chemistry 2008; 12: 326-341.

(14)          Smith FMJ., Wood SA., Ginkel RV., Broady PA., Gaw S. First report of saxitoxin production by a species of the freshwater benthic cyanobacterium, Scytonema Agardh Francine. Toxicon 2011; 57: 566-573.

(15)          Dahms HU., Xu Y., Pfeiffer C. Antifouling potential of cyanobacteria: a minireview. Biofouling 2006; 22: 317-327.

(16)          Liwei L., Jouni J., Nowruzi B., Fewer D., Wahlsten M., Sivonen K. Nostoginosins: trypsin inhibitors from Nostoc sp. strain FSN. Journal of Natural Products 2015; 77: 1784-1790.

(17)          Nowruzi B., Haghighat S., Fahimi H., Mohammadi E. Nostoc cyanobacteria species: a new and rich source of novel bioactive compounds with pharmaceutical potential. Journal of Pharmaceutical Health Services Research 2018; 9: 5-12.

 

(18)          Nowruzi B., Fahimi H., Ordodari N., Assareh R. Genetic analysis of polyketide synthase and peptide synthase genes of cyanobacteria as a mining tool for new pharmaceutical compounds. Journal of Pharmaceutical and Health Sciences 2017; 5(2): 139-150.

(19)          Marahiel MA., Stachelha T., Mootz HD. Modular peptide synthetases involved in nonribosomal peptide synthesis. Chemical Reviews 1997; 97(7): 2651-2674.

(20)          Neuendettelsau A. Substrate specificity prediction of enzymes and its applications to nonribosomal peptide synthetases [Dissertation]. Eberhard Karls University of Tübingen, verzeichnet diese Publikation in der Deutschen Nationalbibliografie; 2007.

(21)          Rastogi RP., Sinha RP. Biotechnological and industrial significance of cyanobacterial secondary metabolites. Biotechnology Advances2009; 27: 521-539.

(22)          Stanier RY., Kunisawa R., Mandel M., Cohen-Bazire G. Purification and properties of unicellular blue-green algae (Order Chroococcales). Bacteriological Reviews 1971; 35: 171-205.

(23)          Kaushik BD. Laboratory methods for blue-green algae. New Delhi: Associated Publishing CO; 1987: 17-63.

(24)          Ferris MJ., Hirsch CF. Method for isolation and purification of Cyanobacteria. Applied and Environmental Microbiology 1991; 57: 1448-1452.

(25)          Lobban CS., Chapman DJ., Kremer BP. Experimental phycology: A laboratory manual. Cambridge: Cambridge University Press; 1988.

(26)          Acreman J. Algae and Cyanobacteria: isolation, culture and long-term Maintenance. The Journal of Industrial Microbiology 1994; 13: 193-194.

(27)          Vazquez-Martınez G., Rodriguez MH., Herna´ndez-Herna´ndez F., Ibarra JE. Strategy to obtain axenic cultures from field-collected samples of the cyanobacterium Phormidium animalis. Journal of Microbiological Methods 2004; 57: 115-121.

(28)          Rippka R. Isolation and purification of cyanobacteria. Methods in Enzymology 1998; 167: 3-27.

(29)          Sarchizian I., Ardelean I. Axenic culture of a diazotrophic filamentous Cyanobacterium isolated from mesothermal sulphurous springs (obanul mare- mangalia). Plant Biology 2010; 55: 47-53.

(30)          Berg K. Heterotrophic bacteria associated with Cyanobacteria in recreational and drinking water [Dissertation]. Helsinki: University of Helsinki; 2007.

(31)          Anand N. Hand book of blue-green algae of rice fields of South India. Deharadun: Bishen Singh Mahendra Pal singh; 1989.

(32)          Prescott GW. Algae of western Great Lakes area. Dubuque: Iowa William C. Brown Company Publishers; 1962.

(33)          Desikachary TV. Cyanophyta. New Delhi: Indian Council of Agricultural Research; 1959.

(34)          Anagnostidis K., Komarek J. Modern approach to the classification system of cyanophytes. 4-Nostocales. Archiv fur Hydrobiologie. Supplementband: Algological Studies 1999; 50: 248-317.

