شناسایی مولکولی سویۀ بومی ترائوستوکیتریوم 1-71 و تعیین کمی و کیفی تولید روغن و اسکوالن در آن

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 بیوتکنولوژی کشاورزی، علوم و فناوری های نوین، تحصیلات تکمیلی صنعتی و فناوری پیشرفته، کرمان، ایران

2 گروه بیوتکنولوژی، دانشده علوم و فناوری های نوین، دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته، کرمان، ایران

3 گروه بیوتکنولوژی کشاورزی،دانشکده علوم و فناوری های نوین، دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته، کرمان، ایران

چکیده

مقدمه: اسکوالن، هیدروکربن غیراشباع با شش پیوند دوگانه است. این اسید چرب زنجیره‌بلند کاربردهای بسیاری در صنایع آرایشی‌- بهداشتی، پزشکی، داروسازی و تولید سوخت‌های زیستی دارد. روغن کبد کوسۀ ماهیان منبع معمول تولید اسکوالن است که در‌حال‌حاضر، استفاده از آن با محدودیت‌هایی مواجه است. ترائوستوکیتریوم جنسی از آغازیان تک‌سلولی دریازی متعلق به خانوادۀ ترائوستوکیتریدها است که توانایی تولید مقدار زیاد اسکوالن را دارد.
مواد و روش‏‏ها: در پژوهش حاضر، میزان کیفی و کمی تولید اسکوالن، روغن و زیست‌توده در سویۀ بومی ترائوستوکیتریوم 1-71 جداسازی‌شده از سواحل جنوبی ایران از طریق TLC و HPLC بررسی شد؛ همچنین بررسی مولکولی این سویه با تجزیه‌وتحلیل و توالی‌یابی ژن 18S rDNA انجام شد.
نتایج: نتایج نشان دادند سویۀ ترائوستوکیتریوم 1-71 متعلق به خانوادۀ ترائوستوکیتریدها و جنس ترائوستوکیتریوم به‌ترتیب میزان 12/4 و 25/1 گرم‌برلیتر زیست‌توده و روغن تولید می‌کند و 6/74 میلی‌گرم‌برلیتر اسکوالن در روز چهارم پس‌از کشت در محیط‌کشت GYP تولید می‌شود.
بحث و نتیجه‏گیری: در پژوهش حاضر برای نخستین‌بار در خاورمیانه، تولید اسکوالن در سویۀ آغازی دریایی ترائوستوکیتریوم گزارش شد. امید است در آینده بتوان تولید این ماده را با بهینه‌کردن محیط‌کشت و شرایط کشت سویۀ یادشده در راستای تولید اسکوالن افزایش داد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Molecular Identification of Native Strain of Thraustochytrium 71-1 and Qualitative and Quantitative Determination of Produced Total Oil and its Squalene

نویسندگان [English]

  • farshad khoshbasirat 1
  • Shahryar Shakeri 2
  • Mahmood maleki 3
1 Agricultural Engineering, Sciences and Modern Technologies, Graduate University of Advanced Technology, kerman, iran
2 Department of Agricultural Engineering، Faculty of Sciences and Modern Technologies, Graduate University of Advanced Technology, kerman, Iran
3 Department of Agricultural Engineering، Faculty of Sciences and Modern Technologies, Graduate University of Advanced Technology, kerman, Iran
چکیده [English]

Introduction:Squalene is a polyunsaturated hydrocarbon with six double bonds. Squalene has many applications in biofuel, cosmetic, medical and pharmaceutical industries. The common source of Squalene is shark liver oil that its consumption is limited. Thraustochytrium a genus of unicellular marine protist belong to the thraustochytrids family which is capable of producing high Squalene.
Materials and methods: In this study, the qualitative and quantitative production of Squalene, oil and biomass was investigated in the native strain of Thraustochytrium 71-1 by TLC and HPLC. Molecular characterization of this strain was analyzed by 18srDNA gene analysis.
Results: Results showed that the strain 71-1 belongs to the family of Thraustochytrids and the genus of Thraustochytrium. The results showed that the strain of Thraustochytrium 71-1 produced 4.12 and 1.25 gr/L, biomass and oil, respectively. Also, Squalene was produced as 74.6 mg/L in 4 days of incubation in GYP medium.
Discussion and conclusion: In this research, the production of Squalene has been reported in the strain of the thraustochytrium marine for the first time in the Middle East. It is hoped that in future, the production of this substance could be increased by optimizing the culture medium and culture conditions of this strain to produce Squalene.

