جداسازی و همسانه‌سازی ژن کاهنده جیوه معدنی (merA) از باکتری‌های مقاوم به جیوه

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 کارشناس ارشد بیوتکنولوژی کشاورزی، دانشگاه شهید مدنی آذربایجان، ایران

2 دانشیار بیوتکنولوژی کشاورزی، دانشگاه شهید مدنی آذربایجان ، ‌‌ایران

3 دانشیار زیست‌شناسی سلولی و مولکولی دانشگاه شهید مدنی آذربایجان، ‌‌ایران

چکیده

مقدمه: برخی باکتری‌ها با داشتن ژن merA کدکننده آنزیم کاهنده جیوه معدنی، توانایی ژنتیکی برای حذف جیوه از طریق احیای جیوه معدنی و تبدیل آن به شکل گازی و در نتیجه پاکسازی منطقه آلوده را دارند. هدف مقاله حاضر، جداسازی ژن merA از باکتری‌های مقاوم به جیوه و همسانه‌سازی آن در وکتور بیانی مناسب به منظور طراحی وکتور پایه‌ای برای تولید این آنزیم در باکتری و استفاده از آن برای پاکسازی محیط‌زیست است.
مواد و روش‏‏ها: تعدادی باکتری موجود در مناطق آلوده به جیوه برای جداسازی ژن merAانتخاب شدند. واکنش زنجیره‌ای پلیمراز برای جداسازی و همسانه‌سازی ژن merAبا استفاده از آغازگرهای اختصاصی روی ژنوم چهار باکتری Klebsiella pneumoniae،Pseudomonas aeruginosa،Serratia marcescensوEscherichia coli انجام شد. قطعه‌های تکثیری در وکتور بیانی pET21a+، همسانه‌سازی شدند و به روش شوک حرارتی به باکتری‌های مستعد E. coli TOP10 تراریزش شدند. خوشه‌بندی ژن کلون‌شده با ژن‌های موجود از این نوع در NCBI با استفاده از نرم‌افزار MEGA ویرایش 4 و بررسی‌های بیوانفورماتیکی برای توالی آنزیم پیش‌بینی‌شده انجام شدند.
نتایج: ژن merAبا طول 1686 جفت باز از باکتری‌های K. pneumoniaeوE. coliجداسازی شد. وکتورهای نوترکیب به روش‌های مختلف تأیید شدند و درستی کار با انجام توالی‌یابی تأیید شد. نتایج خوشه‌بندی، شباهت زیاد این ژن با ژن آنزیم کاهنده جیوه معدنی K. pneumoniaeوE. coli در NCBI را نشان داد.
بحث و نتیجه‏گیری: وجود ژن merA در باکتری‌های سازگار به مناطق آلوده به جیوه، یکی از عوامل مقاومت است که با همسانه‌سازی آن در وکتور حاوی پروموتور بیانی و انتقال آن به باکتری‌ها، ایجاد و یا افزایش توانایی باکتری‌های حساس در حذف مقادیر زیاد جیوه امکان‌پذیر خواهد بود.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Isolation and Cloning of mercuric reductase gene (merA) from mercury-resistant bacteria

نویسندگان [English]

  • Parisa Khoshniyat 1
  • Alireza Tarinejad 2
  • Mohammad Pazhang 3
1 MSc of Agricultural Biotechnology, College of Agriculture, Azarbaijan Shahid Madani University, Tabriz, Iran
2 Associate Professor of Agricultural Biotechnology, College of Agriculture, Azarbaijan Shahid Madani University, Tabriz, Iran
3 Associate Professor of Cell and Molecular Biology, Azarbaijan Shahid Madani University, Tabriz, Iran
چکیده [English]

Introduction: Some of the bacteria having merA gene coding mineral mercury reducing enzyme, has genetic potential of Hg removing via reduction of mineral mercury and transformation of that to gas form and finally bioremediation of polluted area. The aim of this study is the isolation of merA gene from resistance bacteria and cloning of that into suitable expression vector and then the environmental bioremediation by the transformation of bacteria with this vector.
Materials and methods: A number of bacteria were collected in contaminated areas with mercury in order to isolate merA genes. Polymerase chain reaction had done on the four bacterial genomes including Klebsiella pneumoniae, Pseudomonas aeruginosa, Serratia marcescens and Escherichia coli using the specific primers in order to detect merA gene. For cloning, the primers containing restriction enzyme sites are used, merA gene was isolated and amplified. The amplified fragments were cloned in the expression vector pET21a+ and via heat shock method were transformed into E. coli TOP10 competent cell. For clustering of genes, Mega software version 4 was used and bioanformatic studies were achieved for predicted enzyme.
Results: merA gene with 1686 bp in length was isolated from K pneumoniae and E. coli. Recombinant vectors in transgenic bacteria were confirmed by various methods and finally were confirmed by sequencing. The result of clustering these genes with existence genes in NCBI showed high similarity.
Discussion and conclusion: The existence of merA gene in bacteria that adapted to Hg pollution area is because of resistance, so with cloning this gene into suitable expression vector and transformation of susceptible bacteria with this vector ability of resistance to Hg in bacteria for bioremediation could be given.