(35)          Santra SC. Biology of Rice fields blue green algae. New Delhi: Daya publishing House; 1993.

(36)          Sahin B. Algal flora of lakes Aygır and Balıklı (Trabzon, Turkey). Turkish Journal of Botany2000; 24: 35-45.

(37)          Stanier RY., Kunisawa R., Mandel M., Cohen-Bazire G. Purification and properties of unicellular blue-green algae (Order Chroococcales). Bacteriological Reviews 1971; 35: 171-205.

(38)          Rippka RJ., Deruelles JB., Waterbury M., Stanier RY. Generic assignments, strain histories and properties of pure cultures of Cyanobacteria. Journal of General Microbiology 1979; 111: 1-61.

(39)          Watanabe M., Yamagishi T. Fresh water algae of Papua New Guinea blue- green algae from MT-Wilhelm. Tokyo: Academia Scientific Book Inc.; 1979.

(40)          Bessey CE., Saunders D., Woods AF. Flora of Nebraska: Introduction; Part I. Protophyta-Phycophyta; Part II. Coleochaetaceae, Characeae. University of Nebraska–Lincoln 1894; 8-15.

(41)          Neilan BA., Jacob SD., Dot TD., Blackall L., Hawkins PR., Cox PT., Goodman AE. rRNA sequences and evolutionary relationships among toxic and nontoxic Cyanobacteria of the genus Microcystis. International Journal of Systematic Bacteriology1997; 47: 693-697.

(42)          Lepere C., Wilmotte A., Meyer B. Molecular diversity of Microcystis strains (Cyanophyceae, Chroococcales) based on 16S rDNA sequences. Systematics and Geography of Plants 2000; 70: 275-283.

(43)          Ehrenreich IM., Waterbury JB., Webb EA. Distribution and diversity of natural product genes in marine and freshwater cyanobacterial cultures and genomes. Applied and Environmental Microbiology 2005; 11: 7401-7413.

(44)          Challis GL., Ravel J., Townsend CA. Predictive, structurebased model of amino acid recognition by nonribosomal peptide synthetase adenylation domains. Chemical biology 2000; 7: 211-224.

(45)          Ansari MZ., Yadav G., Gokhale RS., Mohanty D. NRPS-PKS: a knowledge-based resource for analysis of NRPS/PKS megasynthases. Nucleic Acids Research 2004; 32: 405-413.

(46)          Thompson JD., Higgins DG., Gibson TL. Clustal w: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 1994; 11: 4673-4680.

(47)          Hall T. BioEdit. Ibis Therapeutics, Carlsbad, CA, 92008, USA. 2004.

(48)          Tamura K., Dudley J., Nei M., Kumar S. MEGA 4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 2007; 8: 1596-1599.

(49)          Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 2004; 32(5): 1792-1797.

(50)          Espinel-Ingroff A. Standardized disk diffusion method for yeasts. Clinical Microbiology Newsletter 2007; 29: 97-100.

(51)          (51) Kaushik P., Chauhan A. Cyanobacteria: Antibacterial Activity. Current Science 2009; 97: 1378-1379.

(52)          Leflaive J., Ten-Hage L. Algal and cyanobacterial secondary metabolites in freshwaters: a comparison of allelopathic compounds and toxins. Freshwater Biology 2007; 52: 199-214.

(53)          Cannell RJP., Owsianka AM., Walker JM. Results of a large-scale screening programme to detect antibacterial activity from freshwater algae. European Journal of Phycology1988; 23: 41-44.

(54)          Caicedo NH., Heyduck-Söller B., Fischer U., Thöming J. Bioproduction of antimicrobial compounds by using marine filamentous cyanobacterium cultivation. Journal of Applied Phycology 2011; 23: 811-818.

(55)          Tuyet LTA. Chemical and biological investigations of vietnamese Cyanobacteria. Thanh Hoa: Universität Greifswald; 2010.

(56)          Madhumathi V., Deepa P., Jeyachandran S., Manoharan C., Vijayakumar S. Antimicrobial activity of cyanobacteria isolated from freshwater lake. International Journal of Microbiology Research 2011; 2: 213-216.