کلیدواژه‌ها [English]

  • Native Strain
  • Thraustochytrium
  • Squalene

مقدمه

اسکوالن، هیدروکربن تری‌ترپن غیراشباع با شش پیوند دوگانه و کلید پیش‌ساز کلسترول، اسید صفراوی و استروئیدها در گیاهان و جانوران است. این ترکیب عامل آنتی‌اکسیدانی است که سلول‌ها را در برابر رادیکال‌های آزاد و گونه‌های اکسیژن فعال محافظت می‌کند (1). اسکوالن به‌عنوان عامل مرطوب‌کننده و نرم‌کننده در صنعت آرایشی عمل می‌کند و کاربرد گسترده‌ای در بخش‌های پزشکی و داروسازی دارد. این ترکیب بازدارندۀ شیمیایی مؤثر تحریک‌کننده‌های توموری رودۀ بزرگ، شش و پوست است (2). اسکوالن عامل ضدباکتری و ضدقارچی است که عملکرد ایمنی بدن را به‌طور درخور توجهی افزایش می‌دهد و موجب کاهش سطح کلسترول خون می‌شود (3).

نتایج بررسی‌های دانشمندان نشان می‌دهند چربی‌های دارای اسیدهای چرب امگا 3 و 2 نه‌تنهابدن را در برابر بیماری‌های قلبی- عروقی حمایت می‌کنند، در کاهش دردهای آرتروزهای روماتیسمی، انواع میگرن و حفظ بدن در برابر سرطان و حتی کاهش برخی از انواع دیابت مفیدند (1). چربی‌های غیر اشباع مانع انباشته‌شدن پلاکت‌های خون در جدار شریان‌ها و مانع چسبنده‌شدن خون می‌شوند؛ درنتیجه از لخته‌شدن خون جلوگیری می‌کنند و مانع حملات قلبی می‌شوند (2). در مدل‌های حیوانی به‌نظر می‌رسد اسکوالن نقش مهمی در سلامت شبکیه بازی می‌کند.

در‌حال‌حاضر، ریزجلبک‌ها منابع بالقوۀ تولید اسکوالن شناخته می‌شوند. گزارش شده است جلبک سبز بوتریوکوکوس[1]زمانی که در شرایط فتواوتوتروفیک کشت شود، اسکوالن تولید می‌کند (4)؛ باتوجه‌به محدودیت نور در چنین شرایطی، رسیدن به زیست‌تودۀ زیاد دشوار است و در‌نتیجه، چگالی سلولی زیاد ازنظر تجاری لازم است. از سویی، ریزجلبکی که بتواند به‌طور هتروتروفیکی رشد کند احتیاجی به نور ندارد و به چگالی زیاد سلولی می‌رسد؛ درنتیجه، زمانی که در مقیاس‌های تجاری کشت شود بهره‌وری خوبی را نشان می‌دهد.

ترائوستوکیتریدها[2] گروهی از یوکاریوت‌های آغازین دریازی هستند که به‌طور گسترده در جنگل‌های مانگرو زندگی می‌کنند و رشد خوبی در شرایط هتروتروفیک دارند. درحال‌حاضر، چنین ریزموجوداتی برای تولید روغن‌های امگا 3 حاوی اسیدهای چرب غیراشباع استفاده می‌شوند و برخی گونه‌ها مقادیر زیادی اسکوالن تولید می‌کنند. جنس ترائوستوکیتریوم آغازی هتروتروفیکی است که به‌عنوان منبع اسکوالن بررسی شده است. مخمر‌های بررسی‌شده از جنس سودوزیما[3] نیز برای تولید اسکوالن استفاده شده‌اند و میزان تولید اسکوالن در این سویه‌ها برابر 32/70 میلی‌گرم‌بر‌لیتر گزارش شده است (5). در پژوهش حاضر، برای نخستین‌بار در خاورمیانه به بررسی سویه‌ای ازآغازیان تک‌سلولی دریازی از خانوادۀ ترائوستوکیتریدها و جنس ترائوستوکیتریوم به‌عنوان سویه‌ای با پتانسیل زیاد تولید اسکوالن از سواحل جنوبی ایران به‌منظور تعیین میزان کمّی و کیفی تولید اسکوالن پرداخته شد.

