مقایسه میزان بیان ژن ERG 11 کاندیدا آلبیکانس تیمار‌شده با تیموس ولگاریس به‌تنهایی و در ترکیب با منتا اسپیکاتا

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 استادیار میکروبیولوژی، گروه زیست شناسی، واحد گچساران، دانشگاه آزاد اسلامی، گچساران، ایران

2 استادیار میکروبیولوژی، گروه میکروبیولوژی، واحد یاسوج، دانشگاه آزاد اسلامی، یاسوج، ایران

3 دانشجوی کارشناس ارشد میکروبیولوژی، گروه میکروبیولوژی، واحد یاسوج، دانشگاه آزاد اسلامی، یاسوج، ایران

چکیده

مقدمه: بیماری‌های ناشی از بیماری‌زای فرصت‌طلب کاندیدا آلبیکانس به‌طور معمول با داروهای ضد قارچ درمان می‌شوند، هرچند شکست درمان به‌ویژه در میزبان دچار نقص ایمنی شدید محتمل است. مطالعه حاضر با هدف مقایسه میزان بیان ژن ERG11  کاندیدا آلبیکانس تیمار‌شده با تیموس ولگاریس به‌تنهایی و در ترکیب با منتا اسپیکاتا انجام شده است.
مواد و روش‏‏ها: در این مطالعه مقطعی، پروفیل بیان ژن ERG11 کاندیدا آلبیکانس تیمار‌شده با  تیموس ولگاریس به‌تنهایی و در ترکیب با منتا اسپیکاتا با تحلیل بر اساس حجم بررسی شد.
نتایج: نتایج تحلیل پروفیل بیان ژن ERG11 در کاندیدا آلبیکانس نشان دادند که تیموس ولگاریس در ترکیب با منتا اسپیکاتا موجب کاهش بیان ژن شده است و تیمار کاندیدا آلبیکانس با تیموس ولگاریس و منتا اسپیکاتا به‌‌تنهایی به کاهش کمتری از میزان RNA ژن ERG11  منجر می‌شود.
بحث و نتیجه‏گیری: دادههای حاصل نشان‌دهنده مکانیسم مشترکی برای یافتن اهداف احتمالی، برای نمونه، در پاسخ به کاهش ارگوسترول در کاندیدا آلبیکانس تیمارشده با  تیموس ولگاریس به‌تنهایی و در ترکیب با منتا اسپیکاتا هستند.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Comparison of ERG11 gene expression profiles of Candida albicans treated with Thymus vulgaris extracts alone and in combination with Mentha spicata

نویسندگان [English]

  • Alireza Khodavandi 1
  • Fahimeh Alizadeh 2
  • Zeynab Abrahe 3
1 Assistant professor of Microbiology, Department of Biology, Gachsaran Branch, Islamic Azad University, Gachsaran, Iran
2 Assistant professor of Microbiology, Department of Microbiology, Yasooj Branch, Islamic Azad University, Yasooj, Iran
3 MS.c. of Microbiology, Department of Microbiology, Yasooj Branch, Islamic Azad University, Yasooj, Iran
چکیده [English]

Introduction:Diseases caused by opportunistic pathogen Candida albicans are usually treated with antifungal drugs, but treatment failure is not uncommon especially in profoundly immunocompromised hosts. The aim of this study was to compare erg gene expression profiles of Candida albicans treated with Thymus vulgaris extracts alone and in combination with Mentha spicata.
Materials and methods: In this cross- sectional study, using volume based analyses we have conducted a gene expression profiling of ERG11 gene in C. albicans treated with Thymus vulgaris extracts alone and in combination with Mentha spicata.
Results: Analysis of gene expression profiles revealed the decrease of ERG11 in C. albicans treated with Thymus vulgaris extracts in combination with Mentha spicata. Incubation with Thymus vulgaris and Mentha spicata extracts alone, however, resulted in a decrease in ERG11 RNA levels less than combination.
Discussion and conclusion: These data suggest a common mechanism to find the probable targets e.g., in response to ergosterol depletion in C. albicans treated with Thymus vulgaris extracts alone and in combination with Mentha spicata.

کلیدواژه‌ها [English]

  • Candida albicans
  • ERG11
  • Gene expression

مقدمه

مخمر کاندیدا آلبیکانس[1] عفونت دوره‌ای کاندیدیازیس[2] را ایجاد می‌کند. تعداد محدودی داروی ضد قارچ برای درمان بیماری‌های ناشی از گونه‌های کاندیدا وجود دارند و استفاده بیش از حد این داروها به پیدایش سوش‌های مقاوم منجر شده است (1-3). همچنین، بیشتر داروهای ضد قارچی آثار جانبی بسیاری را نشان می‌دهند (4).