(57)          Prasanna R., Sood S., Jaiswal P., Nayak S., Gupta V., Chaudhary V., Joshi M., Natarajan C. Rediscovering Cyanobacteria as valuable sources of bioactive compounds (Review). Applied Biochemistry and Microbiology 2010; 46: 119-134.

(58)          Khairy HM., El-Kassas HY. Active substance from some blue green algal species used as antimicrobial agents. African Journal of Biotechnology 2010; 9: 2789-2800.

(59)          Kim JD. Screening of Cyanobacteria (Blue-Green algae) from rice paddy soil for antifungal activity against plant pathogenic fungi. Mycobiology 2006; 34: 138-142.

(60)          Thillairajasekar K., Duraipandiyan V., Perumal P., Ignacimuthu S. Antimicrobioal activity of Trichodesmium erthraeum (Her) (microalga) from south east coast of Tamil Nadu, India. International Journal of Integrative Biology 2009; 5: 167-170.

(61)          Clardy J., Walsh C. Lessons from natural molecules. Nature 2004; 432: 829-837.

(62)          El-Sheekh M., Dawah AM., El-Rahman AM., El-Adel HM., El-Hay A. Antimicrobial activity of the Cyanobacteria Anabaena wisconsinense and Oscillatoria curviceps against pathogens of fish in aquaculture. Annals of Microbiology 2008; 3: 527-534.

(63)          Cano MMS., Mule MCZ., Caire GZ., Haiperin DR. Inhibition of candida albicans and staphylococcus qureus by phenolic compounds from the terresterial cyanobacterium Nostoc mascorum. Journal of Applied Phycology 1990; 2: 79-81.

(64)          Kaushik P., Chauhan P., Chauhan G., Goyal P. Evaluation of Nostoc commune for potential antibacterial activity and UV-HPLC analysis of methanol extract. The Internet Journal of Microbiology 2008; 5: 1-5.

(65)          Kumar RS., Thajuddin N., Venkateswari C. Antibacterial activity of cyanolichen and symbiotic cyanobacteria against some selected microorganisms. African Journal of Microbiology Research 2010; 4: 1408-1411.

(66)          Biondi N., Piccardi R., Margheri MC., Rodolfi L., Smith GD., Tredici MR. Evaluation of Nostoc strain ATCC 53789 as a potential source of natural pesticides. Applied and Environmental Microbiology 2004; 70: 3313-3320.

(67)          Juttner F., Todorova AK., Walch N., philipsborn WV. Nostocyclamide M: a cyanobacterial cyclic peptide with allelopathic activity from Nostoc 31. Phytochemistry 2001; 57: 613-619.

(68)          Portmann B., Gademann KC. Secondary metabolites from cyanobacteria: complex structures and powerful bioactivities. Current Organic Chemistry 2008; 12: 326-341.

(69)          Aleksandra V., Drobac T., Dejan B., Stojanovic Z. The importance of extremophile cyanobacteria in the production of biologically active compounds. Zbornik Matice Srpske za Prirodne Nauke 2007; 112: 57-66.

(70)          Richard JPC., Owsianka AM., Walker JM. Results of a large-scale screening programme to detect antibacterial activity from freshwater algae. European Journal of Phycology 1988; 23: 41-44.

(71)          Asthana RK Deepali., Tripathi MK Srivastava A., Singh AS., Singh SP., Nath G., Srivastava R., et al. Isolation and identification of a new antibacterial entity from the Antarctic cyanobacterium Nostoc CCC 537. Journal of Applied Phycology 2009; 21: 81-88.

(72)          Fish SA., Codd GA. Bioactive compound production by thermophilic and thermotolerant Cyanobacteria. World Journal of Microbiology and Biotechnology 1994; 10: 338-341.

(73)          Kreitlow S., Mundt S., Lindequist U. Cyanobacteria- a potential source of new biologically active substances. J-Biotech 1999; 70: 61-63.

(74)          Abdel-Raouf N., Ibraheem IBM., Abdel-Tawab S., Naser YAG. Antimicrobial and antihyperlipidemic activities of isolated quercetin from Anabaena aequalis. Journal of Phycology2011; 47: 955-962.

