مقایسه روش‌های مولکولی و ریخت‌شناسی در مطالعه همزیستی قارچ‌های میکوریزی آربوسکولار گیاه زعفران (Crocus sativus L.)

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 کارشناسی ارشد میکروبیولوژی، علوم و تحقیقات خراسان رضوی، دانشگاه آزاد اسلامی، نیشابور، ایران

2 استادیار ژنتیک مولکولی، پژوهشکده زیست‌فناوری- سازمان پژوهش‌های علمی و صنعتی ایران، تهران، ایران

چکیده

مقدمه: شناسایی قارچ‌های همزیست میکوریزا آربوسکولار گیاه زعفران که در فصل‌های سال با تنش‌های محیطی فراوان اعم از اقلیمی و خاکی مواجه است، جهت کاربرد، افزایش رشد و تولید گیاه و مقاومت به عوامل بیماری‌زا اهمیت ویژه‌ای دارد.
مواد و روش‏‏ها: وجود اسپور قارچ‌های همزیست میکوریزا آربوسکولار در خاک ریزوسفر گیاه زعفران سه منطقه از مزارع شهرستان گناباد بررسی شد. همچنین کلنیزاسیون ریشه و تنوع قارچ‌های همزیست با زعفران طی دو سال متوالی 93-1392 مبتنی بر روش‌های ریخت‌شناسی و مولکولی انجام شد. علاوه بر این، کشت تله‌ای با استفاده از گیاه سورگوم و خاک سه منطقه کشت زعفران انجام شد. روش مولکولی با استفاده از PCR آشیانه‌ای حاصل از تکثیر ژن زیرواحد کوچک ژن rRNA قارچ‌های کلنیزه انجام شد.
نتایج: طی بررسی اسپورهای موجود در اطراف خاک ریزوسفر، سه گونه اسکوتلوسپورا دیپورپورسنس، ریزوفاگوس اگرگاتوس و فونیلیفورمیس کالدونیوم شناسایی شدند. کلنیزه‌شدن میکوریزها در ریشه زعفران در فیلد طبیعی تنها در یک منطقه مشاهده شد؛ درحالی که کلنیزه‌شدن میکوریزها در گیاه تله سورگوم در خاک مناطق کشت زعفران بین 21 تا 24 درصد متغیر بود، در مزرعه زعفران بیش از 5/1 درصد مشاهده نشد. با وجود این، نتایج مولکولی همزیستی آنها را درتمام مناطق مطالعه‌شده زعفران و گیاه سورگوم نشان داد. این نتایج کلنیزاسیون زعفران را با ریزوفاگوس ایرانیکوس و ف. کالدونیم نشان دادند. پیش از این، به روش مولکولی تعیین همزیستی در زعفران گزارش نشده است.
بحث و نتیجه‏گیری: تنوع گونه‌ای قارچ‌های همزیست در سورگوم و زعفران متفاوت بود و بر اساس مقایسه نتایج همزیستی مبتنی بر ریخت‌شناسی و مولکولی، به نظر می رسد که روش مولکولی ارائه‌شده شاخص مناسب‌تری برای وجود همزیستی است در حالی که روش‌های کلاسیک نتایج متفاوت و گاه گمراه‌کننده‌ای ارائه می‌کنند.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

A comparison between molecular and morphological methods in evaluation of vesicular-arbuscularmycorrhizal fungi colonization with Crocus sativus L (saffron)

نویسندگان [English]

  • Hamzeh Pooryousef 1
  • Jafar Hemmat 2
  • Mohsen Vaez 2
1 MSc. of Microbiology, Khorasan-e-Razavi branch of Science and Research, Islamic Azad University, Neyshabur, Iran
2 Assistant professor of molecular genetics, Biotechnology Department. Iranian Research Organization for Science and Technology (IROST) Tehran, Iran
چکیده [English]

Introduction: Evaluation of symbiosis between Arbuscular mycorrhizal fungi (AMF) and Saffron (Crocus Sativus L.) is important because this strategic plant encounters with many environmental stresses such as climatic and edaphic stresses during seasons and the AMF can let the crops increase their productivity along with the improvement of their resistance to stress factors and pathogens
Materials and methods: The spores of AMF around rhizosphere of saffron were studied in three fields of Gonabad, Khorasan province, Iran (2013-14). Moreover, the colonization of mycorrhizal fungi with saffron and sorghum trap were studied in three regions using morphologic and molecular methods by nested PCR and amplification of small subunit of rRNA gene fragments.
Results: Three species of arbuscular mycorrhizal fungi, Scutellospora dipurpurescens, Funneliformis caledonius and Rhizophagus aggregatus were identified in the soil around rhizosphere of the saffron of three regions. The colonization of sorghum trap in the soil of saffron cultivation areas was among 21 -41%, while the colonization in the natural Saffron field was 1.5% and just in one area. However, the nested PCR results revealed the colonization of Saffron in all 3 regions.  These results showed the colonization of Saffron by Rhizophagus iranicus and F. caledonius.
Discussion and conclusion: The genus and species diversity of AMF Saffron and Sorghum are different. Moreover, the hereby proposed molecular method is a more precise approach to identify AMF colonization with Saffron while classical methods may provide different and misleading results.

