تولید بیوسورفکتانت و حذف زیستی لکه‌های نفتی با استفاده از جدایه‌های بومی باکتری‌های سواحل جنوبی دریای خزر

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 دانشجوی دکتری گروه میکروبیولوژی، دانشکدۀ علوم پایه، دانشگاه آزاد اسلامی واحد لاهیجان، ایران

2 دانشیار گروه میکروبیولوژی، دانشکدۀ علوم پایه، دانشگاه آزاد اسلامی واحد لاهیجان، ایران

3 دانشیار گروه میکروبیولوژِی، دانشکدۀ علوم پایه، دانشگاه آزاد اسلامی واحد رشت، ایران

4 استادیار گروه میکروبیولوژی، دانشکدۀ علوم پایه، دانشگاه آزاد اسلامی واحد لاهیجان، ایران

چکیده

مقدمه: امروزه تجزیۀ زیستی آلودگی‌های نفتی با استفاده از باکتری‌های بومی درخور توجه است. هدف پژوهش حاضر، جداسازی باکتری‌های بومی تولید‌کنندۀ بیوسورفکتانت با قابلیت حذف زیستی لکه‌های نفتی موجود در سواحل دریای خزر است.
مواد و روش‏‏ها: نمونه‌برداری از رسوبات و لکه‌های نفتی هفت ایستگاه داخل سواحل بندر انزلی و کیاشهر انجام شد. تولید بیوسورفکتانت با استفاده از روش‌های کمّی و کیفی شامل همولیز در محیط آگار خون‌دار، روش گسترش نفت، آزمایش انهدام قطره، فعالیت امولسیون‌کنندگی (آمیزندگی) و آزمون کشش سطحی انجام شد. میزان تجزیۀ زیستی ترکیبات در رسوبات و لکه‌های نفتی به روش کروماتوگرافی گازی (GC-MS) و شناسایی باکتری‌ها با آزمون‌های بیوشیمیایی و تعیین توالی ژن 16S rRNA انجام شد.
نتایج: از میان 115 جدایۀ حاصل، 57 جدایه بر اساس آزمون‌های کیفی تولید‌کنندۀ ترکیبات فعال سطحی بودند. 15 جدایه از 57 جدایه برای مراحل بعدی و آزمون‌های تکمیلی انتخاب شدند؛ نتایج اسپکتروفتومتری این جدایه‌ها نشان دادند جدایۀ 3J با میزان حذف نفت 6/94 درصد طی 7 روز توانمندترین جدایه در حذف هیدروکربن‌های نفتی است. تجزیه‌وتحلیل کروماتوگرافی گازی حذف 90 درصد ترکیبات آلیفاتیک طی 21 روز را توسط این جدایه نشان دادند. سه جدایۀ برتر تولید‌کنندۀ ترکیبات بیوسورفکتانت شامل J3، J5 و J12 بر اساس آزمون‌های بیوشیمیایی و مولکولی به‌ترتیب در گروه‌های باسیلوس سرئوس، استافیلوکوکوس همولیتیکوس و سودوموناس آئروژینوزا شناسایی شدند.
بحث و نتیجه‏گیری: نتایج نشان دادند سویه‌های جداسازی‌شده سطح آبگریزی، توانایی تولید ترکیبات فعال‌کنندۀ سطحی و ویژگی تجزیۀ ترکیبات هیدروکربنی را در حد مناسبی دارند. جدایه‌های J3 و J5 و J12 بیشترین درصد حذف نفتی را نشان دادند و نمونۀ J3 پس‌از 21 روز با استفاده از کروماتوگرافی گازی (GC-MS) میزان TPH را به میزان6/94 درصد در نفت خام کاهش داد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Biosurfactant Production and Biological Removal of Bulk Oil using Native Strains Isolated from the Southern Shore Lines of Caspian Sea

نویسندگان [English]

  • Jina Tanzadeh 1
  • Mohammad Faezi Ghasemi 2
  • Masoumeh Anvari 3
  • Khosro Issazadeh 4
1 Ph.D Student, Department of Microbiology, Faculty of Basic Sciences, Lahijan Branch, Islamic Azad University, Lahijan, Iran
2 Associate professor, Department of Microbiology, Faculty of Basic Sciences, Lahijan Branch, Islamic azad University, Lahijan, Iran
3 Associate professor, Department of Microbiology,Faculty of Basic Sciences, Rasht Branch, Islamic Azad University, Rasht, Iran
4 Assistant professor, Department of Microbiology, Faculty of Basic Sciences, Lahijan Branch , Islamic Azad University, Lahijan, Iran
چکیده [English]

Introduction: Nowadays, biodegradation of oil pollution using native bacteria isolates is considered in different research programs. The purpose of this study was to investigate biosurfactant production and degradation of oil spills on Caspian Sea coastlines using native bacterial isolates.
Materials and methods: Sediment and oil spills samples were isolated from seven stations in the coasts of Bandar Anzali and Kiah Shahr. Biosurfactant production was evaluated using quantitative and qualitative methods such as hemolysis on blood agar, oil spreading method, droplet disintegration, emulsification activity and surface tensile test. Also, total hydrocarbon of oil was estimated. Biodegradation of compounds in sediments and petroleum analyzed using gas chromatography mass spectrometry (GC-MS) method. Identification of strains was performed using different morphological, biochemical and sequencing of 16S rRNA genes.
Results: Amongst 115 isolates, 57 isolates showed biosurfactant activity based on qualitative methods, and 15 strains with highest biological removal efficiency were selected for further studies. The spectrophotometry results showed the J3 isolate could remove 94.6% of oil within 7 days, was the most potent isolate in removal of hydrocarbons. Gas chromatography analysis indicated that 90% of aliphatic compounds were removed byJ3 strain in 21 days.  The isolates J3, J5, and J12, which showed highest biosurfactant activity, were identified as strains of   Bacillus cereussenso latu, Staphylococcus aureus and Pseudomonas aeruginosa, respectively.
Discussion and conclusion: The results of this study showed that the isolated strains showed suitable decreasing hydrophobicity and removal of oil hydrocarbons. So, it can be concluded that isolated J3, J5 and J12 are potent microorganisms in cleaning of contaminated waters by oil and other hydrocarbons.

کلیدواژه‌ها [English]