کاندیدا آلبیکانس[3] عوامل بیماری‌زای بسیاری دارد؛ ازجمله چسبندگی به سلول‌های اندوتلیال و اپی‌تلیال انسان، توانایی ترشح آنزیم‌های هیدرولیز‌کننده که بیشتر پروتئینازها و فسفولیپازها هستند، تغییر فنوتیپی و همچنین فرار از فاگوسیتوزشدن توسط سلول‌های ایمنی میزبان. علاوه بر این، از عوامل مهم بیماری‌زایی کاندیدا آلبیکانس چندشکلی‌بودن با توانایی تغییر برگشت‌پذیر شکل‌های مخمری، ریسه حقیقی، ریسه کاذب و تشکیل بیوفیلم هستند. شکل ریسه‌ای و بیوفیلم کاندیدا آلبیکانس قادر به نفوذ به درون بافت میزبان، فرار از سیستم ایمنی و ایجاد عفونت است(5-7).

ارگوسترول، از اجزای حیاتی غشای سلولی قارچ‌هاست. ژن‌های بسیاری در تولید آنزیم‌های لازم برای سنتز ارگوسترول دخالت می‌کنند؛ ازجمله ژن‌های دخیل در سنتز ارگوسترول کاندیدا آلبیکانس، ERG1-11وERG25-27 هستند و ژن‌های دیگری مانند CYB5 و NCP1 آنزیم‌های سیتوکروم را سنتز می‌کنند (8).

ثابت شده است که مواد مشتق‌شده از گیاهان دارویی حتی پس از استفاده طولانی‌مدت، عوارض جانبی ندارند. خانواده نعناعیان[4] یکی از معروف‌ترین گیاهان طبیعی هستند که برای چای گیاهی، تونیک، ضد نفخ، ضد سرفه، ضدعفونی‌کننده، ضد التهاب و درمان سرماخوردگی استفاده می‌شود.  تیموس ولگاریس[5] حاوی ترکیبات تیمول و دارای ویژگی‌های ضد میکروبی است. منتا اسپیکاتا[6] دارای ترکیبات پلی‌فنلی است و از این رو، ویژگی‌هی آنتی اکسیدانی بسیاری دارد (9-13).

مقاومت به داروهای ضد قارچ به جهش‌های نقطه‌ای و سطوح بالای بیان ژن ERG11 ربط داده شده‌اند (14). مطالعه‌ها نشان داده‌اند که فلوکونازول بر بیان ژن‌های ERG11، ERG1،ERG7، ERG25و ERG9 در کاندیدا آلبیکانس تأثیر درخور توجهی دارد (15).

در مطالعه حاضر، میزان بیان ژن ERG11 در کاندیدا آلبیکانس تیمارشده با رقت‌های مختلف عصاره‌های آبی و متانولی تیموس ولگاریس و منتا اسپیکاتا به‌‌تنهایی و در ترکیب با همسنجیده شد.

 

مواد و روشها

تهیه گیاهان: گیاهان تیموس ولگاریس (آویشن باغی) و منتا اسپیکاتا (نعناع) در فصل بهار از فروشگاهای یاسوج تهیه شدند و شرکت دارویی زرد بند یاسوج آنها را تأیید علمی کرد.

عصارهگیری: اندام هوایی گیاهان یادشده با آب مقطر استریل شسته و قطعه‌قطعه شدند. سپس در هوای آزاد و سایه خشک شدند تا به‌راحتی در آسیاب برقی خرد شوند. مقدار 1 گرم از پودر الک‌شده (الک شماره 80) اندام‌های مختلف گیاهان مطالعه‌شده به 5 میلی‌لیتر آب مقطر و یا متانول 96 درصد اضافه و به مدت 72 ساعت در دمای 30 درجه سلیسیوس گرمخانه گذاری شد. پس از سوکسیله‌کردن عصاره‌ها، از کاغذ صافی واتمن شماره 42 عبور داده شدند. برای استریل‌کردن عصاره‌ها از میلی‌پور فیلتر(0.22 μm durapore, Millipore) استفاده شد (16) .

ریزموجودات:ریزموجودات استفاده‌شده در پژوهش شامل9 جدایه بالینی بودند که از افراد دچار ضعف سیستم ایمنی بدن (افراد مبتلا به سرطان خون، تومور مغزی، ایدز و دیابت) جمع‌آوری شده بودند. نمونه‌ها با سواب از ترشحات مخاطی دهان و واژن 40 بیمار جمع‌آوری و بی‌درنگ روی محیط‌کشت سابوراد دکستروز آگار[7] حاوی کلرامفنیکل
(Difco Laboratories, Detroit, Michigan) کشت داده شدند. جدایه‌ها با توجه به شکل ظاهری کلنی (ماهواره‌ای کرم‌رنگ) روی محیط‌کشت SDA، مشاهده‌های میکروسکوپی مخمر، تولید لوله زایا، هیدرولیز اوره و کشت روی محیط‌کشت کــروم آگــار کاندیــدا (CHROMagar Company, France)، شناسایی و در سابوراد دکستروز مایع[8] (Difco Laboratories) حاوی کلرامفنیکل ذخیره شدند. همچنین، از سویه استاندارد کاندیدا آلبیکانس ATCC 10231 به‌عنوان منبعی برای کنترل کیفیت استفاده شد (17).