کلیدواژه‌ها [English]

  • Saffron
  • Sorghum
  • Vesiculare Arbuscular Mycorrhizal (VAM)
  • Colonization
  • Nested PCR

مقدمه

قارچ‏های میکوریزایی، گروه ناهمگنی از گونه‏های مختلف قارچی و همزیست با ریشه‏ گیاهان بیش از 80 درصد گونه‏های گیاهی از خزه‌تباران[1] تا آوندداران[2] هستند (1). اعتقاد است که این رابطه حدود 460 میلیون سال پیش شکل گرفته و نقش مهمی در استقرار گیاهان روی زمین داشته است (2). با وجود فراوانی این قارچ‏ها و طیف گسترده ارتباط آن‌ها با گونه‏های گیاهی، تنها حدود 240 گونه بر اساس ریخت‌شناسی در شاخه گلومرومیکوتا توصیف شده‏اند (3-5). شایع‌ترین انواع این قارچ‌ها، میکوریزا آربوسکولارها (AMF)[3] هستند. گیاهان اولیه خود را باگروهی قدیمی از قارچ‌های گلومرومیکوتا[4] یا قارچهای میکوریزا آربوسکولار کلنیزه می‌کردند (1)، زیرا اجتماع قارچ با گیاه، رویداد سودمندانه متقابلی است که گیاه، کربن قارچ را تأمین می‌کند و قارچ‌ها به گیاه در جذب فسفات و دیگر مواد معدنی از خاک کمک می‌کنند. در نتیجه این همزیستی، افزایش زیست‌توده گیاهی و مقاومت گیاه به تنش‌‏ها وعوامل بیماری‌زا تقویت می‌شود (6 و 7). این همزیستی برای توسعه تولید و بهره‌وری محصولات مهم کشاورزی، تغذیه‌ای و دارویی اهمیت دارد (8). یکی از چالش‌های پژوهش‌های میکوریزی، ارائه روش شناسایی دقیق آن است.

زعفران خوراکی یا مزروعی[5]، گیاهی علفی و دایمی است که با توسعه ساقه پیازمانند دختری روی ساقه پیازمانند مادری رشد و تکثیر می‌یابد (9). این گیاه به دلیل ویژگی‌های دارویی و خوراکی، ارزش اقتصادی بسیاری دارد و ادویه‏ای گران‌قیمت است (10 و 11). کل تولید زعفران جهان حدود 220 هزار کیلوگرم است که حدود 80 تا 90 درصد آن، در ایران و در استان خراسان و باقیمانده در یونان، اسپانیا، ایتالیا و هند تولید می‌شود (12 و 13). زعفران طی فصل‌های سال با تنش‌های محیطی فراوانی اعم از اقلیمی و خاکی مواجه است. پژوهش‌های بسیاری نشان می‏دهند که رشد گیاهان میکوریزایی در تنش‌‏های محیطی به‌ویژه کمبود مواد غذایی، کمبود آب، وجود مواد سمی (سرب، کادمیوم، مس، نیکل و روی) در خاک، شوری خاک و حضور فلور میکروبی نسبت به گیاهان غیرمیکوریزایی بهتر ‏است و این گیاهان مقاومتر هستند (14 و 15). سازوکارهای متعددی درباره چگونگی تأثیر AMFبر جذب فلزها توسط گیاه وجود دارند، ازجمله کاهش جذب گیاه از راه تغییر در قابلیت دسترسی فلزها به گیاه یا جداسازی فلزها در بافت‌های گیاه (16-19). برخلاف بیشتر گیاهان نهاندانه مناطق معتدله، دوره رویشی زعفران در پاییز آغاز می‌شود و خزان آن در بهار اتفاق می‏افتد و از این رو، همزیستی میکوریزا با زعفران بر رشد بهینه و تولید بیشتر زعفران تأثیر می‌گذارد. زعفران گیاه مهم اقتصادی منطقه است که مطالعه جنبه‏های مختلف همزیستی قارچ‏های میکوریزا و ممکن‌کردن کاربرد آن، اتکا به کودهای شیمیایی را در این گیاه کاهش می‌دهد. پیش‌نیاز کاربردی‌کردن وزیکولار آربوسکولار برای هر گونه گیاهی مفید در اقتصاد کشاورزی مستلزم تعیین دقیق تنوع AMF است. با توجه به مشکلات یادشده، امروزه از روش‌های مولکولی به‌عنوان روش تکمیلی روش‌های ریخت‌شناسی برای شناسایی و تشخیص قارچ‌های میکوریز استفاده می‌شود. محدودیت‌های روشی و نبود دانش تاکسونومی از مهم‌ترین مشکلات مطالعه تنوع قارچ‌های AM هستند (5). بنابراین، اطلاعات حاصل از پژوهش حاضر ضمن شناسایی قارچ‏های میکوریزای بومی موجود در منطقه، به‌عنوان ابزاری برای توسعه پایدار کشاورزی به کار گرفته می‌شود. در پژوهش حاضر، بررسی پراکنش و تنوع قارچ‌های AMF در مزارع زعفران شهرستان گناباد و کلنیزاسیون ریشه آنها مبتنی بر روش‌های ریخت‌شناسی و مولکولی انجام و راهکاری برای ارائه روش شناسایی دقیق آن، یکی از چالش‌های پژوهش‌های میکوریزی، ارائه شد.