  • Contamination
  • Biosurfactant Production
  • Biodegradation
  • Bulk Oil

مقدمه

لکه‌های نفتی از مهم‌ترین مشکلات تهدیدکنندۀ محیط‌زیست‌های آبی به شمار می‌روند و وقوع هر لکۀ نفتی با آسیب به محیط‌زیست دریایی همراه است. لکه‌های نفتی اغلب روی دریاها و در تأسیسات خطوط ساحلی ظاهر می‌شوند و بیشتر با مسیر رفت‌و‌آمد کشتی‌ها مرتبط هستند. قرارگیری در معرض لکۀ نفتی با‌توجه‌به زمان و مکان و سمیت و غلظت لکۀ نفتی ممکن است به مرگ موجودات مختلف منجر و آثار مضری ازجمله کاهش تولیدمثل، رشد غیرمناسب، مشکل در سازوکار تغذیه و کاهش قدرت دفاعی در برابر بیماری‌ها را موجب شود (1). هیدروکربن‌های نفتی با منشأ فعالیت‌های انسانی بر اثر نشت و ورود نفت خام و ترکیبات فراوری‌شدۀ آن و یا ورود باقیمانده‌های ناشی از احتراق ناقص نفت وارد محیط می‌شوند. تاکنون بیش از ۱۷۵ هیدروکربن در ترکیب نفت شناسایی شده است که ۱۰۸ نمونۀ آن ترکیبات آلیفاتیک اشباع‌شده و بقیه ترکیبات آروماتیک هستند. هیدروکربن‌های آلیفاتیک ترکیبات شاخه‌ای و سادۀ نفت محسوب می‌شوند که بر اساس تعداد اتم‌های کربن دسته‌بندی می‌شوند. ترکیبات آروماتیک از مهم‌ترین آلاینده‌های موجود در نفت خام هستند و آثار مخرب آنها بر سلامت انسان و محیط‌زیست چشمگیر است؛ به‌طوری‌که ورود آنها به زنجیرة غذایی انسان ممکن است موجب بروز انواع بیماری‌ها، سرطان و مشکلات ژنتیکی در انسان شود. بندر انزلی در بخش غربی ساحل جنوبی دریای خزر جزو قدیمی‌ترین بندرهای ایران است و بیش از ۱۲۰ سال از عمر آن می‌گذرد. این بندر درباری بین تالاب انزلی و دریای خزر قرار دارد و دارای دو بازوی موج‌شکن سنگی است که حوضچۀ بندر را تشکیل می‌دهند. امروزه، روش تجزیۀ زیستی هیدروکربن‌های نفتی با استفاده از باکتری‌های بومی به دلایل اقتصادی و زیست‌محیطی درخور توجه است. بیوسورفکتانت‌ها با ساختمان دوگانه‌دوست آب‌دوست و آب‌گریز از مواد فعال سطحی هستند که به‌علت توانایی‌هایی مانند کم‌کردن کشش سطحی و بین‌سطحی یا قدرت امولسیون‌کنندگی دارای پتانسیل استفاده در حوزه‌های مختلفی مانند صنایع شیمیایی، نفت، پتروشیمی، پلاستیک‌ها و مواد کامپوزیتی، دترجنت‌ها و پاک‌کننده‌ها، صنعت نساجی، محصولات آرایشی، صنایع رنگ، کاغذ، معدن، فلزات، تهیۀ حشره‌کش‌ها و کنترل آفت‌ها، غذا و بسته‌بندی غذایی، مواد دارویی، پژوهش‌های پزشکی و بیوشیمیایی و سایر حوزه‌های فناوری پیشرفته هستند (2). برای تولید بیوسورفکتانت توسط میکروب‌ها از بسترهایی مانند نفت خام (3) روغن زیتون (4)، پوست میوۀ پرتقال (5) و گلوکز (6) استفاده می‌شود. هدف پژوهش حاضر بررسی توانایی تولید بیوسورفکتانت و قابلیت حذف نفتی توسط باکتری‌های بومی جداسازی‌شده از مناطق آلوده به لکه‌های نفتی در سواحل جنوبی دریای خزر است.

 

مواد و روش‌ها

.نمونه‌برداری: در پژوهش حاضر، نمونه‌گیری از هفت منطقۀ رسوب و لکه‌های نفتی موجود در سواحل بندر انزلی (طول جغرافیایی ۴۹ درجه و ۲۸ دقیقه و عرض جغرافیایی ۳۷ درجه و ۲۸ دقیقه) انجام شد؛ این مناطق شامل 3 نمونه از رسوب و لکه‌های نفتی در سه ایستگاه داخل بندر انزلی از سه فاصلۀ طولی 5، 50 و 100 متری ساحل (از هرکدام 3 نمونه با فاصلۀ 50 متر از یکدیگر در عرض ساحل)، 2 نمونه از لکه‌های نفتی موجود در منطقۀ سنگاچین، 2 نمونه از خاک سواحل کیاشهر (طول جغرافیایی 37 درجه و 10 دقیقۀ شمالی و عرض جغرافیایی 49 درجه و 56 دقیقۀ شرقی) و 1 ایستگاه (ایستگاه شاهد) در خارج از بندر انزلی بودند و نمونه‌ها پس‌از جمع‌آوری به آزمایشگاه منتقل شدند. در فرایند نمونه‌برداری حدود ۲۰۰ تا ۳۰۰ گـرم نمونـه از رسوبات سطحی مرطوب با عمق حداکثر 5 سانتی‌متر برداشته شد. بـرای نمونـه‌بـرداری از رسـوبات سـطحی بـستر بـه‌منظـور اندازه‌گیری هیدروکربن‌هـای موجـود از روش شـمارة ۲۰ اسـتاندارد UNEP/IOC/IAEA استفاده شد. اسیدیتۀ نمونه‌ها با دستگاه (Horiba U-54) اندازه‌گیری شد. نمونه‌ها به‌طور میانگین در دمای 29 در‌جۀ سانتی‌گراد، اسیدیتۀ برابر 2/8 و میزان قابلیت هدایت الکتریکی 5/48 دسی‌زیمنس‌بر‌متر (ds/m) داشتند..

محیط‌کشت: نفت خام موردآزمایش از پالایشگاه نفت تهران با چگالی 8445/0 گرم‌بر‌سانتی‌مترمکعب تهیه شد. نمونه‌ها در محیط‌کشت MSM (Mineral Salt medium) حاوی 1 درصد نفت خام (تنها منبع کربن و انرژی) کشت شدند؛ به این منظور، 100 میلی‌لیتر محیط‌کشت MSM درون ارلن‌های 250 میلی‌لیتری ریخته شد، به‌مدت 20 دقیقه در دمای 121 درجۀ سانتی‌گراد استریل شد و سپس 1 میلی‌متر نفت خام استریل‌شده به آن اضافه شد. ترکیبات محیط پایۀ نمکی (MSM) استفاده‌شده در پژوهش حاضر عبارتند از: 5/2 گرم‌بر‌لیتر K2HPO4، 3/0 گرم‌بر‌لیتر MgSO4. 7H2O، 4 گرم‌بر‌لیتر (NH4)Cl، 05/0 گرم‌بر‌لیتر NaCl و 01/0 گرم‌بر‌لیتر CaCl2. سپس به ترکیب یادشده میزان 2 میلی‌لیتر عناصر کمیاب به شرح زیر اضافه شد: 75/0 گرم‌بر‌لیتر H2O ZnSO4.، 2/0 گرم‌بر‌لیتر MgSO4. H2O، 075/0 گرم‌بر‌لیتر CuSO4. 5H2O، 05/0 گرم‌بر‌لیتر Na2MnO4. 2H2O، 08/0 گرم‌بر‌لیتر 2CoCl. 6H2O، 15/0 گرم‌بر‌لیتر H3BO3، 027/0 گرم‌بر‌لیتر FeCl3. 6H2O. پس‌از افزودن 1 میلی‌لیتر از نمونه‌های جداسازی‌شده به ارلن‌های محیط‌کشت MSM حاوی غلظت‌های مختلف (5/0، 1، 5/1 و 2 درصد) نفت خام، ارلن‌ها به‌مدت 21 روز در دمای 30 درجۀ سانتی‌گراد درون انکوباتور شیکردار با 180دوردردقیقه (rpm) قرار گرفتند؛ پس‌از‌آن، 5 میلی‌لیتر از مایع میکروبی به پلیت‌های حاوی محیط‌کشت MSMجامد اضافه شد و پلیت‌ها درون انکوباتور با دمای 30 درجۀ سانتی‌گراد قرار گرفتند (7). برای خالص‌سازی باکتری‌ها، کلنی‌هایی که ازنظر ماکروسکوپی و میکروسکوپی متفاوت بودند به‌طور متوالی به روش کشت خطی روی محیط‌کشت نوترینت‌آگار کشت شدند. کشت نمونه‌ها روی محیط جامد نوترینت‌آگار تا رسیدن به کلنی خالص تکرار شد (8).

.غربال‌گری باکتری‌های جداشده بر اساس تولید بیوسورفکتانت:به‌منظور بررسی تولید بیوسورفکتانت توسط جدایه‌ها، ارلن‌ها به‌مدت 40 دقیقه در دور 4000 دوردردقیقه سانتریفیوژ شدند و با مشاهدۀ کدورت حاصل از رشد باکتری‌ها درون لوله‌ها، مایع رویی از باکتری‌ها جداسازی و برای بررسی تولید بیوسورفکتانت استفاده شد (9)..