آزمون حساسیتسنجی ضد کاندیدیایی به روش دیسک دیفیوژن: برای اطمینان از فاز لگاریتمی رشد، از جدایه‌های کاندیدا آلبیکانس و سویه استاندارد دو بار کشت مجدد تهیه و سوسپانسیونی به کدورت معادل نیم مک فارلند 106 ×(1-5 CFU/ml) در سرم فیزیولوژی تهیه شد. به‌طور خلاصه، تعداد 5 کلنی به قطر تقریبی 1 میلی‌متر به 5 میلی‌لیتر سرم فیزیولوژی استریل اضافه، ورتکس و یک بار شسته شدند. تراکم سلول‌ها با استفاده از اسپکتروفتومتر (UNICO 2150-UV, USA) در طول موج 530 نانومتر حدود CFU/ml  106 × 1-5 برای دستیابی به کدورت معادل 5/0 مک فارلند تنظیم و با روش ویبل کانت[9] تأیید شد. پس از تهیه سوسپانسیون مخمری، 100 میکرولیتر سوسپانسیون به‌شکل کشت چمنی، 3 بار به‌طور کامل با زاویه 60 درجه و یکنواخت در سطح پلیت 9 سانتی‌متری حاوی محیط‌کشت SDA تلقیح شد. سپس پلیت‌ها 15 دقیقه زیر هود میکروبیولوژی قرار داده شدند تا مایع اضافی آنها جذب شود و به درون آگار نفوذ کند. سپس دیسک‌های خالی با حجم‌های مختلف (20، 50 و 100 میکرولیتر) عصاره‌‌های استریل گیاهان تیموس ولگاریس و منتا اسپیکاتا و نسبت مساوی از هر دو گیاه آغشته و پس از خشک‌‌شدن در فاصله 5/2 تا 3 سانتی‌متر قرار داده شدند. پلیت‌ها به مدت 24 ساعت در 37 درجه سلیسیوس گرمخانه‌گذاری شدند و سپس، قطر هاله عدم رشد در اطراف دیسک با خط‌کش میلی‌متری بررسی شد. در این آزمایش، از دیسک‌های حاوی 10 میکروگرم بر میلی‌لیتر آمفوتریسین بی (Sigma-Aldrich, St. Louis, MO USA) برای شاهد مثبت و دیسک‎های خالی استریل برای شاهد منفی استفاده شد. آزمایش‌ها در دو تکرار سه‌تایی انجام شدند (18).

آزمون حساسیتسنجی ضد کاندیدیایی به روش میکرودایلوشن براث[10]: برای تهیه سوسپانسیون میکروبی، ابتدا مطابق دستورعمل CLSI، سوسپانسیون تهیه‌شده معادل 5/0 مک فارلند به میزان 1:100 با سرم فیزیولوژی رقیق و در مرحله بعد به میزان 1:20 در محیط‌کشت استریل RPMI-1640 حاوی ال-گلوتامین (Sigma) رقیق شد. در پایان، سوسپانسیون حاصل 103×5/2-5/0 سلول مخمر در میلی‌لیتر داشت که با روش ویبل کانت تأیید شد (19).

تهیه رقت از عصاره‌ها: دامنه رقت عصاره‌های آبی و الکلی اندام‌های برگ، ساقه و گیاهان مطالعه‌شده 102/0 تا 102 میلی‌گرم در میلی‌لیتر بود. عصاره‌های گیاهان  در ظروف تیره‌رنگ شیشه‌ای، در یخچال و دمای منفی 4 درجه سلسیوس ذخیره شدند. اسیدیته عصاره‌ها 7 در نظر گرفته شد.