 

مواد و روش‌ها

محیط‌کشت‌ها:در پژوهش حاضر، سویۀ ترائوستوکیتریوم 1-71 که فکرت[4] و شاکری در سال 1392 آن را از سواحل جنوبی ایران نمونه‌برداری کرده‌اند (6) در محیط‌کشت جامد GYP با ترکیب 20 گرم‌برلیتر گلوکز، 10 گرم‌برلیتر پپتون، 10 گرم‌برلیتر عصارۀ مخمر، 15 گرم‌برلیتر آگار، 3/0 گرم‌برلیتر آنتی‌بیوتیک‌های پنی‌سیلین و استرپتومایسین و 50 درصد آب دریا فعال شد؛ سپس برای تولید روغن در محیط‌کشت مایع شامل 20 گرم‌برلیتر گلوکز، 5 گرم‌برلیتر عصارۀ مخمر، 5 گرم‌برلیتر پپتون و 20 درصد آب دریا کشت شد (7).

بررسی ژن18S rRNA:DNA ژنومی با استفاده از کیت استخراج DNA و با‌توجه‌به دستورعمل کیت (شرکت سیناژن) استخراج شد. آغازگرهای رفت و برگشت T18S1F و T18S5R برای تکثیر ژن استفاده شدند (8) (جدول1). واکنش زنجیره‌ای پلیمراز (PCR) در 30 چرخه با دمای اتصال 62 درجۀ سانتی‌گراد انجام و محصول آن روی ژل آگارز 1 درصد برده شد. باند مدنظر توسط دستورعمل مربوط به کیت استخراج از ژل شرکت یکتا تجهیز آزما استخراج و برای تعیین توالی فرستاده شد.

 

 

جدول 1- آغازگرهای استفاده‌شده در پژوهش حاضر

نام آغازگر

توالی

طول محصول

دمای اتصال (درجۀ سانتی‌گراد)

T18S1F

CAACCTGGTTGATCCTGCCAGTA

1700

64

T18S5R

TCACTACGGAAACCTTGTTACGAC

1700

64

 


تعیینوزنخشکسلولی:10 میلی‎لیتر از محیط‌کشت مایع به‌مدت 10 دقیقه با سرعت 5000 دور‌در‌دقیقه سانتریفیوژ و سپس محلول رویی دور ریخته شد. رسوب سلولی حاصل به‌مدت 48 ساعت در آونی با دمای 80 درجۀ سانتی‌گراد قرار داده شد تا خشک شود و درنهایت، تودۀ خشک سلولی وزن شد.

استخراجروغن ازوزنخشک:استخراج روغن از زیست‌تودۀ خشک سلولی طبق پروتکل بلایت[5] و دایر[6] با کمی تغییرات انجام شد (9). طبق این روش، مقدار مشخصی از زیست‌تودۀ خشک سلولی به فالکون منتقل و 2 میلی‌لیتر آب مقطر به آن افزوده شد. خرد‌شدن زیست‌تودۀ خشک سلولی با دستگاه آلتراسونیک[7] (مدل UP200S) به‌مدت 5 دقیقه انجام شد؛ سپس، 5/2 میلی‌لیتر محلول کلروفرم و 5 میلی‌لیتر محلول متانول به لوله اضافه و خرد‌شدن دیوارۀ سلولی به‌مدت 4 دقیقه با دستگاه همگن‌ساز و آلتراسونیک انجام شد، دوباره مقدار 5/2 میلی‌لیتر آب مقطر و 5/2 میلی‌لیتر کلروفرم اضافه و به دنبال آن، همگن‌سازی و ورتکس به‌مدت 2 دقیقه انجام شد. نمونه به‌مدت 15 دقیقه با سرعت 4000 دور‌در‌دقیقه سانتریفیوژ شد و به دنبال آن، دو فاز تشکیل شد. لایۀ پایین (فاز آلی) به فالکون تمیز دیگری که قبلاً وزن شده بود منتقل شد، عمل تبخیر حلال کلروفرم انجام و وزن روغن تولیدی توسط سویۀ مدنظر محاسبه شد. روغن تولیدی به‌منظور نگهداری و انجام سایر تحلیل‌ها به فریزر منفی 20 درجۀ سانتی‌گراد منتقل شد (9).