آزمون‌های تشخیص تولید بیوسورفکتانت

آزمون همولیز خون در محیط‌کشت آگار خون‌دار (BA): کشت باکتری‌های جداسازی‌شده روی محیط آگار خون‌دار دارای 5 درصد (V/V) خون گوسفند انجام و نمونه به‌مدت 48 تا 72 ساعت در 37 درجۀ سانتی‌گراد گرماگذاری شد. جدایه‌های حاوی همولیز بتا (ایجادکنندۀ هالۀ شفاف) برای آزمون‌های بعدی انتخاب شدند (10)؛ هالۀ شفاف اطراف کلنی فعالیت همولیتیک سویه‌ها را نشان داد و قطر هالۀ تولید‌شده شاخصی برای تأیید توان تولید بیوسورفکتانت در نظر گرفته شد (11). از محلول رقیق‌شدۀ آب و صابون برای شاهد مثبت و از آب مقطر و محیط MSM بدون تلقیح باکتری برای نمونۀ شاهد منفی استفاده شد (11).

.آزمون پراکنش نفت OilSpread Method (OSM): برای انجام این آزمایش، مقدار 50 میلی‌لیتر آب مقطر داخل پلیت ریخته شد و سپس 100 میکرولیتر نفت خام به سطح آب افزوده شد؛ پس‌از پخش‌شدن نفت، 10 میکرولیتر روماند میکروبی حاصل از سانتریفیوژ لایۀ نفتی در مرحلۀ پیش به آن افزوده شد. چنانچه روماند میکروبی حاوی بیوسورفکتانت باشد توانایی کنار‌زدن لایۀ نفتی و ایجاد ناحیۀ شفاف روی سطح آب را دارد. در این آزمون از Tween20 (مرک- آلمان) برای شاهد مثبت و از محیط‌کشت MSM بدون باکتری برای شاهد منفی استفاده شد؛ همچنین، اگر قطر لایۀ شفافی که عصارۀ حاصل از سانتریفیوژ ایجاد می‌کند کمتر از 10 میلی‌متر بود با علامت + و اگر بین 10 تا 20 میلی‌متر و بیشتر از 20 میلی‌متر بود به‌ترتیب با ++ و +++ نمایش داده شد (12 و 13).

 

.آزمایش‌‌های تکمیلی برای غربال‌گری باکتری‌های تولید‌کنندۀ بیوسورفکتانت

اندازه‌گیری کشش سطحی: به این منظور، 5 میلی‌لیتر روماند حاصل از سانتریفیوژ به لوله‌های آزمایشی اضافه شد که در حمام آب‌گرم با دمای 28 درجۀ سانتی‌گراد قرار داشتند. کشش سطحی روماند تمام نمونه‌های آزمایش‌شده در شرایط دمایی یکسان بر حسب میلی‌نیوتن‌بر‌متر با دستگاه تنسیومتر به روش حلقۀ دونوی (Du Nouy Ring Method) اندازه‌گیری شد. در هر بار اندازه‌گیری کشش سطحی از آب مقطر غیراستریل برای شاهد منفی و از Tween20 برای شاهد مثبت استفاده شد (14).

بررسی فعالیت امولسیون‌کنندگی: برای اندازه‌گیری فعالیت امولسیون‌کنندگی از روش کوپر و گولدنبرگ[1] (1987) استفاده شد (15)؛ برای این منظور، 5 میلی‌لیتر از کشت 48‌ساعتۀ باکتری در محیط پایۀ نمکی (MSM) همراه با 6 میلی‌لیتر هیدروکربن مدنظر (نفت خام) در لولۀ آزمایش مدرج ریخته شد. محتویات لولۀ آزمایش به‌مدت 2 دقیقه در 200 دوردردقیقه هم زده و سپس به‌مدت 24ساعت در شرایط سکون قرار داده شدند (16). پس‌از این مدت، فعالیت امولسیفیکاسیون (EC) با استفاده از آزمون E24(Emulsification index) محاسبه شد. از محیط‌کشت استریل برای شاهد منفی و از سدیم‌دودسیل‌سولفات برای شاهد مثبت استفاده شد (16).

 

100×حجم لایه امولسیون/حجم کل ستون مایع=E24

 

بررسی فعالیت شکل‌گیری کف: میزان پایداری امولسیون ایجاد‌شده توسط بیوسورفکتانت تولیدی سویه‌های برتر با اندازه‌گیری فعالیت شکل‌گیری کف مشخص شد (12). همۀ جدایه‌هایی که طی مراحل اولیۀ غربال‌گری نتایج مثبت نشان داده بودند به‌طور جداگانه به ارلن‌های 250میلی‌لیتری حاوی 100 میلی‌لیتر محیط نوترینت‌براث تلقیح شدند و به‌مدت 96 ساعت درون انکوباتور شیکر (200 دوردردقیقه) با دمای 37 درجۀ سانتی‌گراد قرار گرفتند؛ سپس فعالیت تشکیل کف بر اساس میزان پایداری کف و ارتفاع کف تولید‌شده بررسی شد. از محیط‌کشت استریل برای شاهد منفی و از سدیم‌دودسیل‌سولفات برای شاهد مثبت استفاده شد (9).

جداسازی بیوسورفکتانت: برای این منظور، محلول شفاف رویی حاصل از سانتریفیوژ به کمک کلریدریک‌اسید 6 نرمال تا رسیدن به اسیدیتۀ 2 اسیدی شد و پس‌از نگهداری در دمای 4 درجۀ سانتی‌گراد به‌مدت یک‌ شبانه‌روز، رسوب حاصله به کمک سانتریفیوژ در8500 دور‌در‌دقیقه به مدت 15 دقیقه جمع آوری شد. پس‌از آن به حجمی برابر با محلول رویی حاصل از سانتریفیوژ، کلروفرم و متانول با نسبت (1:2) به رسوب اضافه شد و در ادامه، فاز آلی مجزا و حلال آن در آون و دمای 60 درجۀ سانتی‌گراد تبخیر شد (16).

سنجش میزان حذف نفت: در این روش، نفت خام موجود در نمونه‌های آزمایش پیش و پس‌از تجزیۀ زیستی با استفاده از حلال غیرقطبی تولوئن و دی‌کلر‌ومتان استخراج (7) و نمودار استاندارد نفت خام برای تعیین مقادیر هیدروکربن نمونه‌ها رسم شد. در این نمودار، بین جذب نوری و غلظت هیدروکربن در حلال غیرقطبی رابطه وجود دارد و به ازای هر غلظت از آلاینده، لوله‌های بدون باکتری (شاهد) تهیه می‌شوند (17). برای تعیین توانمندی جدایه‌های حاصل در حذف نفت خام، ابتدا هریک ازجدایه‌ها با استفاده از روش سنجش کل محتوای هیدروکربنی از طریق اسپکتروفتومتری ارزیابی شد.

.سنجش میزان حذف نفت و رشد جدایه‌ها با روش سنجش کل محتوای هیدروکربنی: برای تعیین توانمندی جدایه‌ها در حذف نفت خام از روش سنجش کل محتوای هیدروکربنی[2] به روش رحمان و همکاران[3] (2003) استفاده شد (7، 18، 19)؛ برای این منظور، هریک از جدایه‌ها به‌طور جداگانه به ارلن‌های 50 میلی‌لیتری حاوی 10 میلی‌لیتر محیط‌کشت MSM همراه با 1 درصد نفت خام (تنها منبع کربن) تلقیح و به‌مدت 15 روز در شیکرانکوباتور با دمای 28 درجۀ سانتی‌گراد و دور 180 دوردردقیقه گرماگذاری شدند. محتوای هیدروکربنی باقیمانده در ارلن‌ها 5، 10 و 15 روز پس‌از تلقیح با حلال تولوئن استخراج و میزان جذب نوری آن پس‌از سانتریفیوژ به‌مدت 5 دقیقه در 4000 دوردردقیقه با دستگاه اسپکتروفتومتر دوشعاعی مرئی- فرابنفش مدل Lambda25 در طول موج 420 نانومتر تعیین شد. منحنی استاندارد با استفاده از نفت خام رسم و غلظت کل محتوای هیدروکربنی نمونه‌های تیمارشده با منحنی استاندارد و نیز نمونۀ شاهد (محیط‌کشت 1 درصد نفت و بدون باکتری) مقایسه شد (7).