تعیین کمترین رقت ممانعت‌‌کنندگی از رشد[11]: کمترین رقت ممانعت‌کنندگی عصاره‌ها در میکروپلیت‌های 96 چاهکی
 (Brand 781660, Wertheim, Germany) تعیین شد. 100 میکرولیتر از هر رقت عصاره در محیط‌کشت RPMI-1640 حاوی ال-گلوتامین به‌تنهایی و یا ترکیب 50:50 به 100 میکرولیتر سوسپانسیون میکروبی درون چاهک میکروپلیت اضافه و به‌خوبی مخلوط شد. در میکروپلیت‌های حاوی سوسپاسیون میکروبی و عصاره‌ها بسته و با پارافیلم پوشانده شد. پس از 2 ساعت انکوباسیون در یخچال (برای یکسان‌سازی وضعیت چاهک‌ها)، به مدت 24 ساعت در دمای 35 درجه سلیسیوس گرمخانه‌گذاری شدند. چاهک‌های حاوی 100 میکرولیتر محیط‌کشت و 100 میکرولیتر سوسپانسیون میکروبی، شاهد مثبت در نظر گرفته شدند. در این روش، شاهد مثبت برای بررسی نتایج بسیار مهم و معیار سنجش MIC است و باید کاندیدا در چاهک شاهد مثبت به‌خوبی رشد کرده باشد. علاوه بر این، چاهک حاوی 100 میکرولیتر عصاره در محیط‌کشت به 100 میکرولیتر محیط‌کشت، شاهد منفی در نظر گرفته شد. پس از گرمخانه‌گذاری، ابتدا محتویات هر چاهک به‌خوبی مخلوط و میزان جذب نوری نمونه‌ها با الیزا ریدر در طول موج 530 نانومتر اندازه‌گیری شد. نقطه پایانی برای تأثیر عصاره‌ها بر مخمر، کمترین رقت هر ترکیب ضد قارچی تعریف شد که از 50 و 90 درصد رشد در مقایسه با شاهد ممانعت می‌کند. آزمایش‌ها در دو تکرار سه‌تایی انجام شدند (3 و 14).

سنجش بیان ژن ERG11 کاندیدا آلبیکانس:برای سنجش میزان بیان ژن ERG11 در کاندیدا آلبیکانس، رقت‌های مختلف بر اساس نتیجه MIC از رقت‌های معادل  دو برابرMIC ،  MIC و نصف MICبا
106 × 1 سلول در میلی‌لیتر کاندیدا آلبیکانس مخلوط و 24 ساعت در دمای 35 درجه سلسیوس گرمخانه‌گذاری شدند. سوسپانسیون تهیه‌شده به مدت 10 دقیقه در دور rpm3000 سانتریفیوژ و پلت سه بار با سرم فیزیولوژی شسته شد. استخراج RNA کل با کیت RNeasy Mini ویژه سلول‌های مخمری (Qiagen, Hilden, Germany) مطابق دستورعمل شرکت سازنده و با اندکی تغییر انجام شد. پس از استخراج RNA، کیفیت و کمیت آن با اسپکتروفتومتری و ژل آگارز بررسی و سپس کیفیت RNA استخراجی پس از سنتز cDNA با استفاده از پرایمرهای اختصاصی طراحی‌شده برای ژن اکتین:

(F: 5'ACCGAAGCTCCAATGAATCCAAAATCC3'،
R: 5'GTTTGGTCAATACCAGCAGCTTCCAAA3')

 سنجیده شد (6). برای حذف احتمال هر نوع آلودگی DNA، از تیمار با آنزیم RNase free DNase set (Qiagen) استفاده شد. 5/0 میکروگرم از RNA کل با استفاده از آنزیم ترانس کریپتاز معکوس و پرایمرهای هگزامر تصادفی موجود در کیت سنتز cDNA (Fermentas, USA) به cDNA سنتز شد. آزمایش ها در دو تکرار سه‌تایی انجام شدند (2 و 6).

ژن ERG11 کاندیدا آلبیکانس با استفاده از پرایمر (F: 5'TTGGTGGTGGTAGACATA3'،R: 5'TCTGCTGGTTCAGTAGGT3') که خداوندی[12] و همکاران (6) طراحی کرده‌اند از cDNA سنتزشده تکثیر شد. علاوه بر این، از ژن اکتین به‌عنوان ژن مرجع استفاده شد. برای اطمینان از اینکه محصولات واکنش زنجیره‌ای پلیمراز ناشی از DNA ژنومی نباشند، برای هر نمونه شاهد منفی داخلی بدون آنزیم ترانس کریپتاز معکوس تهیه شد. واکنش زنجیره‌ای پلیمراز شامل 5 میکرولیتر بافر Taq X10 (Fermentas)، 1 میکرولیتر dNTP  10 میلی‌مولار (Fermentas)، 5/0میکرولیتر از هر یک از پرایمرهای بالادست و پایین‌دست (Bioneer, Korea)، 5/0 میکرولیتر آنزیم Taq DNA پلیمراز (Fermentas)، 1 میکرولیتر cDNA و مقدار مناسبی آب دیونیزه (سیناژن، ایران) تا حجم 25 میکرولیتر آماده شد. شرایط تکثیر مطابق دستور زیر انجام شد: چرخه 1 (X1): مرحله 1. 94 درجه سلیسیوس به مدت 5 دقیقه؛ چرخه 2 (X26): مرحله 1. 94 درجه سلیسیوس به مدت 30 ثانیه، مرحله 2. 56 درجه سلیسیوس به مدت 45 ثانیه و مرحله 3. 72 درجه سلیسیوس به مدت 45 ثانیه؛ چرخه 3 (X1): مرحله 1. 72 درجه سلیسیوس به مدت 7 دقیقه در دستگاه ترموسایکلر  (Techno, Germany) انجام شد. آزمایش‌ها در دو تکرار سه‌تایی انجام شدند (2 و 6).