 

مواد و روش‌ها.

نمونه‌برداری: برای بررسی کلنیزاسیون قارچ‌های میکوریزا آربوسکولار در ریشه گیاه زعفران، از سه منطقه گناباد (R1، R2 و R3) با طول جغرافیایی 58 درجه و 41 دقیقه و عرض جغرافیایی 34 درجه و 21 دقیقه نمونه‌برداری و بررسی‏های لازم روی نمونه‏ها انجام شد. نمونه‌برداری‌ها در اسفندماه سال 1392 و تیرماه و آبان‌ماه سال 1393 انجام شدند؛ نمونه‌برداری تیرماه سال 1393 فقط از خاک (بدون ریشه در این مرحله از زمان) و برای کشت تله‌ای انجام شد. به‌طور تصادفی از هر منطقه تعداد 3 نمونه ریشه و خاک ریزوسفر مزارع زعفران جدا شد. در نمونه‏برداری حدود 2 کیلوگرم خاک اطراف ریشه (ریزوسفر) و ریشه‏های گیاه مربوطه از عمق 0 تا 30 سانتی‌متری جمع‌آوری شد. ریشهها در آب قرار داده شدند و سپس، به‌آرامی خاک باقیمانده اطراف ریشه‏ها با آب شسته شد. بخشی از ریشه‌ها که برای آزمایش‌های ریخت‌شناسی لازم بود، در محلول F.A.A (فرمالین، استیک‌اسید، الکل به نسبت حجمی 5:5:90) نگهداری شد.

جداسازی و شناسایی اسپورها: برای استخراج اسپور قارچ‌های اندومیکوریزایی  VAMاز روش الک مرطوب و دکانته‌کردن سوسپانسیون خاک استفاده شد. پس از سانتریفیوژ، اسپورها شمارش و بر اساس روش شرح‌داده شده در پیش، شناسایی شدند (20). در تیرماه سال 1393 برای تکثیر قارچ‌های میکوریز آربوسکولار، کشت گلدانی تله با استفاده از نمونه‌هـای خاک مزرعه و گیاه سورگوم انجام شد. برای هر منطقه، 4 گلدان تهیه شد:.

گلدان‌های شماره 1 تا 3: کشت سورگوم در نمونه خاک مناطق شماره 1 تا 3

گلدان شماره 4: مخلوط خاک منطقه همراه با کشت سورگوم

کف گلدان‌ها مقداری شن ریخته و سپس خاک به گلدان‌ها منتقل شد. دانه‌ها در فاصله 3 تا 4 سانتی‌متری سطح خاک در گلدان‌ها کشت شدند. پس از گذشت 6 ماه از کشت گلدانی، ریشه‌ها جمع‌آوری، در الکل 96 تا 100 درصد ذخیره و بی‌درنگ آزمون شدند.

رنگ‌آمیزی ریشه‌ها: ریشه‏های نگهداری‌شده در محلول F.A.A به‌ملایمت با آب مقطر شسته شدند. برای رنگ‌آمیزی ریشه‌ها از روش کرمانیک[6] و همکاران (1980) استفاده (21) و بررسی و عکس‌برداری از نمونه ریشه‌های رنگ‌آمیزی‌شده با دوربین الیمپوس[7] مدل BX51 انجام شد.