.سنجش میزان حذف نفت با استفاده از کروماتوگرافی گازی (GC-MS): برای تأیید میزان حذف نفت و انتخاب برترین جدایه، 15جدایۀ برگزیده از مرحلۀ پیش که دارای بیشترین فعالیت حذف نفت بودند به روش طیف‌سنجی با دستگاه کروماتوگرافی گازی (Shimadzu GC-Q2010, Japan) سنجیده شدند (17). جدایه‌ها در محیط‌کشت همراه با 1 درصد نفت خام کشت داده شدند و پس‌از گذشت 15 روز، محتوای هیدروکربنی باقیمانده در محیط‌کشت با استفاده از حلال تتراکلریدکربن استخراج و با دستگاه کروماتوگرافی گازی (GC-MS) مجهز به ستون HP-5MS به طول 30 متر و قطر داخلی 25/0 میلی‌متر با گاز حامل هلیوم سنجیده شد. شرایط دمایی تجزیه‌وتحلیل به شرح زیر بود: ابتدا 3 دقیقه در دمای 50 درجۀ سانتی‌گراد (دمای شروع) ماند، سپس دما با سرعت 15 درجۀ سانتی‌گرادبردقیقه تا دمای 29 درجۀ سانتی‌گراد افزایش یافت و مدت 6 دقیقه روی این دما ماند و سپس تزریق انجام شد (17).

شناسایی جدایه‌ها: شناسایی جدایه‌های دارای توانایی زیاد در تولید بیوسورفکتانت بر اساس ویژگی‌های ماکروسکوپیک، میکروسکوپیک، بیوشیمایی و تجزیه‌وتحلیل 16S rRNA انجام شد. ویژگی‌های ریخت‌شناسی و بیوشیمیایی شامل اندازۀ کلنی، شکل کلنی، شرایط کشت، اندازۀ سلول، کاتالاز، اکسیداز، تولید اسید از قندها، هیدرولیز کازئین، نشاسته، ژلاتین، اسکولین، سیترات، همولیز، رشد در درجه‌حرارت‌های مختلف، رشد در درصدهای مختلف نمک، حرکت، تشکیل اندول، آرژنین‌دهیدرولاز، لیزین‌دکربوکسیلاز، لیپاز، اوره‌آز و سایر آزمون‌های بیوشیمیایی لازم بررسی شدند. به‌منظور تعیین توالی ژن 16S rRNA از کشت باکتری‌های هدف برای شناسایی کلنی تک استفاده شد. استخراج DNA ژنومی از کلنی تک باکتری با استفاده از کیت DNeasy Blood & Tissue Handbook شرکت Qiagen کرۀ جنوبی انجام شد. واکنش زنجیرۀ پلیمراز تکثیر ژن 16S rRNA با استفاده از آغازگرهای 27f: 5'-GAGTTTGATCCTGGCTCAG-3' و 1505r: 5'-GATACGGCTACCTTGTTACGA-3' به کمک ترموسایکلر مدل Techne FTC51S5D (Staffordshire, UK) انجام شد.

برنامۀ PCR در شرایط زیر انجام شد: واسرشته‌شدن ابتدایی در 95 درجۀ سانتی‌گراد به‌مدت 3 دقیقه، واسرشته‌شدن طی 35 چرخه در 93 درجۀ سانتی‌گراد به‌مدت 45 ثانیه، جفت‌شدن آغازگرها در دمای 58 درجۀ سانتی‌گراد به‌مدت 1 دقیقه و طویل‌شدن در 72 درجۀ سانتی‌گراد به‌مدت 90 ثانیه. خالص‌سازی محصول PCR به کمک کیت GF-1 PCR Clean- up (Vivantis technologies, Malaysia) انجام شد. واکنش زنجیره‌ای پلیمراز با استفاده از آغازگرهای زیر انجام شد.

27f: 5'- GAGTTTGATCCTGGCTCAG -3'

16r339: 5'- ACTGCTGCCTCCCGTAGGAG -3'

16f358: 5’- CTCCTACGGGAGGCAGCAG-3'

704f: 5'- GTAGCGGTGAAATGCGTAGA- 3'

1505r: 5'- GATACGGCTACCTTGTTACGA -3'

 

نتایج

در مطالعۀ حاضر پس‌از نمونه‌برداری از هفت ایستگاه داخل سواحل بندر انزلی و کیاشهر و یک ایستگاه (ایستگاه شاهد) خارج از سواحل در مناطق آلوده به نفت، تعداد 115 باکتری جداسازی شدند که بر اساس ویژگی‌های ریخت‌شناسی و میکروسکوپی، 38 باسیل گرم مثبت، 32 کوکسی گرم مثبت، 25 باسیل گرم منفی و 20 کوکسی گرم منفی بودند. از میان جدایه‌ها، 25 جدایه بهترین فعالیت همولیتیکی را در آزمون همولیز نشان دادند و 32 جدایه دارای توانایی پراکنش روغن (OSM) بودند. طی آزمون‌های غربال‌گری اولیه، 15 جدایه برای آزمون‌های تکمیلی انتخاب شدند (جدول 1).

محلول رویی حاصل از سانتریفیوژ حاوی بیوسورفکتانت باشد لایۀ نفتی را کنار می‌زند و ناحیۀ شفافی در سطح آب ایجاد می‌کند. موریکاوا و همکاران[4] (2000) (12) این روش را برای مقایسۀ فعالیت شکل‌های حلقوی و خطی سورفکتین و آرتروفکتین استفاده و بیان کردند قطر ناحیۀ شفاف ایجادشده با غلظت بیوسورفکتانت موجود در محیط رابطۀ مستقیم دارد.

 

جدول 1- آزمون های تکمیلی تولید بیوسورفکتانت توسط جدایه‌ها

نمونه‌ها

فعالیت همولیتیک روی آگار خون‌دار

OSM

فعالیت شکل‌گیری کف

درصد امولسیفیکاسیون نفت خام E24%

کشش سطحی

(میلی‌نیوتن‌برمتر)

J1

+

+

+

12/68 درصد

03/51

J2

+

+

_

14/61 درصد

4/41

J3

++

++

++

7/80 درصد

85/37

J4

+++

++

++

98/79 درصد

85/37

J5

++

++

++

97/79 درصد

48/38

J6

+

+

+

28/71 درصد

06/50

J7

+

+

+

08/65 درصد

12/51

J8

+

+

+

52/59 درصد

16/51

J9

+

+

+

76/66 درصد

16/53

J10

+

+

+

08/65 درصد

34/52

J11

+

+

+

53/64 درصد

39/50

J12

++

++

++

12/72 درصد

62/49

J13

_

+

_

16/55 درصد

12/50

J14

+

+

_

51/59 درصد

05/53

J15

_

+

+

13/42 درصد

31/52

آب مقطر

_

_

_

_

02/71

SDS1%

_

_

_

57 درصد

 

محیط‌کشت استریل

_

_

_

_

63

 

 

به‌منظور افزایش‌دادن احتمال جداسازی باکتری‌های مولد بیوسورفکتانت، تمام نمونه‌های جمع‌آوری‌شده در محیط‌کشت اختصاصی باکتری‌های تجزیه‌کنندۀ نفت (MSM حاوی 1 درصد نفت خام به‌عنوان تنها منبع کربن و انرژی) کشت داده شدند (شکل 1). روش همولیز روی محیط آگار خون‌دار یک روش غربال‌گری اولیه در تولید بیوسورفکتانت است و مشاهدۀ همولیز در محیط‌کشت آگار نشان‌دهندۀ کاهش کشش سطحی گلبول‌های قرمز خون و لیزشدن آنها در اثر رشد باکتری‌های یادشده و در واقع، توانایی تولید بیوسورفکتانت آنها است.