کلیدواژه‌ها [English]

  • Mineral Mercury
  • Microbial bioremediation
  • merA gene
  • Cloning

مقدمه

جیوه یکی از فلزهای سنگین سمی است که از طریق آلاینده‌های صنعتی و رسوبات آنها به‌طور وسیعی در اکوسیستم گسترش یافته است. منشأ آلودگی جیوه، صنایع مصرف‌کننده آن شامل تولیدکننده‌های کلر‌آلکالی، رنگ‌ها، ضدعفونی‌کننده‌ها، مواد دارویی، کاغذ، خمیر کاغذ و ... هستند. سوخت‌های فسیلی یکی از منابع بزرگ آلودگی جیوه در محیط‌زیست (1) و فاضلاب‌ها منشأ وسیع دو نوع جیوه آلی و غیرآلی مانند جیوه عنصری[1]، جیوه‌متیل‌کلرید[2] و دی‌متیل‌جیوه[3] هستند (2). جیوه، آلاینده زیست‌محیطی بزرگ و جزو توکسین‌های قابل جمع‌آوری زیستی[4] است که در محیط‌زیست به مدت طولانی پایدار می‌ماند (مدت پایداری آن بین 5/0 تا 2 سال برآورد شده است) (3). جیوه، شکل‌های شیمیایی خود را در محیط‌زیست تغییر می‌دهد، از یک مکان به مکان دیگر حرکت می‌کند و داخل خاک و رسوبات دفن می‌شود (4). بیشتر گیاهان دریایی و حیوانات جیوه را جذب می‌کنند و موجودات شاخه‌های پایین چرخه غذایی (مانند پلانکتون‌ها) جیوه را در بدن خود به دام می‌اندازند. زمانی که گیاه‌خواران یا گوشت‌خواران شاخه‌های بالاتر زنجیره غذایی پلانکتون‌ها را می‌خورند، جیوه به بدن ماهی‌ها منتقل می‌شود و در نهایت، انسان‌ها آنها را مصرف می‌کنند. جیوه عاملی جهش‌زا، مهارکننده رشد، دارای آثار سمی و عامل بیشتر بیماری‌های مهم انسانی و سندرم است. آثار جیوه روی عملکرد اکوسیستم از نظر اقتصادی و بهداشتی درخور توجه است(5).

زیست‌پالایی یکی از روش‌های مهندسی زیستی مطمئن برای پاکسازی محیط‌های آلوده با استفاده از میکروب‌ها یا آنزیم‌های آنها، گیاهان و کرم‌های خاکی است(6). از آنجا که این روش، فرایندی طبیعی است و مواد سمی در کنار محصولات آن تولید نمی‌شوند در مقایسه با سایر روش‌های پالایش مقرون به صرفه است. همچنین راه حلی پایدار و دائمی است که موجب معدنی‌سازی آلاینده‌ها[5] در محیط‌زیست می‌شود (7). مقاومت به جیوه در انواع باکتری‌های گرم مثبت و منفی مشاهده شده است. در باکتری‌ها، ژن‌های مقاومت به جیوه بیشتر در اپرونی روی پلاسمید و یا ترانسپوزون‌ها قرار دارند. اپرون مقاومت به طیف ضعیفی از جیوه[6] (mer­R­T­P­A­D­E) فقط در برابر جیوه غیرآلی مقاوم است و اپرون مقاوم به طیف وسیع جیوه[7] (mer ­R­T­P­A­G­B­D­E) در برابر هر دو نوع جیوه آلی و غیرآلی مقاومت نشان می‌دهد (8 و 9). در این اپرون، merA آنزیم کاهنده جیوه[8] را رمز می‌کند و این پروتئین سیتوپلاسمی نقش اصلی را در حذف جیوه دارد. این آنزیم  Hg2+را طبق مکانیسم زیر به Hg0 با سمیت کمتر تبدیل می‌کند (10):.

Hg0به‌شدت فرار است و آزادانه از غشاهای زیستی به بیرون سلول عبور می‌کند و به اتمسفر باز می‌گردد؛ این آخرین گام مسیر غیرسمی‌سازی جیوه در باکتری‌های مقاوم به جیوه است و به این ترتیب، باکتری‌ها جیوه را از محیط اطراف خود حذف می‌کنند (10). با توجه به اهمیت جیوه از نظر آلودگی زیست‌محیطی، پاکسازی آن از روش مهندسی ژنتیک ضروری و کم‌هزینه است. پژوهش حاضر با هدف جداسازی ژن merA از باکتری‌های مقاوم به جیوه و تولید وکتور نوترکیب بیانی، مقدمه‌ای برای مهندسی ژنتیک باکتری‌ها برای افزایش توانایی آنها در پاکسازی جیوه و تولید آنزیم MerA برای بررسی ویژگی‌های آنزیم در مطالعه‌های آینده است.

مواد و روش‌ها

باکتری‌ها، شرایط رشد و آغازگرهای استفاده‌شده:چهار نوع باکتری از باکتری‌هایی که پژوهشگران در پژوهش‌های پیشین از مناطق مختلف آلوده به جیوه جداسازی و به‌عنوان باکتری‌های مقاوم به جیوه شناسایی کرده بودند (11 و 12) شامل Klebsiella pneumoniae (ATCC 700603)، Pseudomonas aeruginosae (ATCC 9027)، Escherichia coli (ATCC 8739)و Serratia marcescence (ATCC 13880) از سازمان پژوهش‌های علمی صنعتی ایران تهیه و در محیط‌کشت جامد nutrient agar حاوی آنتی‌بیوتیک اختصاصی هر باکتری به‌ترتیب آمپی‌سیلین، کلرامفنیکل، استرپتومایسین و سفوتاکسیم و در دمای 37 درجه سانتی‌گراد کشت شدند. سپس، باکتری‌های رشدکرده برای تهیه پیش‌کشت در 10 میلی‌لیتر محیط‌کشت مایع حاوی آنتی‌بیوتیک و 24 ساعت در شیکر با دمای 37 درجه سانتی‌گراد قرار داده شدند. برای استخراج پلاسمید باکتری‌ها از روش پیشنهادشده برنبویم و دالی[9] استفاده شد (13). کمیت و کیفیت DNA پلاسمیدی با روش اسپکتروفتومتری و الکتروفورز روی ژل آگارز تعیین شد.