اندازه‌گیری درصد کلنیزه‌شدن ریشه‌ها: از روش جیووانتی و موسه[8] برای تعیین درصد کلنیزه‌شدن ریشه استفاده شد. مربعی با ابعاد 1010 سانتی‌متر به مربع‌های کوچکتری با ابعاد 5/05/0 سانتی‌متر شبکه‌بندی و زیر پتری‌دیش قرار داده شد. ریشه‏های میکوریزایی پس از رنگ‏آمیزی، به‌طور تصادفی درون پتری‌دیش پخش و زیر دوچشمی مشاهده شدند. سپس، تمام مکان‌های تلاقی ریشه (مجموع بخش‌های میکوریزایی‌شده و بخش‌های غیرمیکوریزایی) و مکان‏های تلاقی اندام‏های میکوریزایی ریشه‏ها (بخش‌های میکوریزایی) با شبکه، روی خطوط افقی و عمودی شمارش و درصد کلنیزه‌شدن ریشه با رابطه زیر محاسبه شد. این عمل برای هر تیمار سه بار تکرار و میانگین اعداد حاصل، درصد کلنی در هر تیمار در نظر گرفته شد (22).

 

A: درصد کلنیزاسیون، B: مکان‌های تلاقی اندام‌های میکوریزا با شبکه، C: مکان‌های تلاقی ریشه با شبکه (بخش‌های میکوریزایی و ‌بخش‌های غیرمیکوریزایی)

 

واکنش زنجیره‌ای پلیمراز آشیانه‌ای (Nested PCR):با هدف تکثیر ژن ریبوزومی (rRNA) که شامل ژن‌های کدشونده 18S است، واکنش زنجیره‌ای پلیمراز به‌شکل آشیانه‌ای برای جلوگیری از آلودگی‌های جانبی، کاهش اثر مواد بازدارنده و اختصاصی‌تر‌کردن واکنش بر اساس روش لی و همکاران (2008) انجام شد. در این روش، از جفت آغازگرهای NS1 و NS4 در مرحله اول و جفت آغازگرهای AML1 و AML2 در مرحله دوم PCRبرای تکثیر منطقه SSU rRNA استفاده می‌شود (23) (جدول 1).

 

جدول 1- پرایمرهای استفاده‌شده برای PCR آشیانه‌ای و تعیین ترادف

نام پرایمر

ترادف (5'-3')

جهت آغازگر

کاربرد

NS1

GTAGTCATATGCTTGTCTC

رفت

PCR اول

NS4

CTTCCGTCAATTCCTTTAAG

برگشت

PCR اول

AML1

ATCAACTTTCGATGGTAGGATAGA

رفت

PCR آشیانه‌ای

AML2

GAACCCAAACACTTTGGTTTCC

برگشت

PCR آشیانه‌ای

 

شرایط انجام PCR: با استفاده از پرایمرهای NS1 و NS4 در واکنش PCR، دمای واسرشتگی اولیه DNA دورشته 95 درجه سانتی‌گراد برای 15 دقیقه طی یک چرخه و سپس 35 چرخه شامل 40 ثانیه واسرشتگی در 94 درجه، 30 ثانیه برای اتصال در 54 درجه سانتی‌گراد پرایمرها، 40 ثانیه برای طویل‌سازی در 72 درجه سانتی‌گراد و در نهایت یک چرخه به مدت 4 دقیقه در 72 درجه سانتی‌گراد انجام شد. برای PCR آشیانه‌ای، دمای اتصال پرایمر‌ها 57 درجه سانتی‌گراد با استفاده از پرایمرهای داخلی AML1 و AML2 در نظر گرفته شد (جدول 1).

برای هر نمونه، محصول PCR روی ژل با طول قطعه مدنظر برای قارچ‌های میکوریز آربوسکولار انتخاب و با استفاده از دستورعمل کیت خالص‌سازی PCR (BioneerInc, Seoul, Korea)، خالص‌سازی شد. محصولات PCR آشیانه‌ای برای تعیین توالی با پرایمرهایAML1-V و AML2-V ارسال شد.