.تجزیه‌وتحلیل کروماتوگرافی لایه‌نازک (TLC): کروماتوگرافی لایه‌نازک[8] (TLC)، کروماتوگرافی مایع با کارایی زیاد[9] (HPLC) و کروماتوگرافی گازی[10] (GC) از مهم‌ترین روش‌های استفاده‌شده برای تجزیه‌وتحلیل اسیدهای چرب هستند (10)؛ ازاین‌رو در پژوهش حاضر، روش‌های کروماتوگرافی مایع باکارایی زیاد و کروماتوگرافی لایه‌نازک برای بررسی تولید اسکوالن استفاده شدند. سویه‌ در 100 میلی‌لیتر محیط‌کشت مایع GYP درون ارلنی با شرایط استریل تلقیح و به‌مدت 4 روز در شیکرانکوباتوری با دمای 30 درجۀ سانتی‌گراد و 140 دور‌در‌دقیقه گرماگذاری شد و پس‌از‌آن، اسلاید میکروسکوپی از کشت مایع تهیه شد تا خلوص سویۀ کشت‌شده بررسی شود؛ سپس محیط‌کشت به‌مدت 10 دقیقه در 4000 دور‌در‌دقیقه سانتریفیوژ شد و درنهایت، فاز رویی دور ریخته شد. فاز زیرین که از زیست‌تودۀ سلولی تشکیل شده بود به‌مدت 24 ساعت درون آون 60 درجۀ سانتی‌گراد قرار داده شد و سپس وزن خشک سلولی آن اندازه‌گیری شد؛ پس‌از‌آن، روغن سلولی با حلال‌های کلروفرم و متانول استخراج شد (7 و 9). کاغذ کروماتوگرافی لایه‌نازک (TLC) با مشخصات Spherical silica gel 60; Wako Pure Chemicals در ابعاد 5/1 در 8 سانتی‌متر بریده شد و به میزان 10 میکرولیتر روغن به‌شکل لکه‌ای گرد روی آن قرار داده شد. به‌منظور یافتن لکۀ اسکوالن از اسکوالن استاندارد (شرکت سیگما) برای شاهد استفاده شد. کاغذهای TLC به‌مدت 30 دقیقه درون بشر حاوی حلال‌های کلروفرم و متانول (1:9) قرار داده شدند (10) و در بشر با پارافیلم بسته شد تا حلال تبخیر نشود. پس‌از‌ گذشت مدت زمان یادشده، کاغذها به‌آرامی با پنس از درون بشر برداشته شدند و روی آنها سولفوریک‌اسید 20 درصد اسپری شد؛ درنهایت، کاغذها به‌مدت 30 دقیقه درون آون 60 درجۀ سانتی‌گراد قرار داده شدند تا رنگ بگیرند. لکۀ اسکوالن باکاغذ شاهد حاوی اسکوالن استاندارد شناسایی و Rf آن طبق رابطۀ زیر اندازه‌گیری شد (11).

 Retention factore=

 فاصلۀ بین باند ظاهرشده با نقطۀ شروع نمونه (میلی‌متر)

 فاصله‌ای که فاز مایع از سطح حلال پیموده است (میلی‌متر)

 فاصلۀ بین سطح حلال و نقطۀ شروع (میلی‌متر)

باتوجه‌به میزان Rf و لکۀ اسکوالن، تولید اسکوالن به‌طور کیفی بررسی و تأیید شد. Rf اسکوالن در پژوهش حاضر برابر 97/0 اندازه‌گیری شد.