 

شکل 1 الف- ارلن تیمارشده با جدایۀ J3 در محیط‌کشت  MSMهمراه با 1 درصد نفت خام در مقایسه با نمونۀ شاهد MSM بدون باکتری

 

شکل 1ب- ارلن تیمارشده با جدایۀ J3 در محیط‌کشت  MSMهمراه با 1 درصد نفت خام در مقایسه با نمونۀ شاهد MSM بدون باکتری

 

در پراکنش نفتی که روشی سریع و بسیار حساس برای تشخیص ترکیبات فعال سطحی است چنانچه

شاخص امولسیون‌کنندگی معیاری از توانایی بیوسورفکتانت در امولسیون‌کردن ترکیبات نفتی و نشان‌دهندۀ میزان پایداری امولسیون حاصل از آب و ترکیبات نفتی است. نتــایج فعالیــت امولــسیون‌کننــدگی کــشت سویه‌های غربال‌شده از مرحلۀ پیش با هیدروکربن نفتی نـشان دادند از میـان 15 سـویۀ حاصـل از غربـال‌گـری اولیـه، 5 سـویه دارای توانـایی امولسیون‌‌کنندگی 70 درصد یا بیشتر هستند که بـرای مطالعه‌های بیشتر انتخاب شدند. نتایج فعالیت امولسیون‌‌کنندگی جدایۀ J3 در شکل 2 نشان داده شده است. نتایج تولید بیوسورفکتانت در مقایسه با نمونۀ شاهد نشان دادند جدایۀ J3 مولد ترکیبات فعال سطحی است و کشش سطحی محیط را به میزان درخور توجهی کاهش می‌دهد (جدول 1).

اندازه‌گیری کشش سطحی (شاخصی برای بررسی حضور بیوسورفکتانت) با دستگاه تنسیومتری به روش حلقۀ دونوی[5] انجام می‌شود (20) و بر اساس رابطۀ W=2πrγ که w وزن قطره، r شعاع لولۀ مویین و γ کشش سطحی مایع است اندازۀ قطره با شعاع مجرا رابطۀ مستقیم دارد. باتوجه‌به اینکه کاهش کشش سطحی به کمتر از 40 میلی‌نیوتن‌بر‌متر شاخص تولید بیوسورفکتانت در نظر گرفته می‌شود، آزمایش تولید بیوسورفکتانت نشان می‌دهد این جدایه‌ها کاهش کشش سطحی را به‌خوبی نشان می‌دهند (جدول 1). بر اساس نتایج، جدایۀ J3 قادر به بیشترین کاهش کشش سطحی (از 63 به 85/37 میلی‌نیوتن‌برمتر) در مقایسه با نمونۀ شاهد است.

 

شکل 2- بررسی فعالیت امولسیون‌کنندگی در نمونۀ J3

 

توانایی هریک از جدایه‌ها در حذف نفت طی مدت 21 روز در محیط‌کشت پایۀ نمکی حاوی 1 درصد نفت بررسی شد و جدایه‌هایJ3، J5 و J12 بیشترین درصد حذف نفت را به خود اختصاص دادند (جدول 2). غلظت اجزای ترکیبـات آلیفاتیـک و آروماتیـک موجود با دسـتگاه کرومـاتوگرافی گــازی (GC-MS) تعیین و جدایۀ J3 پس‌از 21 روز، میزان TPH در نفت خام را به میزان 8/99 درصد کاهش داد.

 

در شـکل‌های 3 و 4، زیـرطیف‌هـای جرمـی نفـت خـام در نمونـۀ شــاهد و نمونۀ حاوی باکتری J3 با استفاده از کروماتوگرافــی گازی طیف‌ســنج جرمــی توسـط دسـتگاه GC-MS نشــان داده شــده است. نتایج نشان می‌دهند هـرچـه ارتفـاع و سـطح زیـر پیـک بیشـتر باشـد میـزان آلودگـی نیـز بیشـتر اسـت. در ایـن نمودارهـا سـتون افقـی نشـان‌دهندۀ زمـان و سـتون عمـودی نشـان‌دهندۀ غلظـت فــراورده است.

 

 

جدول 2- بررسی بازدۀ تجزیه‌کنندگی نفت خام توسط جدایه‌ها

نمونه‌‌ها

حذف نفتی (درصد) پس‌از 7 روز در طول موج 420 نانومتر

J3

6/94 درصد

J5

5/42 درصد

J12

42 درصد

J11

9/32 درصد

 

 

شکل 3- تجزیه‌وتحلیل کروماتوگرافی گازی نمونۀ نفت خام پیش‌از تیمار با جدایۀ J3

 

 

شکل 4- تجزیه‌وتحلیل کروماتوگرافی گازی نمونۀ J3 در محیط‌کشت حاوی 1 درصد نفت خام پس‌از 21 روز گرماگذاری

 

همان‌طور کــه در طیــف جرمــی نمونۀ J3 مشــاهده می‌شــود ارتفــاع و ســطح زیر پیــک کاهــش یافتــه است کــه نشـان‌دهندۀ حـذف آلودگـی توسـط باکتری مـدنظـر است. بر اساس نتایج کروماتوگرافی گازی بیشترین میزان حذف به ترکیبات C9، C10 و C30 تا C35 مربوط است.

با‌توجه‌به نتایج، بهترین شرایط برای به‌دست‌آوردن بیشترین کاهش TPH در اسیدیتۀ برابر 7، دمای 37 درجۀ سانتی‌گراد، غلظت 1 درصد نفت خام و زمان 21 روز حاصل می‌شود. بر اساس نتایج تجزیه‌وتحلیل TPH، نمونۀ حاوی نفت خام و نمونۀ J3 بیشترین قدرت تولید بیوسورفکتانت را نشان می‌دهد. برای جدایۀ J3 که حاوی بیشترین قدرت تولید بیوسورفکتانت و درصد حذف نفتی 6/94 درصد است، کاهش TPH برابر 8/99 درصد است.

بر اساس بررسی‌های ریخت‌شناسی و بیوشیمیایی انجام‌شده، جدایۀ J3 روی محیط‌کشت نوترینت‌آگار در 30 درجۀ سانتی‌گراد دارای کلنی‌هایی به‌اندازۀ 2 میلی‌متر، سفید‌رنگ، تخم‌مرغی با اطراف صاف، نرم و تیره بود. در مطالعۀ میکروسکوپی، باسیل‌های گرم مثبت کوتاه یا دارای زنجیره‌های بلند مشاهده شدند و اندازۀ سلول‌ها بزرگ‌تر از 1 میکرومتر بود. سایر ویژگی‌های ریخت‌شناسی و بیوشیمیایی در جدول 3 دیده می‌شوند. جدایۀ J5 روی محیط‌کشت آگار خون‌دار در 30 درجۀ سانتی‌گراد دارای کلنی‌هایی به‌اندازۀ 1 تا 5/1 میلی‌متر، سفید، کروی با اطراف صاف، محدب، نرم، درخشنده و تیره بود. در مطالعۀ میکروسکوپی، کوکسی‌های گرم مثبت به‌شکل دسته‌های نامنظم دیده شدند. سایر وی‍‍ژگی‌ها در جدول 3 مشاهده می‌شوند. جدایه J12 روی محیط نوترینت‌آگار دارای کلنی‌های 2 تا 3 میلی‌متری با رنگدانۀ سبز و صورتی بود و کلنی‌ها به‌شکل کروی، مسطح با اطراف برآمده و لبه‌های نامنظم و نرم درخشان دیده شدند. سایر وی‍ژگی‌ها در جدول 3 آمده است.