مطابق روش خداوندی و همکاران (17)، سنجش نسبی میزان بیان ژن مطالعه‌شده بر اساس حجم باندهای ایجادشده در الکتروفورز محصول واکنش زنجیره‌ای پلیمراز انجام شد. با استفاده از تصویرساز ژل داک (Bio-Rad, USA)، تصویر ژل آگارز کالیبره ثبت و میزان بیان ژن با نرم‌افزار Quantity One 1-D Analysis (Bio-Rad, USA, version 4.6) ارزیابی شد.

طرح مطالعه و تحلیل آماری:مطالعه حاضر به‌شکل طرح کاملاً تصادفی و آزمایش‌ها در دو تکرار سه‌تایی انجام شدند. نتایج مطالعه پس از نرمال‌کردن داده‌ها با آزمون آنالیز واریانس یک‌طرفه، با نرم‌افزار آماری SPSS نسخه 20(SPSS Inc., Chicago, IL) تجزیه و تحلیل شدند. ارزش p<0.05 سطح معناداری در نظر گرفته شد.

 

نتایج

نتایج آزمون حساسیت‌سنجی ضد کاندیدیایی انتشـار دیسک نشان دادند که در مقایسه با داروی ضد قارچی آمفوتریسین بی، عصاره‌های گیاهان تیموس ولگاریس و منتا اسپیکاتا روی جدایه‌های بالینی و سویه استاندارد ATCC کاندیدا آلبیکانس مؤثر بوده‌اند. عصاره‌های مطالعه‌شده‌ هاله ممانعت از رشدی ایجاد کردند که نشان داد حجم 100 میکرولیتر دارای پتانسیل ضد قارچی بیشتری بوده است. در همه تیمارهای مطالعه‌شده، عصاره‌های آبی و متانولی تفاوت درخور توجهی نشان ندادند. نتایج، تأثیر بیشتر عصاره تیموس ولگاریس در ترکیب با منتا اسپیکاتا علیه کاندیدا آلبیکانس را در مقایسه با عصاره‌های دیگر نشان دادند. همچنین، گیاه تیموس ولگاریس به‌تنهایی تأثیر ضد کاندیدیایی بیشتری در مقایسه با منتا اسپیکاتا داشت (جدول 1). نتایج آزمون حساسیت‌سنجی ضد کاندیدیایی میکرودایلوشن براث، نتایج آزمون انتشـار دیسک را تأیید کردند؛ کمترین میزان رقت ممانعت از رشد (MIC) به عصاره تیموس ولگاریس در ترکیب با منتا اسپیکاتا تعلق داشت (جدول 2).

 

جدول 1- نتایج آزمون حساسیت‌سنجی ضد کاندیدیایی به روش دیسک دیفیوژن (میلی‌متر) عصاره‌های آبی و متانولی اندام هوایی گیاهان تیموس ولگاریس و منتا اسپیکاتا به‌تنهایی و در ترکیب با هم علیه کاندیدا آلبیکانس

جدایه 9

جدایه 8

جدایه 7

جدایه 6

جدایه 5

جدایه 4

جدایه 3

جدایه 2

جدایه 1

کاندیدا آلبیکانس

ATCC 10231

حجم عصاره (میکرولیتر)

عصاره‌های آزمایش‌شده/جدایه‌ها

95/0±03/7

50/0±50/7

00/0±90/6

00/0±6

00/0±6

30/0±10

00/0±6

00/0±6

00/0±6

00/0±6

100

عصاره آبی

تیموس ولگاریس

46/0±26/6

45/0±62/6

34/0±70/6

00/0±6

00/0±6

20/0±30/9

00/0±6

00/0±6

00/0±6

00/0±6

50

 

 

51/0±30/6

34/0±10/7

00/0±90/6

00/0±6

00/0±6

70/0±50/8

00/0±6

00/0±6

00/0±6

00/0±6

20

 

 

20/0±9

20/0±9

36/0±70/6

17/0±90/7

00/0±7

00/0±7

00/0±6

17/0±8

25/0±50/7

00/0±90/6

100

عصاره متانولی

 