صابونی‌کردن روغن استخراجی و استخراج اسکوالن برای تجزیه‌وتحلیل HPLC: ازآنجاکه اسکوالن از معدود اسیدهای چربی است که صابونی نمی‌شوند، این ویژگی برای جداسازی اسکوالن از دیگر اسیدهای چرب استفاده شد. به این منظور، 50 میلی‌گرم از روغن استخراجی با 4 میلی‌لیتر محلول KOH اتانولی (11/0گرم پتاسیم‌هیدروکسید+4 میلی‌لیتر اتانول( مخلوط شد؛ برای آماده‌سازی محلول KOH اتانولی باید ابتدا KOH با میزان بسیار اندکی آب حل و درنهایت، اتانول به آن افزوده شود. نمونه به‌مدت 30 ثانیه ورتکس و به‌مدت 1 ساعت در حمام آب 90 درجۀ سانتی‌گراد قرار داده شد؛ پس‌از‌آن، نمونه‌ برای چند ثانیه روی یخ قرار داده شد تا سرد شود و سپس 2 میلی‌لیتر هگزان همراه با 5/0 میلی‌لیتر آب مقطر و 5/0 میلی‌لیتر اتانول به آن افزوده ‌شد. نمونه چند ثانیه با دست تکان و سپس در مکان ثابتی قرار داده شد تا دو فاز تشکیل شود. اسکوالن در حلال هگزان حل می‌شود و به همراه هگزان فاز رویی محلول را تشکیل می‌دهد؛ فاز رویی تشکیل‌شده برداشته و به لولۀ آزمایش تمیزی منتقل شد. لولۀ آزمایش حاوی هگزان به‌مدت یک روز درون آون 60 درجۀ سانتی‌گراد قرار داده شد تا هگزان آن به‌طور کامل بخار شود و اسکوالن باقی بماند؛ سپس 1 میلی‌لیتر محلول استونیتریل‌تتراهیدروفوران (1:9) به نمونه اضافه و نمونه 30 ثانیه ورتکس شد و سپس از فیلتر 2/0 میکرون عبور داده شد. نمونه‌ها به‌منظور تزریق به HPLC در فریزر منفی 20 درجۀ سانتی‌گراد نگهداری شدند (12). دستگاه HPLC استفاده‌شده در پژوهش حاضر، Agilent, 1100 Series ساخت کشورآمریکا با ستون ZOR Bax,Sb-C18 (4.6×250mm, 5-micron) بود. اسکوالن در طول موج 210 نانومتر ردیابی و میزان جریان دستگاه 1 میلی‌متر‌بر‌دقیقه با حجم تزریق 10 میکرولیتر و دمای ستون 30 درجۀ سانتی‌گراد بود. فاز متحرک ستون از محلول استونیتریل/تتراهیدروفوران (20:80) تشکیل شده بود و اسکوالن استاندارد به‌عنوان شاهد برای یافتن زمان خارج‌شدن اسکوالن از دستگاه استفاده شد.

نتایج.

.بررسی ریخت‌شناختی سویۀ ترائوستوکیتریوم 1-71: سویۀ ترائوستوکیتریوم 1-71 بر اساس ویژگی‌های ریخت‌شناختی و فیزیولوژیکی بررسی شد. این سویه روی محیط‌کشت تخصصی GYP حاوی آنتی‌بیوتیک کشت شد و سلول‌های کشت‌‌شده پس از 2 روز گرماگذاری با میکروسکوپ نوری بررسی شدند. نتایج مطالعه‌های میکروسکوپی نشان دادند این سویه دیوارۀ پلی‌ساکاریدی کاملاً مشخصی دارد و اندازۀ سلول‌ها بین 5 تا 25 میکرومتر است که از ویژگی‌های بارز خانوادۀ ترائوستوکیتریدها است (شکل 1).

 

 

 

شکل 1- A. سویۀ 1-71 در روز چهارم پس‌از کشت (a. سلول کاملاً گرد با دیوارۀ پلی‌ساکاریدی مشخص، b. گرانول‌های چربی درون‌سلولی)، B. c. سلول درحال تقسیم پی‌درپی و تشکیل کلاستر سلولی و زئوسپورانژیوم

 

 

.تولید زیست‌توده و روغن توسط سویۀ ترائوستوکیتریوم1-71:سویۀ ترائوستوکیتریومبه‌منظور تولید روغن در محیط‌کشت مایع اختصاصی کشت و زیست‌توده و روغن تولیدی آن اندازه‌گیری شد. نتایج نشان دادند سویۀ 1-71 در روز چهارم پس‌از کشت، میزان 12/4 و 25/1 گرم‌برلیتر به‌ترتیب زیست‌توده و روغن تولید می‌کند (شکل 2).

 

 

شکل 2- میزان زیست‌توده (بیومس) و روغن تولیدی توسط سویۀ 1-71

بررسی تولید زیست‌توده و روغن در زمان‌های متفاوت پس‌از کشت:تولید زیست‌توده و روغن در سویۀ 1-71 طی روزهای اول تا پنجم کشت بررسی شد. نتایج نشان دادند این سویه در روزهای اول، دوم، سوم، چهارم و پنجم به‌ترتیب 7/1، 8/2، 9/3، 12/4 و 8/3 گرم‌برلیتر زیست‌توده و 4/0، 8/0، 1، 25/1 و 22/1 گرم‌برلیتر روغن تولید می‌کند (شکل 3).