 

 

جدول 3- ویژگی‌های ریخت‌شناسی و بیوشیمیایی جدایه‌های J3، J5 و J12

J12

J5

J3

ویژگی‌‌ها

J12

J5

J3

ویژگی‌ها

+

+

+

آزمون حرکت

+

+

+

اندازۀ سلول >1.0μm

+

 

+

لیپاز

باسیل

کوکسی

باسیل

ریخت‌شناسی سلول

بتا

آلفا

بتا

همولیز

-

+

+

واکنش گرم

-

 

+

دآمیناسیون فنیل‌‌آلانین

-

-

+

تشکیل اسپور

-

_

-

ایندول

+

+

+

کاتالاز

+

+

+

رشد در NaCl(2 تا 7 درصد)

+

+

+

اکسیداز

-

_

-

اوره‌آز

-

+

+

وژس– پروسکوئر (VP)

 

+

 

ساکارز

 

 

+

گلوکز

+

+

+

مالتوز

 

 

_

آرابینوز

-

-

 

Dnase

 

 

_

گزیلوز

_

+

 

متیل‌رد

+

+

-

مانیتول

 

+

 

ONPG

+

 

+

سیترات

 

+

 

PYR

+

+

 

اکسیداز

_

_

_

کوآگولاز

غیرتخمیری

 

 

OF

-

_

_

سولفید‌هیدروژن

ALK/ALK

 

 

KIA (Kligler Iron Agar)

+

_

+

رشد در 42 درجۀ سانتی‌گراد

ALK/ALK

 

 

LIA (Lysine Iron Agar)

+(سبز فلورسنت)

-

-

پیگمان

+

+

+

احیای نیترات به ازت

 

پس‌از انجام مراحل واکنش زنجیره‌ای پلیمراز و الکتروفورز محصول وجود قطعۀ 1500 نوکلئوتیدی تأیید شد. یک توالی 1446 بازی از ژن 16S rRNA برای جدایۀ J3 حاصل شد؛ میزان مشابهت توالی حاصل با ژن مشابه از سویه‌های یادشده که همگی به گروه باسیلوس تعلق داشتند در جدول 4 آمده است. توالی 16S rRNA جدایۀ J3 در پایگاه اطلاعاتی NCBI با شماره دسترسی MH368126 ثبت شد.

یک توالی 1485 بازی از ژن 16S rRNA برای جدایۀ J5 به دست آمد؛ میزان مشابهت توالی حاصل با ژن مشابه از سویۀ استافیلوکوکوس همولتیکوس MTCC 3383T[6]  که توالی کل ژنوم آن با کد LILF01000056 در پایگاه NCBI ثبت شده است 86/99 درصد است. MTCC مرکز کلکسیون و نگهداری ریزموجودات در کشور هند است. توالی 16S rRNA جدایۀ J5 در پایگاه اطلاعاتی NCBI با شماره دسترسی MH368118 ثبت شد.

یک توالی 1456 بازی از 16S rRNA برای جدایۀ J12 به دست آمد؛ میزان شباهت توالی حاصل با ژن مشابه از سودوموناس آئروجینوزا [7]JCM 5962T که توالی کل ژنوم آن با کد BAMA01000316 در پایگاه NCBI ثبت شده است 100 درصد است. JCM مرکز کلکسیون و نگهداری ریزموجودات در کشور ژاپن است. توالی 16S rRNA جدایۀ J12 در پایگاه اطلاعاتی NCBI با شماره دسترسی MH368439 ثبت شد.

 

 

جدول 4- شباهت توالی 16S rRNAجدایۀ J3 با سویه‌های گروه باسیلوس سرئوس

Completeness

Diff/Total nt

Similarity (%)

Accession

Hit strain name

Hit taxon name

100.00

0/1435

100.00

KJ812440

N35-10-2(T)

Bacillus albus

100.00

0/1435

100.00

KJ812435

N24(T)

Bacillus tropicus

100.00

0/1435

100.00

KJ812430

4049(T)

Bacillus nitratireducens

100.00

0/1435

100.00

KJ812415

TD41(T)

Bacillus luti

 


بحث و نتیجه‌گیری

آلودگی محیط‌زیست با نفت و مشتقات آن به‌ویژه درکشورهای تولیدکنندۀ نفت به نگرانی جهانی تبدیل شده است (3 و 21)؛ ازاین‌رو، توسعۀ روش‌های پاکسازی زیستی با قابلیت کاربرد در محیط‌های آلوده به ترکیبات نفتی دارای اهمیت بسزایی است. در میان روش‌های موجود برای کاهش آثار منفی ترکیبات نفتی در جایگاه‌های آلوده، اصلاح زیستی به کمک ریزموجودات یکی از پرکاربردترین روش‌هاست. میزان تجزیۀ زیستی با روش‌های اصلاح زیستی افزایش می‌یابد (3 و 22). هدف پژوهش حاضر، بررسی توانایی تولید بیوسورفکتانت و قابلیت حذف نفتی توسط باکتری‌های بومی جدا‌سازی‌شده از مناطق آلوده به لکه‌های نفتی در منطقۀ ساحلی بندر انزلی در استان گیلان است. بر اساس اصل تطابق، باکتری‌های مولد بیوسورفکتانت در مکان‌هایی یافت می‌شوند که در تماس با آلودگی مواد نفتی و هیدروکربنی هستند. در پژوهش حاضر از اصل یادشده به‌منظور دستیابی به این باکتری‌ها استفاده شد. سه روش همولیز روی محیط آگار خون‌دار، روش انهدام قطره و روش گسترش نفت برای غربال‌گری باکتری‌های مولد بیوسورفکتانت استفاده شدند (23 و 24). نتایج حاصل از تولید بیوسورفکتانت توسط نمونه‌های جداسازی‌شده در پژوهش حاضر نشان دادند از میان 115 جدایۀ به‌دست‌آمده، 57 جدایه بر اساس آزمون‌های کیفی تولیدکنندۀ ترکیبات فعال سطحی هستند. 15 جدایه از 57 جدایه با بیشترین فعالیت کاهش‌دهندگی سطحی برای مراحل بعدی و آزمون‌های تکمیلی انتخاب شدند. در آزمون‌های تکمیلی، جدایه‌های J3، J5،J11 وJ12 بیشترین فعالیت تجزیه‌کنندگی را نشان دادند و در بین چهار جدایۀ یادشده، J3 بیشترین توانایی تجزیه‌کنندگی را به خود اختصاص داد؛ این جدایه بر اساس نتایج بیوشیمیایی و تجزیه‌وتحلیل 16S rRNA به گروه باسیلوس سرئوس تعلق دارد. میزان شباهت جدایۀ J3 به چهار گونۀ باسیلوس آلبوس[viii]، باسیلوس تروپیکوس[ix]، باسیلوس نیتراتیردوسنس[x] و باسیلوس لوتی[xi]100 درصد است. لیو و همکاران[xii] در سال 2017 چهار جدایۀ یادشده و پنج جدایۀ دیگر از جنس باسیلوس سرئوس را از نمونه‌های مختلف شامل رسوبات و آب دریا جداسازی کردند (جدول 4). جدایۀ J3 در پژوهش حاضر از آب‌های آلوده به ترکیبات نفتی نیز جداسازی شد که با پژوهش لیو و همکاران مطابقت دارد. برای تشخیص نهایی می‌بایست تجزیه‌وتحلیل )[xiii](MLST انجام شود که بر اساس ترادف‌یابی قطعه‌های داخلی ژن‌های خانه‌دار[xiv] انجام می‌شود (25).

گونانامی و همکاران[xv] در سال 2010 در زمینۀ پاکسازی زیستی آلودگی‌های نفت خام با استفاده از ریزموجودات نشان دادند تولید بیوسورفکتانت ارتباط مستقیمی با جذب مواد اولیۀ هیدروکربنی موجود در محیط دارد و سبب پاکسازی زیستی زمین‌های آلوده می‌شود. آنها 6 سویۀ مختلف از جنس باسیلوس جداسازی کردند (19). جوزف و همکاران[xvi] در سال 2009 موفق به جداسازی سویه‌های مختلف جنس باسیلوس دارای نقش در تجزیۀ ترکیبات نفتی از خاک‌های آلوده به ترکیبات نفتی شدند (26). مصطفی‌پور و احمدی[xvii] جدایه‌ای از گروه باسیلوس سرئوس را از نمونه‌های نفت، آب و خاک‌های آلودۀ مختلف جداسازی و شناسایی کردند که قابلیت زیادی در کاهش کشش سطحی و تولید بیوسورفکتانت داشت )27).