52/0±20/8

52/0±20/8

26/0±30/6

50/0±50/7

50/0±50/6

00/0±7

00/0±6

55/0±20/7

00/0±7

00/0±90/6

50

 

 

34/0±50/6

34/0±50/6

00/0±6

00/0±50/7

50/0±50/6

00/0±6

00/0±6

50/0±7

00/0±7

00/0±90/6

20

 

 

00/0±6

00/0±6

00/0±6

00/0±6

20/0±20/7

00/0±6

50/0±50/7

00/0±6

00/0±6

00/0±6

100

عصاره آبی

منتا اسپیکاتا

00/0±6

00/0±6

00/0±6

00/0±6

00/0±7

00/0±6

25/0±40/7

00/0±6

00/0±6

00/0±6

50

 

 

00/0±6

00/0±6

00/0±6

00/0±6

00/0±7

00/0±6

00/0±7

00/0±6

00/0±6

00/0±6

20

 

 

 

 

ادامه جدول 1- نتایج آزمون حساسیت‌سنجی ضد کاندیدیایی به روش دیسک دیفیوژن (میلی‌متر) عصاره‌های آبی و متانولی اندام هوایی ...

جدایه 9

جدایه 8

جدایه 7

جدایه 6

جدایه 5

جدایه 4

جدایه 3

جدایه 2

جدایه 1

کاندیدا آلبیکانس

ATCC 10231

حجم عصاره (میکرولیتر)

عصاره‌های آزمایش‌شده/جدایه‌ها

00/0±6

00/0±6

17/0±10/8

00/0±6

36/0±50/7

00/0±7

36/0±70/6

00/0±6

00/0±6

00/0±6

100

عصاره متانولی

 

00/0±6

00/0±6

34/0±30/7

00/0±6

00/0±7

00/0±7

34/0±70/6

00/0±6

00/0±6

00/0±6

50

 

 

00/0±6

00/0±6

52/0±60/6

00/0±6

00/0±6

00/0±6

26/0±20/6

00/0±6

00/0±6

00/0±6

20

 

 

00/0±6

00/0±50/7

00/0±50/6

00/0±6

40/0±50/7

43/0±10

30/0±80/7

00/0±6

00/0±6

00/0±6

100

عصاره آبی

 تیموس ولگاریس

+منتا اسپیکاتا+ منتا اسپیکاتا

00/0±6

26/0±80/6

00/0±50/6

00/0±6

36/0±30/7

04/1±20/9

00/0±50/7

00/0±6

00/0±6

00/0±6

50

 

 

00/0±6

00/0±6

00/0±6

00/0±6

00/0±7

45/0±50/8

00/0±50/7

00/0±6

00/0±6

00/0±6

20

 

 

00/0±9

00/0±6

34/0±60/10

30/0±8

00/0±50/9

36/0±20/9

26/0±90/6

20/0±8

00/0±6

00/0±50/7

100

عصاره متانولی

 

43/0±50/8

00/0±6

17/0±60/9

00/0±50/7

30/0±9

36/0±90/8

43/0±50/6

26/0±70/7

00/0±6

00/0±50/7

50

 

 

40/0±50/7

00/0±6

26/0±80/7

00/0±7

30/0±20/8

36/0±8

17/0±10/6

00/0±7

00/0±6

00/0±7

20

 

 

11/0±31/23

41/0±81/23

00/0±61/23

00/0±11/22

00/0±11/22

11/0±11/22

55/0±01/23

59/0±02/22

16/0±11/22

01/0±01/22

آمفوتریسین بی


 

جدول 2- نتایج آزمون حساسیت‌سنجی ضد کاندیدیایی به روش میکرودایلوشن براث عصاره‌های آبی و متانولی اندام هوایی گیاهان تیموس ولگاریس و منتا اسپیکاتا به‌تنهایی و در ترکیب با هم علیه کاندیدا آلبیکانس

جدایه 9

جدایه 8

جدایه 7

جدایه 6

جدایه 5

جدایه 4

جدایه 3

جدایه 2

جدایه 1

ATCC

10231

MIC

(میلی‌گرم بر میکرولیتر)

عصاره های آزمایش شده/جدایه ها

15/12

55/11

24/12

44/11

80/11

82/11

27/12

24/12

26/11

28/11

MIC90

عصاره آبی

تیموس ولگاریس

75/6

42/6

80/6

36/6

55/6

57/6

82/6

80/6

25/6

27/6

MIC50

 

 

50/13

84/12

60/13

72/12

10/13

14/13

64/13

60/13

51/12

54/12

MFC

 

 

21/12

28/11

25/12

07/11

25/11

25/11

42/12

79/11

30/11

20/12

MIC90

عصاره متانولی

 