 

نتایج

بر اساس مشاهده میکروسکوپی اسپور موجود در ریزوسفر مزرعه 1 (منطقه R1)، دو گونه قارچ اسکوتلوسپورا دیپورپورسنس[9] و ریزوفاگوس اگرگاتوس (گلوموس اگراگاتوم[10]) و در مزرعه‌های 2 و 3 (منطقه‌های R2 و R3) تنها گونه قارچ فونلیفرمیس کالدونیم[11] شناسایی شد (شکل 1). دو نمونه در مجموعه مرجع قارچ‌های هرباریوم مؤسسه پژوهش‌های گیاه‌پزشکی کشور[12] با شماره دسترسی‌های زیر ثبت شده‌اند:

Scutellosporadipurpurescens (J.B. Morton &Koske,) [IRAN 16878F]

Rhizophagus fc.aggregatus (N.C. Schenck& G.S. Sm.) C. Walker

Funneliformiscaledonium (T.H. Nicolson &Gerd.) C. Walker & A. Schüßler [IRAN 16879F]

بر اساس مطالعه میکروسکوپی ریشه، درصد کلنیزاسیون قارچ‌های میکوریزا آربوسکولار در گیاه زعفران در منطقه R3 برابر 5/1 درصد و در سایر مناطق، صفر بود. بر اساس مشاهده ریشه، همزیستی در دو منطقه از سه منطقه وجود نداشت (جدول 2 و شکل D2).

پس از گذشت 6 ماه از انجام کشت‌های گلدانی تله، آلودگی به قارچ‌های میکوریزا آربوسکولار در تمام گیاهان سورگوم مشاهده شد که وجود اسپور قارچ‌ها را در ریزوسفر تمام مناطق نمونه‌برداری‌شده نشان می‌دهد (شکل 2). کلنیزاسیون میکوریزا در گیاه سورگوم در منطقه R1 برابر 18 درصد، منطقه R2 برابر 38 درصد و منطقه R3 برابر 32 درصد ثبت شد (جدول 2).

 

شکل1- الف و ب. دو تصویر اسپور ف. کالدونیم، ج. اسکوتلوسپورا دیپورپورسنس

 

جدول2- درصد کلنیزاسیون زعفران و سورگوم کشت‌شده در مناطق مختلف

گیاه میزبان

منطقه

درصد کلنیزاسیون گیاه میزبان در مناطق مختلف

R1

 

R2

 

R3

زعفران

-

 

-

 

5/1

سورگوم

18

 

38

 

32

شکل 2- A. موقعیت وزیکول و هیف در ریشه سورگوم کشت‌شده در خاک منطقه R1، B. موقعیت هیف در ریشه سورگوم کشت‌شده در خاک منطقه R2، C. موقعیت وزیکول در ریشه سورگوم کشت‌شده در خاک منطقه R3، . وزیکول مشاهده‌شده در ریشه زعفران R3

 

مطالعه مولکولی شناسایی قارچ‌های همزیست بر اساس تکثیر محصول هدف قارچ کلنیزه‌شده در ژنوم میزبان، وجود و قابلیت کلنیزه‌شدن قارچ‌های همزیست را در دو گونه گیاهی سورگوم و زعفران نشان داد (جدول 3). گونه‌های موجود در خاک منطقه R1 بر اساس ریخت‌شناسی اسپورهای موجود، ریزوفاگوس اگرگاتوس و اسکوتلوسپورا دیپورپورسنس تشخیص داده شدند. در سورگوم، گونه‌ای از ریزوفاگوس و در زعفران زراعی، ف. کالدونیوم تشخیص داده شد. در منطقه R2، نتایج حداقل در سطح جنس بین اسپور موجود در خاک و نمونه کلنیزه‌کننده سورگوم تشابه داشتند، هرچند با وجود کلنیزه‌بودن زعفران در این منطقه، قارچ همزیست به دلایل تکنیکی با روش مولکولی تشخیص داده نشد. در منطقه R3 که بر اساس روش ریخت‌شناسی بقایای وزیکول میکوریزی در ریشه زراعی نیز مشاهده شده بود، ریزوفاگوس ایرانیکوس در زعفران کلنیزه‌شده به روش مولکولی تشخیص داده شد، هرچند با گونه جنس اسپور موجود در خاک (ف. کالدونیوم) یا گونه کلنیزه‎کننده سورگوم (ریزوفاگوس آیریگولاریس) متفاوت بود (جدول 3). نتایج تعیین توالی و گونه‌های شناسایی‌شده در بانک ژن با شماره‌هایMF668213 وMF687342- MF687345ثبت شدند.

 

جدول3- مقایسه نتایج شناسایی قارچ‌های همزیست میکوریز بر اساس روش مولکولی و روش مبتنی بر ریخت‌شناسی اسپور موجود در خاک

منطقه

همزیست با زعفران

همزیست با سورگوم

اسپور خاک

R1

ف. کالدونیوم

گونه‌ای ازگلوموس

اسکوتلوسپورا دیپورپورسنس

ریزوفاگوس(گلوموس) اگرگاتوس

R2

تعیین نشد.