آغازگرهای استفاده‌شده در پژوهش حاضر با استفاده از توالی‌های موجود در [10]NCBI با نرم‌افزار Vector NTI طراحی شدند، گروه اول برای جداسازی و سنتز ژن (بدون سایت برشی) و گروه دوم که برای سنتز و توالی‌یابی استفاده شدند، دارای سایت برشی برای همسانه‌سازی در وکتور بیانی بودند (جدول 1).

 

 جدول 1- لیست پرایمرهای استفاده‌شده در پژوهش حاضر

توالی پرایمر

نام پرایمر

5'GCTCCGGCGCAGCACGAAAGCT3'

5'TGCATGACCACCCTGAAAATCACCGGG3'

Mer A-R

Mer A- F

5'GCG*GATCCTCCGGCGCAGCACGAAAGCT3'

5'TGCG*CTAGCATGACCACCCTGAAAATCACCGGG3'

Mer A- R- K- BamHІ

Mer A- F- K- NheІ

.


واکنش PCR[11]، جداسازی ژن merA و تأیید درستی توالی:واکنش PCR با حجم نهایی 25 میکرولیتر شامل 5/12 میکرولیتر master mix (سیناژن)، 5/9 میکرولیتر آب مقطر استریل، 1 میکرولیتر DNA پلاسمیدی (الگو) و 1 میکرولیتر از هر یک از آغازگرهای رفت و برگشتی بود. مراحل برنامه تکثیر ژن merA در دستگاه ترموسایکلر شامل واسرشت اولیه در 94 درجه سانتی‌گراد به مدت 5 دقیقه و پس از آن 35 چرخه شامل سه مرحله دناتوراسیون در 94 درجه سانتی‌گراد به مدت 1 دقیقه، اتصال در 58 درجه سانتی‌گراد به مدت 1 دقیقه و بسط در 72 درجه سانتی‌گراد به مدت 80 ثانیه و سپس مرحله بسط نهایی در 72 درجه سانتی‌گراد به مدت 10 دقیقه انجام شد. سپس، برای3 میکرولیتر از محصول PCR به همراه نشانگر مولکولی 1کیلو باز روی ژل آگارز 1 درصد بارگذاری شد. برای تأیید ژن تکثیری با استفاده از آنزیم‌های برشی، 15 میکرولیتر از محصول PCR خالص‌سازی‌شده توسط 5/0 میکرولیتر آنزیم EcoRІ در حجم نهایی 20 میکرولیتر و دمای 37 درجه سانتی‌گراد به مدت 3 ساعت هضم شد.

همسانه‌سازی در وکتور بیانی pET21a+: وکتور بیانی pET21a+ (Invitrogen) در پژوهش حاضر برای همسانه‌سازی و توالی‌یابی استفاده شد. وکتور pET21 دارای توالی ×HIS-tagا6 در بخش انتهای کربوکسیل پروتئین مدنظر است که برای تخلیص پروتئین نوترکیب در پژوهش‌های بعدی تعبیه شده است. این وکتور با داشتن پروموتور T7 در باکتری بیانی BL21 سوش DE3 بیان می‌شود. ژن انتخابگر آن برای گزینش، ژن مقاومت به آمپی‌سیلین (ژن بتالاکتاماز) است. قطعه‌های DNA تکثیریافته با استفاده از سایت‌های برشی NheІ و BamHІ برش داده شدند که به‌ترتیب در ساختار آغازگرهای رفت و برگشتی طراحی شده بودند. واکنش هضم با آنزیم‌های برشی به‌شکل جداگانه در حجم 50 میکرولیتر و دمای 37 درجه سانتی‌گراد انجام شد. محصول هضم‌شده روی ژل آگارز با [12]LMP 1 درصد بارگذاری و باند مربوط به ژن merA با اندازه 1686 جفت باز از روی ژل جداسازی و برای واکنش لیگاسیون خالص‌سازی شد؛ به این شکل که قطعه ژل حاوی DNA مدنظر پس از برش، 5 دقیقه در دمای 70 درجه سانتی‌گراد درون دستگاه ترمومیکسر قرار گرفت. سپس 4 برابر حجم، بافر LMP (Tris-HCl 200 میلی‌مولار و EDTA 1 میلی‌مولار) به آن اضافه شد و 5 دقیقه در دمای 70 سانتی‌گراد قرار گرفت. پس از حل‌شدن کامل ژل، 1 برابر حجم، فنل اشباع به آن اضافه و 5 دقیقه در دمای 4 درجه سانتی‌گراد با سرعت rpm 14000 سانتریفیوژ شد. پس از خالص‌سازی با روش فنل کلروفرم، رسوب باقیمانده در 20 میکرولیتر آب حل شد.