در پژوهش حاضر، جدایۀ J5 به جنس استافیلوکوکوس متعلق بود و بر اساس ترادف‌یابی 16S rRNA استافیلوکوکوس همولیتیکوس شناسایی شد. یوبانی و همکاران[xviii] در سال 2016 انواع مختلفی از باکتری‌های تجریه‌کنندۀ ترکیبات نفتی را از کمپوست‌ها جداسازی کردند و گونۀ استافیلوکوکوس اپیدرمیدیس جزو جدایه‌های شناسایی‌شده بود (28). موکرد و همکاران [xix] در پژوهش خود در سال 2008 تجزیۀ زیستی نفت خام در آب را با اضافه‌کردن منابع نیتروژنی افزایش دادند؛ یکی از چهار جدایه‌ای که در افزایش تجزیه نقش داشتند گونه‌ای از استافیکوکوس شناسایی شد (29).

جدایۀ J12 متعلق به جنس سودوموناس و گونۀ آئروژینوزا شناسایی شد. اخوان و همکاران در سال 2008 از آزمون‌های همولیتیک و کاهش کشش سطحی برای سنجش تولید بیوسورفکتانت توسط باسیلوس‌ها استفاده کردند (30).

جیالاکشمی و تووسیو [xx]در سال 2003 نمونه‌ای از باکتری‌های تولیدکنندۀ بیوسورفکتانت مانند باسیلوس مگاتریوم[xxi]، کورینه‌باکتریوم کوتشری[xxii] و سودوموناس آئروژینوزا[xxiii] را از نمونه‌های آب بندر توتیکوری در سواحل جنوب‌شرق هند جداسازی کردند (31). آبولوس و همکاران[xxiv] در سال 2001 تولید بیوسورفکتانت رامنولیپیدی توسط سودوموناس آئروجینوزا AT10 جداشده از پسماند تصفیۀ روغن سویا را معادل 5/9 گرم‌در‌لیتر گزارش کردند (32). در سال‌های اخیر، تولید بیوسورفکتانت انگیزۀ زیادی برای افزایش استخراج نفت و ازبین‌بردن آلودگی‌های نفتی ایجاد کرده است (چسبندگی باکتری‌ها به هیدروکربن‌ها حلالیت آنها را افزایش می‌دهد و تجزیۀ آن را تحریک می‌کند). پروتی و همکاران [xxv] در سال 1997 نشان دادند سویه‌های گرم منفی می‌توانند به هیدروکربن‌های متعددی متصل شوند و بیش از80 درصد گونه‌های سودوموناس، باسیلوس و اسنیتوباکترها به هیدروکربن‌های متعددی می‌چسبند (33). آلکان‌ها بخشی از ترکیبات آلیفاتیک موجـود در هیدروکربن‌های نفتی و حاوی تعـداد زیادی از نشانگرهای زیستی مرتبط با منـشأ و ماهیـت هیـدروکربن‌هـای نفتی هستند. فراوانی نسبی آلکان‌ها با تعداد کربن‌های مختلف یـا غالب‌بودن حضور یک آلکان مشخص در رسوبات بیان‌کنندۀ حضور نوع ویژه‌ای از هیدروکربن‌های نفتـی در نمونـه‌هـای ‌رسـوبی است. در این زمینه، حضور شاخص آلکان نرمال 18کربنه (n-C18) در نمونه‌های رسوبی نـشان‌دهنـدة منـشأ نفتـی هیـدروکربن‌هـای مشاهده‌شده است. در پژوهش حاضر، در منطقة ورودی بندر انزلی، در مجـاورت تـالاب کـه خــارج از محــدودة لایروبــی است بیــشترین میــزان غلظــت TPH مــشاهده شد. بر اساس نتایج کروماتوگرافی گازی مشخص شد بیشترین میزان حذف به ترکیبات n-C9، n-C10 و  C30تا n-C35 مربوط است. مشاهده‌های فیزیولوژیکی و بررسی‌های گازکروماتوگرافی تأیید می‌کنند که باکتری‌های بومی جداسازی‌شده از هیدروکربن‌های نفتی برای منبع کربن استفاده و آنها را به ترکیبات ساده‌تر تجزیه می‌کنند؛ ازآنجاکه نفت فرآورده‌ای سمی برای سیستم‌های زیستی و یکی از آلوده‌کننده‌های اصلی اکوسیستم‌های زیستی محسوب می‌شود و آلودگی‌های نفتی آثار مضری روی انسان و سایر موجودات زنده دارند، نتایج پژوهش حاضر در استفاده از باکتری‌های بومی برای تجزیۀ لکه‌های نفتی شاخصی برای رفع آلودگی‌های نفتی مناطق آلوده است. ترکیبات فعال در سطح شامل بیوسورفکتانت‌ها ازجمله شاخص‌های ریزموجودات تجزیه‌کنندۀ آلاینده‌های نفتی هستند که حضور باکتری‌های جداسازی‌شده با توانایی تولید بیوسورفکتانت در رسوبات آلودۀ موجود در منطقۀ ساحلی نشان‌دهندۀ توانایی احتمالی سازش‌پذیری آنها با محیط‌های آلوده به هیدروکربن است (34-36).

نتایج پژوهش حاضر نشان می‌دهند نمونه‌های J3، J5 و J12 دارای توانایی بیشترین درصد حذف نفتی هستند. تجزیه‌وتحلیل نمونۀ J3 پس‌از 21 روز با استفاده از کروماتوگرافی گازی (GC-MS) نشان داد این باکتری TPH را به میزان 6/94 درصد در نفت خام کاهش می‌دهد. جدایه‌های پژوهش حاضر دارای پتانسیل زیاد در تولید بیوسورفکتانت هستند و می‌توانند در تجزیۀ لکه‌های نفتی به‌عنوان شاخصی برای رفع آلودگی‌های نفتی در مناطق آلوده به نفت استفاده شوند.

 

سپاسگزاری

از خانم دکتر فرزانه عزیز محسنی و همکاران مرکز کلکسیون قارچ‌ها و باکتری‌های صنعتی و عفونی ایران برای شناسایی نژادهایی جداسازی‌شده سپاسگزاری می‌شود.



[1]- Cooper and Gotenberg

[2]- Total Petroleum Hydrocarbon (TPH)

[3]- Rahman et al.

[4]- Murikava et al.

[5]- Du Nouy Ring Method 

[6]- Staphylococcus haemolyticus

[7]- Pseudomonas aeruginosa

[viii]- Bacillus albus

[ix]- Bacillus tropicus

[x]- Bacillus nitratireducens

[xi]- Bacillus luti

[xii]- Liu et al.

[xiii]- Multilocussequence typing

[xiv]- House keeping

[xv]- Gnanamani et al.

[xvi]- Joseph et al.

[xvii]- Mostafapour and Ahmady-Asbchin

[xviii]- Ubani et al.

[xix]- Mukred et al.

[xx]- Jayalakshmi and Thavasi

[xxi]- B. megaterium

[xxii]- C. kutsheri

[xxiii]- Pseudomonas aeruginosa

[xxiv]- Abalos et al.

[xxv]- Pruthi et al.

(1)              Najafi AR., Rahimpour MR., Jahanmiri AH., Roostaazad R., Arabian D., Ghobadi Z. Enhancing biosurfactant production from an indigenous strain of Bacillus mycoides by optimizing the growth conditions using a response surface methodology. Chemical Engineering Journal 2010; 163(3): 188-194.