گونه ای از فونلیفرمیس

ف. کالدونیوم

R3

ریزوفاگوس ایرانیکوس

ریزوفاگوس آیریگولاریس

ف. کالدونیوم


بحث و نتیجه‌گیری

محبی[13] و همکاران (2015) با مطالعه جمعیت اسپوری خاک ریزوسفر زعفران مناطق خراسان رضوی و جنوبی (مناطق نزدیک به مطالعه حاضر)، 9 گونه قارچ میکوریزا آربوسکولار را در خاک زراعی زعفران گزارش کردند (جدول 4) و در بین آنها، 2 گونه ریزوفاگوس مانیه وتیس[14]و ف. موسه‌آ[15]بیشترین فراوانی را داشتند (20)؛ دو گونه قارچ یادشده در منطقه گناباد مشاهده نشدند و تنوع گونه‌ای قارچ‌ها به شرح جدول 4 بود و تفاوت‌ها در مناطق مجاور بارز و ویژه هر منطقه است.

سلوانکومر[16]و همکاران (2016)، باکتری‌های همراه دیواره اسپور قارچ‌های میکوریزا آربوسکولار را در منطقه سامنگوم[17]کره بررسی کردند. در این مطالعه، سه گونه قارچ فونلی فرمیس کالدونیم (موجود در خاک گناباد و همزیست در یک منطقه)، روکوسرتا البرسه آ[18] و ف. موسهآ[19](کلنیزه با زعفران گناباد) شناسایی شدند (24).

کریسنامورسی[20] و همکاران (2015)، ساختار و فراوانی قارچ‌های میکوریزا آربوسکولار را در خاکهای آلوده به فلزهای سنگین بررسی کردند. در این مطالعه، تراکم اسپور در خاک‌های بسیار آلوده به‌مراتب بیشتر گزارش شد و در میان گونه‌های شناسایی‌شده، ف. کونستریکتوم[21]، ف. کلاروس[22]، کلاروایداوگلاموس کلاروایدئوم[23] وف. کلادونیوم[24](موجود در خاک گناباد و همزیست در یک منطقه) حساس به غلظت زیاد فلزهای سنگین گزارش شدند (25). به نظر می‌رسد که گونه ف. کلادونیوم پراکنش جهانی دارد.

 

جدول 4- مقایسه تنوع اسپور قارچ‌های میکوریزا آربوسکولار موجود در خاک گیاه زعفران منطقه گناباد با مناطق دیگر مجاور

منطقه مطالعه‌شده

خراسان (20)

گناباد

گونه‌های قارچ

ریزوفاگوس مانیهوتیس - ف. موسه‌آ-

ف. کالدونیوس[25]، ف. ژئوسپوروم[26]

ریزوفاگوس اگرگاتوس

کلاروایداوگلاموس کلاروایدئوم[27]

ک. کلاروایدئوم، ک. اتانیکاتوم[28]

کوریمبیگلوموس تورتواوسوم[29]

پاراگلوموس آلبیدوم[30]

ف. کالدونیوس

ریزوفاگوس اگرگاتوس

اسکوتلوسپورا دیپورپورسنس

 زارع مایوان[xxxi] و همکاران (1379) با بررسی نوع میکوریزای رایج در رویشگاه‌های عمده زعفران ایران در کشتهای گلدانی، میکوریزا آربوسکولار را در تمام ارقام مشاهده کردند و با روشهای ریخت‌شناسی، قارچ‌های آکاولاسپورا مورویا[xxxii]و گلوموسکوروناتوم[xxxiii] را گونه‌های چیره سازنده میکوریزا معرفی کردند (26).

در مطالعه محبی در مناطق مجاور استان خراسان، درصد کلنیزاسیون گیاه تله سورگوم 21 تا 41 درصد گزارش شده (20) که مشابه با کشت گلخانه‌ای مطالعه حاضر است.

نتایج مطالعه حاضر که در سطح مولکولی برای نخستین بار درباره زعفران گزارش می‌شوند، نتایج به‌نسبت متفاوتی را برای شناسایی قارچ‌های همزیست و مبتنی بر دو روش متفاوت نشان می‌دهند. تفاوت گونه‌های شناسایی‌شده بر اساس دو روش مبتنی بر ویژگی‌های ریخت‌شناسی اسپور و روش مولکولی مبتنی بر ژنوم قارچ کلنیزه‌شده، از جنبه‌های مختلف توجیه می‌شوند. به‌تبع بخشی مربوط به ماهیت روش شناسایی، حساسیت و دقت و شاخص‌های متفاوت هر کدام است، هرچند شناسایی قارچ های همزیست با گیاه برای مطالعات  تکمیلی و کاربردی  بر انواع موجود در خاک ارجح است.  تفاوت‌های این دو نوع مطالعه نشان دادند که تنها روش مولکولی و نتایج آن مبنا قرار می‌گیرد. با توجه به چندساله‌بودن گیاه زعفران، انتخابی و رقابتی‌بودن کلنیزه‌شدن میزبان، بخشی از تفاوت به همزیستی گیاهان میزبان با گونه‌های قارچی موجود پیشین نسبت داده می‌شود که در زمان شناسایی ریخت‌شناسی مبتنی بر اسپور به تعداد کافی وجود نداشته یا حذف شده‌اند.