.واکنش لیگاسیون در حضور آنزیم T4 لیگاز (فرمنتاز) و دمای 22 درجه سانتی‌گراد به مدت 1 ساعت برای قطعه‌های تکثیری merA و وکتور برش‌یافته با آنزیم‌های برشی BamHІ و NheІ انجام شد. مقدار 10 میکرولیتر از محصول لیگاسیون به ازای هر بار تراریزش، به باکتری‌های مستعد شوک حرارتی E. coli سویه TOP10 منتقل شد و سپس در دمای 37 درجه کشت داده شدند (14). پس از گذشت یک شبانه‌روز، استخراج پلاسمید از کلنی‌های رشد‌کرده در محیط گزینش برای تأیید درستی همسانه‌سازی انجام شد. روش هضم آنزیمی برای اطمینان کامل از تأیید حضور پلاسمید نوترکیب حاوی ژن merA در کلنی‌های حاصل از واکنش لیگاسیون استفاده شد. پلاسمیدهایی که وجود ژن در آنها طی واکنش PCR با آغازگرهای اختصاصی ژن merA تأیید شده بود، با آنزیم‌های برشی BamHІ و NheІ برش داده شدند. برای بررسی توالی ژن همسانه‌سازی‌شده، نمونه DNA پلاسمید نوترکیب pET21-merA تأییدشده برای تعیین توالی به مرکز توالی‌یابی Macrogen کره جنوبی ارسال شد. توالی‌های ثبت‌شده در NCBI برای ژن merA با شماره دستیابی KJ187752.1 با نتایج حاصل از توالی‌یابی‌ با دو نرم‌افزار بلاست[13] و مولتی الاین[14] مقایسه شدند. سپس توالی آمینواسیدی مربوط به توالی مورد توافق در هم‌ردیفی ژن merA همسانه‌سازی‌شده با استفاده از نرم‌افزار APE حاصل شد. توالی آمینواسیدی حاصل با توالی آمینواسیدی مربوط به پروتئین MerA موجود در NCBI با شماره دسترسی AJD77091.1 با استفاده از نرم‌افزار Multalign مقایسه شد.

نتایج

پس از استخراج ژنوم باکتری‌های Klebsiella pneumoniae،Serratia marcescens، P. aeruginosa و E. coli، واکنش PCR برای جداسازی و تکثیر ژن merAبا استفاده از جفت آغازگرهای رفت و برگشتی (جدول 1) انجام شد. محصول PCR مربوط به ژنوم باکتری‌های K. pneumoniaeوE. coli باند 1686 جفت بازی را روی ژل آگارز 1 درصد نشان داد که با اندازه مدنظر برای ژن merA مطابق بود (شکل 1).

تأیید ژن merA با واکنش هضم در حضور آنزیم EcoRI انجام شد (شکل 2). با توجه به توالی‌های موجود در NCBI، سایت برشی آنزیم تقریباً در اواسط ژن قرار دارد و پس از واکنش هضم، دو قطعه با طول‌های 1023 و 663 جفت باز ایجاد می‌کند. مشاهده این دو قطعه روی ژل آگارز 1 درصد بیان‌کننده تأیید ژن merA محصول PCR است.

 

شکل 1- الکتروفورز محصول PCR حاصل از تکثیر ژنmerA در باکتری‌های الف. K. pneumoniaeو ب. E .coliبا استفاده از آغازگرهای اختصاصی که باند1686 جفت بازی مطابق انتظار حاصل شد. 1، 2، 3 و 4 تکرارهای مستقل هستند. M نشانگر (1 کیلوباز شرکت Fermentas). :C-شاهد منفی بدون DNA.

 شکل 2- الکتروفورز محصول واکنش هضم ژن merA با آنزیم EcoRI در ژل آگارز 1 درصد. با توجه به توالی‌های موجود در NCBI، دو باند مورد انتظار با اندازه‌های 1023 و 663 جفت باز مشاهده شدند که بیانگر تأیید درستی توالی ژن merA تکثیرشده توسط PCR بودند.

 

با جداسازی ژن merA روی ژنوم K. pneumoniaeوE. coli، واکنش PCR روی ژنوم K. pneumoniae برای تکثیر ژن merAبا استفاده از جفت آغازگرهای رفت و برگشتی دارای سایت برشی NheІ و BamHІ انجام شد.

نتایج رشد تعدادی کلنی در محیط گزینشی حاوی  g/ml100 آمپی‌سیلین را نشان دادند، در حالی که همسانه‌سازی 10 میکرولیتر از محصول ری‌لیگاسیون هیچ کلنی را روی محیط گزینشی نشان نداد. هم‌زمان با کشت باکتری‌های حاصل از تراریزش محصول لیگاسیون و ری‌لیگاسیون، شاهد مثبت که باکتری‌های تراریخته با 2 میکرولیتر وکتور خالی بودند و شاهد منفی که باکتری‌های مستعد شوک حرارتی E. coli خالی تراریخت‌نشده بودند، در محیط انتخابی آمپی‌سیلین کشت شدند. رشد مناسب شاهد مثبت کارایی سلول‌های مستعد تراریزش و عامل انتخابی روی وکتور را تأیید می‌کند و رشدنکردن شاهد منفی نبود آلودگی در سلول‌های مستعد و محیط‌کشت را نشان می‌دهد (شکل 3).