درصد روغن تولیدی به زیست‌توده در شکل 4 دیده می‌شود. نتایج نشان دادند بیشترین درصد روغن در روز پنجم پس‌از کشت و به میزان 32 درصد است.

 

 

شکل 3- میزان روغن و زیست‌تودۀ (بیومس) تولیدی توسط سویۀ 1-71 در زمان‌های متفاوت پس‌از کشت

 

 

شکل 4- درصد روغن تولیدی در روز اول تا پنجم پس‌از کشت

استخراج روغن و انجام تجزیه‌و‌تحلیل TLC: روغن استخراج‌شده در روز چهارم پس‌از کشت به‌منظور بررسی کیفی میزان تولید اسکوالن به‌وسیلۀ تجزیه‌و‌تحلیلTLC بررسی شد. لکۀ اسکوالن به‌وسیلۀ کاغذ شاهد حاوی اسکوالن استاندارد شناسایی و Rf اندازه‌گیری شد. باتوجه‌به میزان Rf و لکۀ اسکوالن، میزان تولید اسکوالن توسط سویۀ 1-71 به‌طور کیفی شناسایی و بررسی شد. Rf اسکوالن در پژوهش حاضر 97/0اندازه‌گیری شد و با مشاهدۀ لکۀ اسکوالن مشخص شد این سویه در روغن خود حاوی اسکوالن است (شکل 5).

 

 

شکل 5- کروماتوگرافی لایه‌نازک روغن استخراجی از سویۀ 1-71

 

تجزیه‌وتحلیل HPLC: صابونی‌کردن روغن استخراجی و آماده‌سازی نمونه برای HPLC طبق روش یادشده انجام شد. نتایج نشان دادند پیک مربوط به اسکوالن در دقیقۀ 3/12 ظاهر می‌شود (شکل 6). با استفاده از منحنی استاندارد اسکوالن که با تزریق مقادیر متفاوت (5 تا 50 میکروگرم‌در‌لیتر) اسکوالن استاندارد به دستگاه به دست آمد (شکل 7) و سطح زیر منحنی به‌دست‌آمده از پیک اسکوالن در سویۀ ترائوستوکیتریوم 1-71، مقدار اسکوالن تولیدی توسط این سویه اندازه‌گیری شد. نتایج نشان دادند سویۀ1-71 در روز چهارم پس‌از کشت 6/74 میلی‌گرم‌بر‌لیتر اسکوالن تولید می‌کند (شکل 8).

 

 

 

شکل 6- پیک به‌دست‌آمده از اسکوالن استاندارد که در دقیقۀ 3/12 از ستون دستگاه خارج شده است.

 

 

شکل 7- منحنی استاندارد اسکوالن

 

 

شکل 8- پیک به‌دست‌آمده از اسکوالن تولید‌شده توسط سویۀ 1-71


شناسایی مولکولی و فیلوژنتیکی سویۀ ترائوستوکیتریوم 1-71: ژن 18S rRNA تکثیر شد، توالی آن به دست آمد و درنهایت، توالی آن با داده‌های بانک ژنی بلاست شد. نتایج نشان دادند توالی این ژن بیشترین شباهت با میزان 94 درصد را به همین ژن در جنس ترائوستوکیتریوم دارد. درخت فیلوژنتیکی با استفاده از روش Neighbor-joining و نرم‌افزار مگا 4 ترسیم شد.

 

 

 

شکل 9- درخت فیلوژنیکی سویۀ ترائوستوکیتریوم 1-71

 