به‌طور کلی با توجه به نتایج پژوهش حاضر، اگر مشاهده قارچ‌های میکوریزا آربوسکولار تنها شاخص ارزیابی همزیستی باشد، مشاهده بقایای وزیکولی در کشت تله تمام مناطق و حضور آنها تنها در یک مزرعه زعفران نشان می‌دهدکه این قارچ‌ها در ریزوسفر مزارع وجود داشته‌اند ولی توانایی همزیستی با زعفران را به دلایل متعددی ازجمله ماهیت قارچ‌ها و ویژگی‌های کلنیزاسیون و نیز شرایط محیطی ازجمله ترکیبات خاک، شرایط فیزیکی و شیمیایی، وجود قارچ‌های رقابت‌کننده احتمالی و سایر عوامل دخیل، نداشته‌اند یا از گونه‌هایی بوده‌اند که قادر به همزیست‌شدن با گیاه زعفران نبوده‌اند یا با وجود همزیستی، حداقل نمود ظاهری با وزیکول مشهود را نداشته‌اند. اما مطالعه‌ها و مشاهده‌های دقیق‌تر تمام موارد یادشده، با استفاده از مطالعه‌های مولکولی و مقایسه آنها با روش‌های مبتنی بر ریخت‌شناسی، بر محدویت‌های کاربرد روش‌های مبتنی بر ریخت‌شناسی دلالت داشت و نشان داد که گونه‌های زراعی زعفران نیز با قارچ‌های همزیست کلنیزه و همزیست هستند اما الزاماً گونه‌های شناسایی‌شده موجود در خاک نیستند و ممکن است گونه‌هایی باشند که قبلاً در خاک ریزوسفر گیاه موجود بوده‌اند و یا انواع محدود فعلی هستند که با روش‌های غیرمولکولی مشخص نشده‌اند یا به اشتباه شناسایی شده‌اند.



[1]- Bryophytes

[2]- Tracheophytes

[3]-Arbuscular Mycorrhizal Fungi (AMF)

[4]- Glomeromycota

[5]- Crocus sativus L.

[6]-Kormanik

[7]-Olympus

[8]-Giovannetti & Mosse

[9]-Scutellosporadipurpurescens

[10]-Rhizophagusaggregatus(Glomusaggregatum)

[11]-Funneliformiscaledonium

[12]- http://web.iripp.ir/index.php/r-lab

[13]-Mohebi

[14]-Rhizophagusmanihotis

[15]- Funneliformismosseae

[16]-Selvakumar

[17]-Saemangeum

[18]-Racocetraalborosea

[19]-F. mosseae

[20]-Krishnamoorthy

[21]-F. constrictum

[22]-F.clarus

[23]-Claroideoglomusclaroideum

[24]-F. caledonium

[25]- F. caledonius . Funneliformis mosseae

[26]- Funneliformis geosporum

[27]- Claroideoglomus claroideum

[28]- C. etunicatum

[29]- Corymbiglomus tortuosum

[30]- Paraglomus albidum

[xxxi]-Zare-maivan

[xxxii]-Acaulosporamorrowiae

[xxxiii]-Glomuscoronatum

 

(1)              Smith S., Read D. Mycorrhizal symbiosis. 3rd ed. San Diego: Academic Press; 2008.

(2)              Redecker D., Kodner R., Graham LE. Glomalean fungi from the Ordovician. Science. 2000; 289(5486): 1920-1921.

 (3)              Schüβler A., Walker C. The Glomeromycota: A species list with new families and genera. Edinburgh & Kew, UK: The Royal Botanic Garden; 2010.

(4)              Schüβler A., Schwarzott D., Walker C. A new fungal phylum, the Glomeromycota: phylogeny and evolution. Mycological Research 2001; 105(12): 1413-1421.

(5)              Krüger M, Krüger C., Walker C., Stockinger H., Schüßler A. Phylogenetic reference data for systematics and phylotaxonomy of arbuscular mycorrhizal fungi from phylum to species level. New Phytologist 2012; 193(4): 970-984.