شکل3- تصویر کلنی‌های حاصل از تراریزش در محیط گزینشی آمپی‌سیلین‌دار. پتری الف. حاوی 6 کلنی حاصل از تراریزش محصول لیگاسیون ژن merA و وکتور pET21a+، پتری ب. مربوط به باکتری‌های تراریخته با محصول ری‌لیگاسیون، رشدنکردن کلنی بیان‌کننده برش هر دو آنزیم برشی و تأیید کلنی‌های نوترکیب حاصل از لیگاسیون است، پتری ج. شاهد منفی، مربوط به باکتری‌های تراریخت‌نشده خالی، رشدنکردن کلنی بیان‌کننده عدم آلودگی باکتری‌های مستعد تراریزش و محیط‌کشت است. پتری د. شاهد مثبت، مربوط به باکتری‌های تراریخته با وکتور خالی برش‌نیافته، رشد مناسب کلنی‌ها بیان‌کننده کارایی باکتری‌های مستعد تراریزش است.

 شکل 4- نقشه پلاسمید نوترکیب حاصل از همسانه‌سازی ژن merA در وکتور pET21a+. پروموتور T7 باکتریوفاژ در ناحیه 5' ژن merA برای بیان ژن قرار دارد. ژن bla عامل مقاومت به آمپی‌سیلین است.

 

پلاسمید تمام کلنی‌های مشاهده‌شده حاصل از واکنش لیگاسیون استخراج شدند و واکنش PCR با آغازگرهای اختصاصی ژن merA روی پلاسمیدهای استخراج‌شده از کلنی‌ها انجام شد. شکل 4، نقشه پلاسمید نوترکیب حاصل از کلون‌کردن DNA مربوط به merA در وکتور بیانی pET21a+ است.

با بارگذاری محصول PCR حاصل از پلاسمید استخراج‌شده، پلاسمیدهای مربوط به کلنی‌های 1، 3 و 5، باند مربوط به ژن merA را نشان دادند که تقریباً 1668 جفت باز بود و این، درستی انجام همسانه‌سازی را نشان داد (شکل 5). از روش هضم آنزیمی برای اطمینان کامل از تأیید حضور پلاسمید نوترکیب حاوی ژن merA در کلنی‌های حاصل از واکنش لیگاسیون استفاده شد.

 شکل 5- الکتروفورز محصول PCR انجام‌شده با استفاده از آغازگرهای اختصاصی ژن merA روی پلاسمیدهای استخراج‌شده از کلنی‌های حاصل از واکنش لیگاسیون (چاهک‌های 1 تا 6).C+: شاهد مثبت. C-: شاهد منفی. M: نشانگر (1 کیلوباز شرکت Fermentas)

پلاسمیدهایی که وجود ژن در آنها طی واکنش PCR با آغازگرهای اختصاصی ژن merA تأیید شده بود با آنزیم‌های برشی BamHІ و NheІ برش داده شدند. با بارگذاری محصول هضم در ژل آگارز، همان‌طور که انتظار می‌رفت دو قطعه با اندازه تقریبی 1668 جفت باز مربوط به merA و 5334 جفت باز مربوط به وکتور مشاهده شدند (شکل 6).

 

شکل 6- الکتروفورز محصول برش پلاسمید نوترکیب pET21-merA کلنی‌های 1، 3 و 5 با آنزیم‌های برشی BamHІ و NheІ روی ژل آگارز 1 درصد و جداشدن merA با اندازه 1668 جفت باز، M نشانگر (1 کیلوباز شرکت Fermentas).

 با توجه به تشکیل دو قطعه پیش‌بینی‌شده از برش آنزیمی، پلاسمید نوترکیب تأیید شد. سه نمونه DNA پلاسمید نوترکیب pET21-merAتأییدشده برای تعیین توالی به توالی‌یابی ارسال شدند. نتیجه حاصل از توالی‌یابی، درستی و تطابق کامل توالی هر سه نمونه پلاسمید ارسال‌شده را با نمونه ثبت‌شده در NCBI برای ژن merA نشان داد. نتایج مقایسه توالی‌های پلاسمیدهای نوترکیب با ژن merA موجود در NCBI، درستی و مطابقت کامل merA درج‌شده در پلاسمید را با توالی ژن merA موجود در NCBI تأیید کرد که همسانه‌سازی صحیح ژن در وکتور بیانی pET21 را نشان می‌دهد. توالی آمینواسیدی پیشگویی‌شده مربوط به توالی مورد توافق در هم‌ردیفی ژن merA همسانه‌سازی‌شده، تطابق کامل با توالی پروتئین MerA موجود در NCBI نشان می‌دهد (شکل 7).

ویژگی‌های بیوانفورماتیکی توالی آنزیم حاصل و منشأ احتمالی تکامل ژن کلون‌‌شده: بررسی ویژگی‌های فیزیکوشیمیایی پروتئین حاصل با استفاده از برنامه پروتپارام[15] (یکی از برنامه‌های تحت هدایت وب سایت ExPASy که برای محاسبه شاخص‌های متنوع فیزیکی و شیمیایی توالی پروتئین ویژه به کار می‌رود) نشان داد که وزن مولکولی محاسبه‌شده و نقطه ایزوالکتریک پیش‌بینی‌شده پروتئین merA با فرمول مولکولی C2570H4176N726O803S21 به‌ترتیب برابر 767/58 کیلودالتون و 25/5 شاخص ناپایداری آن در لوله آزمایش حدود 33/33 است و در رسته پروتئین‌های پایدار تقسیم‌بندی می‌شود. همچنین شاخص Aliphatic (عامل مهمی برای برآورد مقاومت پروتئین‌ها در برابر حرارت) و نیمه‌عمر این پروتئین در محیط in vivo که با برنامه پروتپارام محاسبه‌ شدند به‌ترتیب بیشتر از 10، 20 و 30 ساعت در سلول‌های E. coli، مخمر و انسانی بودند که پایداری و طول عمر زیاد این آنزیم را نشان می‌دهد (15). این آنزیم از 11 مارپیچ آلفا، 7 رشته بتا و 19 فنر تشکیل شده است (شکل 8). آنزیم کاهنده جیوه معدنی یک مارپیچ قطبی انتقال‌دهنده درون غشایی دارد که در شکل 9 نشان داده شده است. علامت‌دهی جیوه از طریق اتصال جیوه به دمین غشایی انجام می‌شود که به‌عنوان گیرنده‌ علامت عمل می‌کند.