(75)          Martins RF., Ramos MF., Herfindal L., Sousa J., Skarven K., Vasconcelos VM. Antimicrobial and cytotoxic assessment of marine Cyanobacteria- Synechocystis and Synechococcus. Marine Drugs 2008; 6: 1-11.

(76)          Issa AA. Antibiotic production by the Cyanobacteria Oscillatoria angustissima and Calothrix parietina. Environmental Toxicology and Pharmacology 1999; 8: 33-37.

(77)          Subramaniam A., Carpenter E. Bio-optical properties of the marine diazotrophic cyanobacteria Trichodesmium spp. I. Absorption and photosynthetic action spectra. Limnology and Oceanography 1999; 3: 608-617.

(78)          Beattie KA., Kaya K., Sano T., Codd GA. Three dehydrobutyrine containing microcyastins from Nostoc. Pergamon Phytochemistry 1998; 7: 1282-1292.

(79)          Asthana RK., Srivastava A., Singh P., Deepali A., Singh SS., Nath G., et al. Identification of an antimicrobial entity from the cyanobacterium Fischerella sp. isolated from bark of Azadirachta indica (Neem) tree. Journal of Applied Phycology 2006; 18: 33-39.

(80)          Singh RK., Upadhyay S., Tiwari SP., Rai AK., Mohapatra TM. Screening of cyanobacterial extracts against bacteria causing nosocomial infections. Journal of Pharmacy Research 2010; 3: 2096-2098.

(81)          Agger SA., Gallego L., Hoye TR., Schmidt-Dannert C. Identification of sesquiterpene synthases from Nostoc punctiforme PCC 73102 and Nostoc sp. strain PCC 7120. Journal of Bacteriology 2008; 13: 6084-6096.

(82)          Bajpai R., Sharma NK., Lawto LA., Edwards C., Rai A. Microcystin producing cyanobacterium Nostoc sp. BHU001 from a pond in India. Toxicon 1999; 53: 587-590.

(83)          Sabarinathan KG., Ganesan G. Antibacterial and toxicity evaluation of C-phycocyanin and cell extract of filamentous freshwater cyanobacterium Westiellopsis sps. European Review for Medical and Pharmacological Sciences 2008; 12: 79-82.

(84)          Ozdemir G., Karabay NU., Dalay MC., Pazarbasi, B. Antibacterial activity of volatile component and various extracts of Spirulina platensis. Phytotherapy Research 2004; 18: 754-757.

(85)          Mundt S., Kreitlow S., Jansen R. Fattyacids with antibacterial activity from the cyanobacterium Oscillatoria redekei HUB 051. Journal of Applied Phycology 2003; 15(2): 263-267.

(86)          Chang EH., Yang SS. Some characteristics of microalgae isolated in Taiwan for biofixation of carbon dioxide. Botanical Bulletin- Academia Sinica Taipei 2002; 44: 43-52.

(87)          Sethubathi GVB., Prabu VA. Antibacterial activity of cyanobacterial species from Adirampattinam Coast, Southeast Coast of Palk Bay current research. Journal of Biological Sciences 2010; 2: 24-26.

(88)          Dembitsky VM., Řezanka T. Metabolites produced by nitrogen-fixing Nostoc species. Folia Microbiologica 2005; 5: 363-391.

(89)          Rezanka T., Dembitsky VM. Metabolites produced by cyanobacteria belonging to several species of the family nostocaceae. Folia Microbiologica 2006; 3: 159-182.

(90)          Ordog V., Stirk WA., Lenobel R., Bancrova M., Strnad M., Staden JV., et al. Screening microalgae for some potentially useful agricultural and pharmaceutical secondary metabolites. Journal of Applied Phycology 2004; 16: 309-314.

(91)          Pawar ST., Puranik PR. Screening of terrestrial and freshwater halotolerant cyanobacteria for antifungal activities. World Journal of Microbiology and Biotechnology 2008; 24: 1019-1025.

(92)          Radhakrishnan B., Prasanna R., Jaiswal P., Nayak S., Dureja P. Modulation of biocidal activity of Calothrix sp. and Anabaena sp. by environmental factors. Biologia 2009; 64: 881-889.