بحث و نتیجه‏گیری

اسکوالن نقش مهمی در سلامت انسان دارد و ازآنجاکه بدن انسان نمی‌تواند آن را تولید کند باید در رژیم غذایی زمان نوزادی و بلوغ وجود داشته باشد (13 و 14). روغن کبد کوسه که منبع اصلی اسکوالن شناخته می‌شود با محدودیت‌هایی مواجه است (15) و منابع گیاهی تولیدکنندۀ اسکوالن مانند زیتون و تاج‌خروس نیز محدودیت رشد دارند و میزان کمی از این ماده را تولید می‌کنند که باعث می‌شود استفاده از این منابع صرفۀ اقتصادی نداشته باشد (16 و 17). ترائوستوکیتریدها آغازیان تک‌سلولی دریازی هستند که گستردگی زیستی جهانی و توانایی تولید اسکوالن به مقدار زیاد را دارند. ساپروفیت‌بودن اعضای این خانواده و نیازنداشتن آنها به نور برای رشد، تولید تجاری اسکوالن را مقرون‌به‌صرفه کرده است؛ به‌طوری‌که اخیراً منبع جایگزینی برای تولید اسکوالن در نظر گرفته شده‌اند. جیانگ[xi] و همکاران در سال 2004 موفق شدند سویۀ Schizochytrium mangrovei FB1 از خانوادۀ ترائوستوکیتریدها را سویه‌ای با توان تولید اسکوالن زیاد معرفی کنند؛ میزان تولید اسکوالن در این سویه 3/1 میلی‌گرم‌بر‌لیتر گزارش شده است (18). گوان کونچن[xii] و همکاران در سال 2010 موفق شدند میزان 9/5 میلی‌گرم‌بر‌لیتر اسکوالن از سویۀ Aurantiochytrium sp. BR-MP4-A1 متعلق به خانوادۀ ترائوستوکیتریدها تولید کنند (19). سویۀ Aurantiochytrium sp. 18W13a در سال 2011 سویه‌ای تجاری در ژاپن معرفی شد که 5/6 گرم‌بر‌لیتر زیست‌توده و 3/1 گرم‌بر‌لیتر اسکوالن در روز چهارم پس‌از کشت و در شرایط بهینه تولید می‌کند (20). سویۀ مخمری Pseudozyma sp. JCC207 که در سال 2008 معرفی شده است، بیشترین میزان اسکوالن را در میان سویه‌های مخمری تولید می‌کند؛ این سویه توانایی تولید 5/340 میلی‌گرم‌برلیتر اسکوالن را در شرایط بهینه دارد (5). باوجود تمام پژوهش‌های انجام‌شده به‌منظور یافتن سویه‌ای با توانایی تولید مقدار زیاد اسکوالن و اهمیت روزافزون این موضوع در سطح بین‌المللی، تاکنون پژوهش‌های لازم در ایران و خاورمیانه برای بررسی خانوادۀ ترائوستوکیتریدها ازنظر تولید روغن ریزجلبکی غنی از اسکوالن انجام نشده است. در پژوهش حاضر از سویۀ بومی ترائوستوکیتریوم 1-71 برای تولید اسکوالن استفاده شد؛ این سویه را فکرت و شاکری در سال 1392 از جنگل‌های مانگرو و سواحل جنوب کشور جداسازی و خالص‌سازی کرده‌اند (6). سویۀ بومی ترائوستوکیتریوم 1-71 ازنظر تولید اسکوالن به‌‌طور کیفی و کمی با تجزیه‌وتحلیل‌های TLC و HPLC بررسی شد. نتایج بررسی توالی 18S rRNA نشان دادند این سویه بیشترین شباهت را به خانوادۀ ترائوستوکیتریدها و جنس ترائوستوکیتریوم دارد. رسم درخت فیلوژنتیکی برای این ژن نشان داد این سویه ازنظر ژنتیکی بیشترین شباهت را به سویۀ Thraustochytrium sp. ATCC 26185 دارد. نتایج بررسی میزان وزن خشک سلولی، روغن و اسکوالن تولیدی در سویۀ ترائوستوکیتریوم 1-71 نشان دادند بیشترین میزان زیست‌توده (12/4 گرم‌بر‌لیتر)، روغن (25/1 گرم‌بر‌لیتر) روغن و اسکوالن (6/74 میلی‌گرم‌در‌لیتر) در روز چهارم پس‌از کشت تولید می‌شود. باتوجه‌به تولید درخور توجه اسکوالن در این سویه در شرایط غیربهینه، انتظار می‌رود میزان تولید اسکوالن در این سویه با بهینه‌سازی شرایط محیط‌کشت افزایش یابد.

 

سپاسگزاری

از معاونت پژوهشی دانشگاه تحصیلات تکمیلی صنعتی و فناوری پیشرفته برای حمایت از پژوهش حاضر سپاسگزاری می‌شود.



[1]- Botrycoccus braunii

[2]- Thraustochytrid

[3]- Pseudozyma

[4]- Fekrat

[5]- Bligh

[6]- Dyer

[7]- Ultrasonic 

[8]- Thin-layer chromatography

[9]- High-performance liquid chromatography

[10]- Gas chromatography

[xi]- Jiang

[xii]- Guanqun Chen

(1)              Güneş FE. Medical use of squalene as a natural antioxidant. Biochemistry 2013; 10: 11.