شکل 7- توالی آمینواسیدی پروتئین MerA حاصل از وکتور همسانه‌سازی‌شده با توالی پروتئین MerA موجود در NCBI. رنگ قرمز تمام آمینواسیدهای توالی مورد توافق، شباهت کامل توالی آمینواسیدی پروتئین MerA حاصل از وکتور همسانه‌سازی‌شده را با توالی پروتئین MerA موجود در NCBI نشان می‌دهد.

 شکل 8- بررسی ساختار آنزیم کاهنده جیوه معدنی از نظر مارپیچ آلفا، رشته بتا و فنر

شکل9- توپولوژی دو بعدی آنزیم کاهنده جیوه معدنی، مارپیچ قطبی به سمت منافذ در موقعیت آمینواسیدهای 101 تا 116 قرار گرفته است.

توالی ژن کاهنده جیوه معدنی کلون‌شده با دیگر ژن‌های همتای خود در سایر ریزموجودات از نظر توالی آمینواسیدی بررسی و دندروگرام با نرم‌افزار MEGA ویرایش 4 و با روش ادغام متوسط همسایه‌ها یا UPGMA ترسیم شد (شکل 10). با برش دندروگرام از محلی که چهار خوشه حاصل شده است، ژن مطالعه‌شده تشابه زیادی با ژن‌های موجود در ریزموجودات Pseudomonase، Klebsiella و E. coli نشان داد و بنابراین به نظر می‌رسد از یک ژن مشترک اجدادی طی تکامل ناشی شده‌اند.

شکل 10- دندروگرام توالی آمینواسیدی MerA کلون‌شده از باکتری K. pneumonia با سایر پروتئین‌های همتای خود در ریزموجودات

 

بحث و نتیجه‌گیری

سالانه هزاران تن جیوه وارد محیط‌زیست می‌شود و هزاران دلار برای حذف تقریباً نیم کیلوگرم جیوه با استفاده از فناوری‌های رایج هزینه می‌شود. بنابراین باید روش‌های جایگزین و عملی حذف جیوه از محیط‌زیست توسعه یابند (16). روش‌های شیمیایی حذف فلزهای سنگینی مانند جیوه از فاضلاب‌ها علاوه بر هزینه‌های زیاد که صنعتگران را از به‌کارگیری این روش‌ها می‌ترساند، با تولید لجن رسوبات شیمیایی و لجن خود مواد زاید موجب بروز مشکلات ناسازگار با محیط‌زیست می‌شوند (17). بنابراین زیست‌پالایی میکروبی، یکی از روش‌های زیستی درخور توجه حذف فلزهای سنگین از محیط‌زیست است که از نظر اقتصادی پایدار و سازگار با محیط‌زیست است. باکتری‌های زیست‌پالاینده از مکان‌های آلوده به آلاینده‌های آلی و معدنی جداسازی می‌شوند. میبدی و همکاران در سال 1394، سویه‌هایی از باکتری Pseudomonas را برای حذف زیستی کروم از خاک‌های آلوده به نفت خوزستان جداسازی کردند (18). اساس ژنتیکی مقاومت به جیوه در برخی گونه‌های باکتریایی به اثبات رسیده است؛ این باکتری‌ها با آنزیم القایی کاهنده جیوه معدنی که merA رمز‌ می‌کند، موجب احیای +Hg2به Hg0 می‌شوند. این کاهنده نوعی فلاونوپروتئین وابسته به NADPH است که احیای Hg2+ به Hg0 را کاتالیز می‌کند. از سویی، جیوه عنصری با فشار بخار زیاد تبخیر و محیط رشد اطراف باکتری عاری از جیوه می‌شود. این کاهنده جیوه در فضای بین سلولی قرار دارد و در غلظت‌های sub-inhibitory یون‌های جیوه و انواع جیوه‌های آلی القا می‌شود (19).