(93)          Chetsumon A., Fujied F., Hirata K., Kiyohito Y., Miura Y. Optimization of antibiotic production by the cyanobacterium Scytonema sp. TISTR 8208 immobilized on polyurethane foam. Journal of Applied Phycology 1993; 5(6): 615-622.

(94)          Zarrini G., Rasooli I., Abazari M., Ghasemi Y. Investigation of antimicrobial activity of Cyanobacteria isolated from Urmia lake Catchment area. Journal of Ardebil University of Medical Science 2011; 11(4): 329-36.

(95)          Maschek JA., Baker BJ. The chemistry of algal secondary metabolism. In: Amsler CD. editor. Algal Chemical Ecology. Berlin, Heidelberg: Springer; 2008: 1-24.

(96)          Jones AC., Monroe EA., Eisman EB., Gerwick L., Sherman DH., Gerwick WH. The unique mechanistic transformations involved in the biosynthesis of modular natural products from marine cyanobacteria. Natural Product Reports 2010; 27: 1048-1065.

(97)          Neilan BA., Dittmann E., Rouhiainen L., Bass RA., Schaub V., Sivonen K., et al. Nonribosomal peptide synthesis and toxigenicity of Cyanobacteria. Journal of Bacteriology 1999; 13: 4089-4097.

(98)          Lerena MEB., Burja AM., Wright  C. Genetic analysis of polyketide synthase and peptide synthetase genes in cyanobacteria as a mining tool for secondary metabolites. The Journal of Industrial Microbiology and Biotechnology 2007; 34: 443-456.

(99)          Moffitt MC., Neilan BA. On the presence of peptide synthetase and polyketide synthase genes in the cyanobacterial genus Nodularia. FEMS MicrobiologyLetters 2001; 196: 207-214.

(100)      Christiansen G., Dittmann E., Ordorika LV., Rippka R., Herdman M., Börner T. Nonribosomal peptide synthetase genes occur in most cyanobacterial genera as evidenced by their distribution in axenic strains of the PCC. Archives of Microbiology 2001; 176: 452-458.

(101)      Burns BP., Seifert F., Goh F., Pomati AD., Jungblut A., Neilan A. Genetic potential for secondary metabolite production in stromatolite communities. FEMS Microbiology Letters 2005; 243(1): 293-301.

(102)      Genuario DB., Silva-Stenico ME., Welker M., Moraes LAB., Fiore MF. Characterization of a microcystin and detection of microcystin synthetase genes from a Brazilian isolate of Nostoc. Toxicon 2010; 55: 846-854.

(103)      Zhao J., Yang N., Zeng R. Phylogenetic analysis of type I polyketide synthase and nonribosomal peptide synthetase genes in Antarctic sediment. Extremophiles 2008; 12: 97-105.

(104)      Becker JE. Biosynthesis of cyclic peptides and depsipeptides in Nostoc Sp. ATCC 53789 [Dissertation]. Manoa: University of Hawaii; 2002.

(105)      Silva-Stenico ME., Silva CSP., Lorenzi AS., Shishido TK., Etchegaray A., Lira SP., et al. Non-ribosomal peptides produced by Brazilian cyanobacterial isolates with antimicrobial activity. Microbiological Research 2011; 166: 161-175.

(106)      Rounge TB., Rohrlack T., Nederbragt AJ., Kristensen T., Jakobsen KS. A genome-wide analysis of nonribosomal peptide synthetase gene clusters and their peptides in a Planktothrix rubescens strain. BMC Genomics 2009; 10: 1-11.

(107)      Minowa Y., Araki M., Kanehisa M. Comprehensive analysis of distinctive polyketide and nonribosomal peptide structural motifs encoded in microbial genomes. Journal of Molecular Biology 2007; 368: 1500-1517.

(108)      Becker JE., Moore RF., Moore BS. Cloning, sequencing, and biochemical characterization of the nostocyclopeptide biosynthetic gene cluster: molecular basis for imine macrocyclization Gene 2004; 325: 35-42.

Cane DE., Walsh CT. The parallel and convergent universes of polyketide synthases and nonribosomal peptide synthetases. Chemistry and Biology 1999; 6: 319-325.