(2)              Kelly GS. Squalene and its potential clinical uses. Alternative Medicine Review: A Journal of Clinical Therapeutic 1999; 4(1): 29-36.

(3)              Miettinen TA., Vanhanen H. Serum concentration and metabolism of cholesterol during rapeseed oil and squalene feeding. The American Journal of Clinical Nutrition 1994; 59(2): 356-363.

(4)              Kalogeropoulos N., Chiou A., Gavala E., Christea M., Andrikopoulos NK. Nutritional evaluation and bioactive microconstituents (carotenoids, tocopherols, sterols and squalene) of raw and roasted chicken fed on DHA-rich microalgae. Food Research International 2010; 43(8): 2006-2013.

(5)              Chang M-H., Kim H-J., Jahng K-Y., Hong S-C. The isolation and characterization of Pseudozyma sp. JCC 207, a novel producer of squalene. Applied Microbiology and Biotechnology 2008; 78(6): 963.

(6)              Fekrat F., Shakeri Sh. Investigation and production of omega 3 oil rich in docosahexaenoic acid by native strain of Aurantiochytrium TA4. Biological Journal of Microorganism 2015; 4(14): 9-24.

(7)              Nakazawa A., Kokubun Y., Matsuura H., Yonezawa N., Kose R., Yoshida M., et al. TLC screening of thraustochytrid strains for squalene production. Journal of Applied Phycology 2014; 26(1): 29-41.

(8)              Singh D., Gupta A., Wilkens SL., Mathur AS., Tuli DK., Barrow CJ., et al. Understanding response surface optimisation to the modeling of Astaxanthin extraction from a novel strain Thraustochytrium sp. S7. Algal Research 2015; 11: 113-120.

(9)              Bligh EG., Dyer WJ. A rapid method of total lipid extraction and purification. Canadian Journal of Biochemistry and Physiology 1959; 37(8): 911-917.

(10)          Özcimder M., Hammers W. Fractionation of fish oil fatty acid methyl esters by means of argentation and reversed-phase high-performance liquid chromatography, and its utility in total fatty acid analysis. Journal of Chromatography A 1980; 187(2): 307-317.

(11)          Albuquerque CL., Santana ÁL., Meireles MAA. Thin layer chromatographic analysis of annatto extracts obtained using supercritical fluid. Food and Public Health 2015; 5(4): 130-140.

(12)          Matsuura H., Watanabe MM., Kaya K. Squalene quantification using octadecylbenzene as the internal standard. Procedia Environmental Sciences 2012; 15: 43-46.

(13)          Rajaratnam RA., Gylling H., Miettinen TA. Independent association of serum squalene and noncholesterol sterols with coronary artery disease in postmenopausal women. Journal of the American College of Cardiology 2000; 35(5): 1185-1191.

(14)          Rao CV., Newmark HL., Reddy BS. Chemopreventive effect of squalene on colon cancer. Carcinogenesis 1998; 19(2): 287-290.

(15)          Li Q., Chen G-Q., Fan K-W., Lu F-P., Aki T., Jiang Y. Screening and characterization of squalene-producing thraustochytrids from Hong Kong mangroves. Journal of Agricultural and Food Chemistry 2009; 57(10): 4267-4272.

(16)          Newmark HL. Squalene, olive oil, and cancer risk: a review and hypothesis. Cancer Epidemiology and Prevention Biomarkers 1997; 6(12): 1101-1103.

(17)          Sun H., Wiesenborn D., Tostenson K., Gillespie J., Rayas-Duarte P. Fractionation of squalene from amaranth seed oil. Journal of the American Oil Chemists' Society 1997; 74(4): 413-418.

(18)          Jiang Y., Fan K-W., Tsz-Yeung Wong R., Chen F. Fatty acid composition and squalene content of the marine microalga Schizochytrium mangrovei. Journal of Agricultural and Food Chemistry 2004; 52(5): 1196-1200.

(19)          Chen G., Fan K-W., Lu F-P., Li Q., Aki T., Chen F., et al. Optimization of nitrogen source for enhanced production of squalene from thraustochytrid Aurantiochytrium sp. New Biotechnology 2010; 27(4): 382-389.

Kaya K., Nakazawa A., Matsuura H., Honda D., Inouye I., Watanabe MM. Thraustochytrid Aurantiochytrium sp. 18W-13a accummulates high amounts of squalene. Bioscience, Biotechnology, and biochemistry 2011; 75(11): 2246-2248.