23/6

27/6

25/6

15/6

25/6

25/6

90/6

55/6

30/6

78/6

MIC50

 

 

46/12

54/12

50/12

30/12

50/12

50/12

80/13

10/13

56/12

56/13

MFC

 

 

57/22

11/23

32/23

31/23

95/22

04/23

22/23

25/23

31/23

57/22

MIC90

عصاره آبی

منتا اسپیکاتا

54/12

84/12

96/12

95/12

75/12

80/12

90/12

92/12

90/12

54/12

MIC50

 

 

68/25

92/25

90/25

50/25

60/25

80/25

84/25

80/25

90/25

08/25

MFC

 

 

48/22

77/22

41/22

59/22

77/22

41/22

14/22

23/22

12/22

12/22

MIC90

عصاره متانولی

 

49/12

65/12

45/12

55/12

65/12

45/12

30/12

35/12

30/12

29/12

MIC50

 

 

98/24

30/24

90/24

10/24

30/24

90/24

60/24

70/24

58/24

58/24

MFC

 

 

14/8

02/8

22/8

13/9

22/8

22/7

31/7

04/7

32/8

20/8

MIC90

عصاره آبی

تیموس ولگاریس

+منتا اسپیکاتا

86/6

79/6

90/6

85/6

90/6

90/6

95/6

80/6

95/6

89/5

MIC50

 

 

72/8

58/8

80/8

70/9

80/9

80/7

90/8

60/7

91/8

78/8

MFC

 

 

41/8

05/8

26/8

77/8

59/8

41/8

41/8

60/8

48/8

04/8

MIC90

عصاره متانولی

 

45/6

25/6

37/6

65/6

55/6

45/6

45/6

56/6

45/6

78/5

MIC50

 

 

90/9

50/9

74/8

30/8

10/8

90/9

90/8

12/8

98/8

56/8

MFC

 

 

 

 

شکل 1، نتایج تکثیر قطعه 313 جفت بازی ژن ERG11 و قطعه 516 جفت بازی برای ژن مرجع را نشان می‌دهد. داده‏ها نشان دادند که میزان بیان ژن مرجع در کاندیدا آلبیکانس شاهد و تیمارشده با عصاره یکسان بود و میزان بیان ژن ERG11 در رقت‌های معادل  دو برابرMIC ،  MIC و نصف MICدر تیمارهای مختلف تفاوت معناداری (p≤0.05) داشته است. در مقایسه با شاهد، بیان ژن ERG11 کاندیدا آلبیکانس تیمارشده با عصاره تیموس ولگاریس، منتا اسپیکاتا به‌تنهایی و در ترکیب با هم کاهش نشانداده است.

 

شکل 1- مقدار نسبی بیان ژن ERG11 در کاندیدا آلبیکانس تیمارشده با رقت‌های مختلف بر اساس MIC. عصاره: الف. تیموس ولگاریس، ب. منتا اسپیکاتا، ج. ترکیب تیموس ولگاریس با منتا اسپیکاتا پس از 24 ساعت همراه با نتایج بیان ژن ERG11 کاندیدا آلبیکانس تیمارشده با رقت‌های مختلف عصاره‌های مطالعه‌شده بر اساس MIC پس از 24 ساعت روی ژل آگارز: M. نشانگر، C+. شاهد مثبت و حاوی DNA ژنومی، C-. نمونه بدون تیمار (شاهد منفی)، ستون 1. رقت دو برابر MIC عصاره، ستون 2. رقت برابر MIC عصاره، ستون 3. رقت نصف MIC عصاره، ستون 4. شاهد داخلی واکنش زنجیره‌ای پلیمراز معکوس


بحث و نتیجه‌گیری

مدت زمانی طولانی است که عفونت‌های قارچی مشکلات بسیاری را برای سلامت انسان‌ها و به‌ویژه افراد دچار نقص ایمنی ایجاد کرده‌اند. با وجود تلاش پی‌درپی پژوهشگران، نبرد علیه کاندیدیازیس همچنان ادامه دارد و تا حد زیادی ناموفق بوده است. با در نظر گرفتن اثر درمان‌های ضد قارچی رایج و محدود فعلی و ظهور مقاومت در برابر داروها توسط سویه‌های مختلف کاندیدا، نیاز شدید به روش ضد قارچ ضروری به نظر می‌رسد و به اﺳﺘﻔﺎده از توان ﺿﺪ ﻣﯿﮑﺮوﺑﯽ گیاهانی مانند تیموس ولگاریس و منتا اسپیکاتا، مولکول‌های زیستی با طیف گسترده‌ای از فعالیت‌های زیستی و دارویی جایگزین داروهای شیمیایی توجه شده است (6 و 11-13).