 

(2)              Zhang G-l., Wu Y-t., Qian X-p., Meng Q. Biodegradation of crude oil by Pseudomonas aeruginosa in the presence of rhamnolipids. Journal of Zheijang University Sciences- B. 2005; 6: 725-730.

(3)              Ibrahim ML., Ijah UJJ., Manga SB., Bilbis LS., Umar S. Production and partial characterization of biosurfactant produced by crude oil degrading bacteria. International Biodeterioration and Biodegradation 2013; 81: 28-34.

(4)              Khopade A., Biao R., Liu X., Mahadik K., Zhang L., Kokare C. Production and stability studies of the biosurfactant isolated from marine Nocardiopsis sp. B4. Desalination 2012; 285: 198-204.

(5)              George S., Jayachandran K. Analysis of rhamnolipid biosurfactants produced through submerged fermentation using orange fruit peelings as sole carbon source. Applied Biochemistry and Biotechnology 2008; 158(3): 694-705.

(6)              Joshi SJ., Geetha SJ., Yadav S., Desai AJ. Optimization of bench-scale production of biosurfactantbyBacillus licheniformis R2. Apcbee Procedia 2013; 5: 232-236.

(7)              Rahman KS., Thahira-Rahman J., Lakshmanaperumalsamy P., Banat IM. Towards efficient crude oil degradation by a mixed bacterial consortium. Bioresource Technology 2002; 85(3): 257-261.

(8)              Sakthipriyaa N., Mukesh Dobleb., Jitendra S. Sangwai. Bioremediation of Coastal and Marine Pollution due to crude oil using a microorganism Bacillus subtilis. Procidia Engineering 2015; 116: 213-220.

(9)              Zhang X., Li M., Xiang T. Genetic modification of MEOR bacterium Bacillus licheniformis H strain by low energy ion beam irradiation. Open Biotechnology Journal 2010; 4: 14-17.

(10)          Shankar S., Kansrajh C., Dinesh MG., Satyan RS., Kiruthika S., Tharanipriya A. Application of indigenous microbial consortia in bioremediation of oil-contaminated soils. International Journal of Environmental Science and Technology (IJEST) 2014; 11(2): 367-376.

(11)          Varjani SJ., Rana DP., Bateja S., Sharma MC., Upasani VN. Screening and identification of biosurfactant (bioemulsifier) producing bacteria from crude oil contaminated sites of Gujarat, India. Engineering and Technology 2014; 3(2): 9205-9213.

(12)          Morikawa M., Hirata Y., Imanaka TA. Study on the structure–function relationship of lipopeptidebiosurfactants. BBA Molecular and Cell Biology of Lipids 2000; 1488(3): 211-218.

(13)          Nasr S., Soudi MR., Mehrnia MR. Characterization of novel biosurfactant producing strains of Bacillus spp. isolated from petroleum contaminated soil. Iranian Journal of Microbiology (IJM) 2009; 1(2): 54-61.

(14)          Dastgheib SM., Amoozegar MA., Khajeh K., Ventosa A. A halotolerant Alcanivorax sp. strain with potential application in saline soil remediation. Applied Microbiology and Biotechnology 2011; 90(1): 305.

(15)          Pereira JF., Gudiña EJ., Costa R., Vitorino R., Teixeira JA., Coutinho JA., et al. Optimization and characterization of biosurfactant production by Bacillus subtilis isolates towards microbial enhanced oil recovery applications. Fuel 2013; 111: 259-268.

(16)          Islam Janpen H., Kitten A., Dassara Y. Screening of biosurfactants producing bacteria and optimization of production process. Journal of Basic Microbiology 2000; 1-3.

(17)          Youssef NH., Duncan KE., Nagle DP., Savage KN., Knapp RM., McInerney MJ. Comparison of methods to detect biosurfactant production by diverse microorganisms. Journal of Microbiological Methods 2004; 56(3): 339-347.

(18)          Behnood M., Nasernejad B., Nikazar M. Biodegradation of crude oil from saline waste water using white rot fungus Phanerochaete chrysosporium. Journal of Industrial and Engineering Chemistry 2014; 1879-1885.

(19)          Gnanamani A., Kavitha V., Radhakrishnan N., Mandal AB. Bioremediation of crude oil contamination using microbial surface-active agents: isolation, production and characterization. Journal of Bioremediation and Biodegradation 2010; 1(2): 1-8.

(20)          Bodour AA., Miller Maier RM. Application of a modified dropcollapse technique for surfactant quantization and screening of biosurfactant-producing microorganisms. Journal of Microbiological Methods 1998; 32: 273-280.

(21)          Megharaj M., Ramakrishnan B., Venkateswarlu K., Sethunathan N., Naidu R. Bioremediation approaches for organic pollutants: a critical perspective. Environment International 2011; (8): 1362-1375.

(22)          Christofi N., Ivshina IB. Microbial surfactants and their use in field studies of soil remediation. Journal of Applied Microbiology 2002; 93(6): 915-929.

(23)          Rahman KSM., Rahman TG., Lakshmanaperumalsmy P., Marchant R., Banat IM. The potential of bacterial isolates for emulsification with a range of hydrocarbons. Acta Biotechnologica 2003; 23(4): 335-345.

(24)          Batista SB., Mounteer AH. Isolation and characterization of biosurfactant/ bioemulsifier producing bacteria from petroleum contaminated sites. Bioresource Technology 2006; 97: 868-875.

(25)          Liu Y., Du J., Lai Q., Zeng R., Ye D., Xu J.,et al. Proposal of nine novel species of the Bacillus cereus group .International Journal of Systematic and Evolutionary Microbiology 2017; 67: 2499-2508.

(26)          Joseph P., Joseph A. Microbial enhanced separation of oil from petroleum refinery sludge. Journal of hazardous materials 2009; 161(1): 522-525.

(27)          Mostafapour R., Ahmady-Asbchin S. Isolation and identification of biosurfactant-producing strains from the genus Bacillus cereus and antibacterial effects of biosurfactant Production in vitro. Arak Medical University Journal (AMUJ) 2014; 16(81): 59-74.

(28)          Ubani O., Atagana H. Identification and characterisation of oil sludge degrading bacteria isolated from compost. Archives of Environmental Protection 2016; 42(2): 67-77.

(29)          Mukred A., Hamid A., Hamzah A., Wan Mohtar Wan Yusoff. Development of three bacteria consortium for the bioremediation of crude petroleum-oil in contaminated water. Online Journal of Biological Sciences 2008; 8(4): 73-79.

(30)          Akhavan Sepahi A., Dejban Golpasha I., Emami M. Isolation and characterization of crude oil degrading Bacillus ssp. Iranian Journal of Enviromental Health Science and Engineering 2008; 5(3): 149-154 (in Persian).

(31)          Mishra S., Sarma PM., Lal B. Crude oil degradation efficiency of a recombinant Acinetobacter baumannii strain and its survival in crude oil-contaminated soil microcosm. FEMS Microbiology Letters 2004; 235(2): 323-331.

(32)          Abalos A., Pinazo A., Infante MR., Casals M., García F., Manresa A. Physicochemical and antimicrobial properties of new rhamnolipids produced by Pseudomonas aeruginosa AT10 from soyabean oil refinery wastes. Langmuir 2001; 17: 1367-1371.

(33)          Pruthi V., Cameotra SS. Rapid identification of biosurfactant-producing bacterial strains a cell surface hydrophobicity technique. Biotechnology Techniques 1997; 11(9): 671-674.

(34)          Banat IM., Makkar RS., Cametora SS. Potential commercial application of microbial surfactants. Applied Microbiology and Biotechnology 2000; 53: 495-508.

(35)          Saravanan V., Vijayakumar S. Isolation and screening of biosurfactant producing microorganisms from oil contaminated soil. Journal of Academia and Industrial Research 2012; 1(5): 264-268.

(36)          Gautam KK., Tyagi VK. Microbial surfactants: A Review. Journal of Oleo Science 2006; 55(4): 155-166.