مور[xvi] در سال 1960، نخستین پژوهش‌ها را در زمینه مقاومت باکتری‌های مقاوم به جیوه انجام داد (20). سپس مقاومت باکتری Staphylococcus aureus جداشده از نمونه‌های کلینیکی را به ترکیبات جیوه گزارش کردند. پس از آن، پژوهش‌های گسترده‌ای در زمینه باکتری‌های مقاوم به جیوه و توانایی حذف جیوه انجام شدند (21). ری و همکاران[xvii] در سال 1989، توانایی باکتری‌های تثبیت‌کننده‌ ازت جدا‌شده از خاک مناطق آلوده به جیوه در حذف جیوه را بررسی و باکتری‌هایی با توانایی 83 درصدی در حذف جیوه را جداسازی کردند (22). چن و همکاران[xviii] در سال 1997 با دست‌ورزی ژنتیکی E. coli، این باکتری را برای پاکسازی محیط‌های آلوده به جیوه آماده کردند. این سویه‌ها به‌شکلی دست‌ورزی شدند که برای انتقال بیشتر +Hg2 به درون سیتوپلاسم خود، پروتئین‌های MerT و MerP را بیشتر بیان می‌کردند(23). ون کنستاین[xix] و همکاران در سال 1999 سوشی از باکتری Pseudomonas putida مقاوم به جیوه را از رسوبات آلوده به جیوه در آلمان جدا کردند. آنها برای نخستین بار از این سویه‌ها برای تصفیه پساب حاوی جیوه در کارخانه کلرآلکالی استفاده کردند (24). بایی و همکاران[xx] نیز در سال 2003 با همسانه‌سازی ژن merR در E. coli و بیان آن در سطح سلول مشاهده کردند که این پروتئین علاوه بر جیوه، فلزهای سنگین دیگری مانند Zn2+ و Cd2+ را جذب می‌کند. آنها شیوه‌ای جدید با کارایی زیاد برای حذف فلزهای سنگین مختلف از پساب کارخانه‌ها ابداع کردند (25).

در مطالعه حاضر، 4 نمونه باکتری مقاوم به جیوه از نظر داشتن اپرون mer، یکی از عوامل ژنتیکی مقاومت در برابر جیوه (1)، بررسی شدند و در این میان با استفاده از روش PCR، ژن merA از باکتری‌هایE. coli و K. pneumoniae جداسازی شد. ژن merA، رمزکننده آنزیم کاهنده جیوه معدنی، ژن عملکردی این اپرون است که وجود آن در باکتری بیان‌کننده نقش اپرون mer در ایجاد مقاومت به جیوه در باکتری است (10). در پژوهش مشابهی، کفیل‌زاده و همکاران در سال 2012 پس از بررسی مقاومت به جیوه باکتری‌های جداسازی‌شده از رسوبات آلوده خورموسی، با تکثیر ژن merA از باکتری E. coli، عامل مقاومت را پلاسمید حاوی اپرون mer گزارش کردند (26). از دیگر روش‌های پاکسازی زیستی، تثبیت باکتری در بیدهای آلژینات‌کلسیم است که برای حذف نیکل از محیط استفاده می‌شود (27).

در مطالعه‌ای برای طراحی حسگر زیستی، اپرون مقاومت به جیوه از ترانسپوزون 21 در وکتور حاوی ژن lux قرار داده شد (28). در سال 2010، ژن merA جداسازی‌شده از E. coli را در وکتور بیانی گیاه همسانه‌سازی کردند و برای گیاه‌پالایی به کالوس‌های توتون منتقل کردند (29). در این بررسی، با هدف زیست‌پالایی میکروبی، پس از تکثیر ژن K. pneumoniae با آغازگرهای حاوی سایت برشی در وکتور بیانی pET21a+ با پروموتور مناسب قرار داده شد. در نهایت، ویژگی‌های فیزیکوشیمیایی توالی آنزیم پیش‌بینی‌شده با استفاده از نرم‌افزارهای بیوانفورماتیکی بررسی شدند.

این مطالعه مقدمه‌ای برای زیست‌پالایی جیوه از طریق روش‌های مختلفی مانند زیست‌پالایی میکروبی با تولید باکتری‌های تراریخته با گنجایش زیاد حذف جیوه، طراحی بیوراکتورهای بر پایه باکتری و یا آنزیم است. امید است دیگر آنزیم‌های مربوط به این اپرون حذف جیوه، خالص‌سازی و بررسی شوند و با استفاده از مجموعه آنزیم‌ها، دامنه وسیعی از شکل‌های مختلف جیوه (جیوه معدنی، جیوه آلی و ...) حذف شوند.

 

سپاسگزاری

نویسندگان مقاله از معاونت محترم پژوهشی دانشگاه شهید مدنی آذربایجان برای فراهم‌کردن امکانات مالی پژوهش حاضر در قالب پایان‌نامه تشکر می‌کنند.



[1]- Elemental mercury

[2]- Methyl mercuric chloride

[3]- Dimethyl mercury

[4]- Bio accumulative toxins

[5]- Mineralization

[6]- narrow-spectrum mer resistance to inorganic mercury

[7]- broad-spectrum mer resistance to organomercurials

[8]- Mercuric ion reductase

[9]- Birnboim and Doly

[12]- Low melting point

[13]- BLAST

[14]- Multialign

[15]- ProtParam

[xvi]- Moore.

[xvii]- Ray S, et al.

[xviii]- Chen sh, et al.

[xix]- Von Canstein H, et al.

[xx]- Bae W, et al.

(1) Hirak RD., Surajit D. Bioremediation of mercury and the importance of bacterial mer genes. International Biodeterioration and Biodegradation 2012; 75: 207-213.

(2) Wang Q., Kim D., Dionysiou DD., Sorial GA.,Timberlake D. Sources and remediation for mercury contamination in aquatic systems-a literature review. Environmental Pollution 2004; 131(2): 323-336.

(3) Schroeder WH., Munthe J. Atmospheric mercury an overview. Atmospheric Environment 1998; 32(5): 809-822.

(4) Siudek P., Falkowska L., Urba A. Temporal variability of particulate mercury in the air over the urbanized zone of the southern Baltic. Atmospheric Pollution Research 2011; 2(4): 484-491.