(6)              Bonfante P., Genre A. Mechanisms underlying beneficial plant-fungus interactions in mycorrhizal symbiosis. Nature Communications. 2010; 1:48.

(7)              Adolfsson L., Solymosi K., Andersson MX., Keresztes Á., Uddling J., Schoefs B., et al. Mycorrhiza symbiosis increases the surface for sunlight capture in Medicago truncatula for better photosynthetic production. PloS one 2015; 10(1):e0115314.

(8)              Bharti N., Baghel S., Barnawal D., Yadav A., Kalra A. The greater effectiveness of Glomus mosseae and Glomus intraradices in improving productivity, oil content and tolerance of salt-stressed menthol mint (Mentha arvensis). Journal of the Science of Food and Agriculture 2013; 93(9):2154-2161.

(9)              Fernández JA., Pandalai S. Biology, biotechnology and biomedicine of saffron. Recent research developments in plant science 2004; 2. 127-159.

(10)          Tavakkoli Kh., Mokhtarian A., Binabaji H., Hamidi H., Esmi R. The effects of different amounts of density and mother corm weight on corm and flower yield of saffron (Crocus sativus l.) under mashhad’s climate. Saffron Agronomy and Technology 2016; 4: 1 29-140.

(11)          Amin B., Abnous K., Motamedshariaty V., Hosseinzadeh H. Attenuation of oxidative stress, inflammation and apoptosis by ethanolic and aqueous extracts of Crocus sativusL. stigma after chronic constriction injury of rats. Anais da Academia Brasileira de Ciências 2014; 86(4): 1821-1832.

(12)          Jahan M, Jahani M. The effects of chemical and organic fertilizers on saffron flowering In: II International Symposium on Saffron Biology and Technology 2006; 739: 81-86.

(13)          Pitsikas N. The effect of Crocus sativus L. and its constituents on memory: basic studies and clinical applications. Evidence-Based Complementary and Alternative Medicine (eCAM) 2015; 2015: 2-7.

(14)          Dietterich L.H., Gonneau C. and Casper B.B.,. Arbuscular mycorrhizal colonization has little consequence for plant heavy metal uptake in contaminated field soils. Ecological Applications 2017; 27:1862-1875.

(15)          Huang X., Ho SH., Zhu S., Ma F., Wu J., Yang J., et al. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress. Journal of environmental management 2017; 197: 448-455.

(16)          Schutzendubel A., Polle A. Plant responses to abiotic stresses: heavy metal induced oxidative stress and protection by mycorrhization. Journal of experimental botany 2002; 53(372):1351-1365.

(17)          Gohre V., Paszkowski U. Contribution of the arbuscular mycorrhizal symbiosis to heavy metal phytoremediation. Planta 2006; 223(6): 1115-1122.

(18)          Miransari M. Hyperaccumulators, arbuscular mycorrhizal fungi and stress of heavy metals. Biotechnology advances. 2011; 29(6): 645-453.

(19)          Ferrol N., Tamayo E., Vargas P. The heavy metal paradox in arbuscular mycorrhizas: from mechanisms to biotechnological applications. Journal of experimental botany 2016; 67(22): 6253-6265.

(20)          Mohebi Anabat M., Riahi H., Zangeneh S. Investigation on Arbuscular Mycorrhizal Fungi (AMF) associated with Crocus sativus in Khorasan Razavi and Southern Khorasan provinces (north east of Iran). Rostaniha 2015; 16(2); 200-205.

(21)          Kormanik PP., Bryan WC., Schultz RC. Procedures and equipment for staining large numbers of plant root samples for endomycorrhizal assay. Canadian Journal of Microbiology 1980; 26(4): 536-538.

(22)          Giovannetti M., Mosse B. An evaluation of techniques for measuring vesicular arbuscular mycorrhizal infection in roots. New Phytologist 1980; 84(3): 489-500.

(23)          Lee J., Lee S., Young JP. Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi. FEMS Microbiology Ecology. 2008; 65(2):339-349.

(24)          Selvakumar G., Krishnamoorthy R., Kim K., Sa TM. Genetic diversity and association characters of bacteria isolated from arbuscular mycorrhizal fungal spore walls. PLoS One 2016; 11(8): e0160356.

(25)          Krishnamoorthy R., Kim CG., Subramanian P., Kim KY., Selvakumar G., Sa TM. Arbuscular mycorrhizal fungi community structure, abundance and species richness changes in soil by different levels of heavy metal and metalloid concentration. PLoS One 2015; 10(6): e0128784.

(26)          Zare-maivan H., Nakhaei A. Mycorrhizal symbiosis of saffron (Crocus Sativus) with two glomina fungal species. Journal of Research and Development 2000; 48; 80-83.