(5) Afrasayab SH., Yasmin A., Hasnain SH. Characterization of some Indigenous mercury resistant bacteria from polluted environment. Journal of Biological Science 2007; 5(7): 792-797.

(6) Sinha RK., Valani D., Sinha S., Singh S., Herat S. Bioremediation of contaminated sites: A low-cost nature's biotechnology for environmental cleanup by Versatile microbes, plants & earthworms In: Faerber T., Herzog J., editors. Solid Waste Management and Environmental Remediation. New York: Nova Science Publishers; 2010: 1-72.

 

(7) Perelo LW. Review: In situ and bioremediation of organic pollutants in aquatic sediments. Journal of Hazardous Materials 2010; 177(1-3): 81-89.

(8) Silver S., Phung LT. A bacterial view of the periodic table: genes and proteins for toxic inorganic ions. Journal of Industrial Microbiology Biotechnology 2005; 32 (11-12): 587-605.

(9) Yurieva O., Kholodii G., Minakhi L., Gorlenko Z., Kalyaeva E., Mindlin S., et al. Intercontinental spread of promiscuous mercury-resistance transposons in environmental bacteria. Molecular Microbiology 1997; 24(2): 321-329.

(10)        Kiyono M., Pan Hau H. Genetic engineering of bacteria for environmental remediation of mercury. Journal Health Science 2006; 52(3): 199-204.

(11)        Aram M., Sharifi A., Kafeelzadeh F., Naghmachi M., Yasari E. Isolating Mercury-resistant Bacteria from Lake Maharloo. International Journal of Biology 2012; 4(3): 63-71.

(12)  Mirzaei N., Kafilzadeh F., Kargar M. Isolation and identification of mercury resistant bacteria from Kor River, Iran. Journal of Biological Sciences 2008; 8(5): 935-939.

(13)        Birnboim HC., Doly J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Research 1979; 7(6): 1513-1523.

(14)  Hanahan D. Techniques for transformation of E. coli In: Glover DM., editor. DNA Cloning. Oxford, Washington D.C: IRL Press; 1985: 109-135. (A Practical Approach; vol 1).

(15)  Gasteiger E., Hoogland C., Gattiker A., Duvaud S., Wilkins MR., Appel RD., et al. Protein identification and analysis tools on the ExPASy server. In: Walker JM. editor. The proteomics protocols handbook. Totowa, NJ: Humana Press; 2005: 571-607.

(16)  Wood A. Remediation Control Strategies and Cost Data for an Economic Analysis of a Mercury Total Maximum Daily Load in California. USGS [Open-File Report 03-284] 2003. Available from: http://pubs.usgs.gov/of/2003/of03-284.

(17)  Fooladi Fard R., Kamani H., Khaefee M. Elimination of heavy metals using the biological absorption method from aquatic solutions. Proceedings of the 9th National Iranian Congress of Chemical Engineering; November 23-25, 2004, Iran University of Science & Technology (IUST), Tehran, Iran.

(18)  Meybodi SM., Khorasani H. Biosorption of chromium by Pseudomonas sp. isolated from oil contaminated soils of Khuzestan. Biological Journal of Microorganism 2015; 4(14): 101-110.

(19)  Schottel JL. The mercuric and organomercurial detoxifying enzymes from a plasmid bearing strain of Escherichia coli. Journal of Biological Chemistry 1978; 253(12): 4341-4349.

(20)  Moore B. A new screen test and selective medium for the rapid detection of epidemic strains of Staphylococcus aureus. Lancet 1960; 2(7148): 453-458.

(21)  Barkay T., Miller SM., Summers AO. Bacterial mercury resistance from atoms to ecosystems. FEMS Microbiology Reviews 2003; 27(2-3): 355-384.

(22)  Ray S., Gachhui R., Pahan K., Chaudhury J., Mundal A. Detoxification of mercury and organomercurials by nitrogen fixing soil bacteria. Journal of Biological Sciences 1989; 14(2): 173-182.

(23)  Chen Sh., Wilson DB. Construction and characterization of E. coli genetically engineering for bioremediation of contaminated environments. Applied and Environmental Microbiology 1997; 63(6): 2442-2445.

(24)  Von Canstein H., Li Y., Timmis KN., Deckwer WD., Wagner Dobler I. Removal of mercury from chloralkali electrolysis waste water by a mercury resistance Pseudomonas putida strain. Applied and Environmental Microbiology 1999; 65(12): 5279-5284.

(25)  Bae W., Wu CH., Kostal J., Mulchandani A., Chon W. Enhanced with surface display merR. Applied and Environmental Microbiology 2003; 69(6): 3176-3180.

(26)  Kafilzadeh F., Zahirian Y., Zolgharnein H. Isolation and molecular identification of mercury resistant bacteria and detection of Escherichia coli mercuric reductase gene from waste water of Khowr-e-Musa, Iran. International journal biosciences 2012; 3(8): 313-318.

(27)   Ahmady-Asbchin S., Jafari N., Moradi H. Immobilization of Bacillus in calcium alginate beads for biosorption of nickel. BJM. 2015; 4(13) :171-180

(28) Selifonova O., Burlage R., Barkay T. Bioluminescent sensors for detection of bioavailable Hg(II) in the environment, Applied and environmental microbiology 1993; 59(9): 3083-3090.

(29) Shah TA., Arif A. Cloning of mercuric reductase (merA) gene isolated from wild strains of Escherichia coli. Asian Journal of Bioscience 2010; 5(1): 80-83.