گزارش‌های بسیاری نشان داده‌اند که تیموس ولگاریس و منتا اسپیکاتا فعالیت ضد قارچی قوی علیه کاندیدا آلبیکانس دارند (17 و 20-23). در مطالعه حاضر، عصاره‌های تیموس ولگاریس و منتا اسپیکاتا به‌تنهایی و در ترکیب با هم علیه کاندیدا آلبیکانس سنجیده شدند و مکانیسم مولکولی احتمالی عصاره‌های آبی اندام هوایی این گیاهان با سنجش میزان بیان ژن ERG11، از مهم‌ترین ژن های دخیل در بیوسنتز ارگوسترول غشای سلولی قارچ، ارزیابی شد.

نتایج مطالعه حاضر، تأثیر عصاره‌های اندام‌های هوایی گیاهان تیموس ولگاریس و منتا اسپیکاتا راعلیه کاندیدا آلبیکانس نشان دادند و با مطالعه‌های پیشین هم‌خوانی داشتند (17و 20-23). در مطالعه حاضر، ترکیب عصاره تیموس ولگاریس با منتا اسپیکاتا بیشترین تأثیر ضد قارچی را علیه کاندیدا آلبیکانس نشان داد. مطالعه‌ها نشان داده‌اند که تیموس ولگاریس حاوی ترکیبات مونوترپن فنلی مانند تیمول و کارواکرول و منتا اسپیکاتا نیز دارای ترکیبات پلی‌فنلی است (9 و 10). بنابراین، وجود ترکیبات مؤثره در گیاهان، نقش مهمی در افزایش تأثیر ترکیبی عصاره‌های تیموس ولگاریس با منتا اسپیکاتا دارد.

ارگوسترول جزو اصلی استرول غشای سلولی و فرآیندهای غشایی سلول مخمر و همچنین مسئول حفظ عملکرد و یکپارچگی سلول است. مکانیسم اولیه عملکرد برخی داروهای ضد قارچی ازجمله آزول‌ها و پلی‌ان‌ها، مهار رشد سلول مخمر از طریق اختلال در بیوسنتز استرول طبیعی است که به کاهش در بیوسنتز ارگوسترول منجر می‌شود (24). یکی از مهم‌ترین ژن‌های دخیل در بیوسنتز ارگوسترول غشای سلولی کاندیدا آلبیکانس ERG11 است و جهش در ژن‌های بیوسنتز ارگوسترول موجب مقاومت قارچ به برخی داروهای ضد قارچی شده است (25).

نتایج مطالعه حاضر تفاوت معنا‏دار میزان بیان ژن ERG11 در تیمارهای مختلف را نشان دادند و در مقایسه با شاهد، بیان ژن ERG11 کاندیدا آلبیکانس تیمارشده با عصاره تیموس ولگاریس، منتا اسپیکاتا به‌تنهایی و در ترکیب با هم کاهش یافت. ERG11 تولید لانوسترول 14-α دمیتلاز را کدگذاری می‌‌کند و بیان بیشتر ERG11 موجب تولید مقدار زیادی آنزیم لانوسترول 14-α دمیتلاز و در نتیجه سنتز بیشتر ارگوسترول و نگهداری یکپارچگی غشای سلولی کاندیدا می‌شود؛ برعکس، کاهش بیان ژن ERG11 موجب سنتز ارگوسترول کمتر و از بین رفتن یکپارچگی غشای سلولی کاندیدا می‌شود (26). مطالعه‌ها نشان داده‌اند که افزایش بیان ژن ERG11یا جهش در این ژن موجب مقاومت به داروهای ضد قارچی مؤثر بر غشای سلولی شده است (27-29).

اصلانی[xiii] و همکاران (30)، تأثیر ضد میکروبی اکینوفورا پلتیلوبا[xiv] (خوشاریزه) و ساتورجا بختیاریکا[xv] (مرزه بختیاری) را در مهار رشد جدایه‌های بالینی مقاوم به فلوکونازول کاندیدا آلبیکانس با ارزیابی میزان بیان ژن‌های  ERG11و MDR1سنجیدند. نتایج نشان دادند که اکینوفورا پلتیلوبا موجب کاهش بیان ERG11 شد در حالی که گیاه ساتورجا بختیاریکا روی بیان ژن ERG11 تاثیری نداشت.

نتایج مطالعه‌های خداوندی و همکاران (16)، کاهش بیان ژن‌های ERG1, 3, 11 کاندیدا آلبیکانس تیمارشده با ترکیب فلوکونازول و تربینافین را نشان دادند.در مطالعه‌ای دیگر، خداوندی و همکاران (17) تأثیر ضد بیوفیلم کاندیدیایی عصاره آبی ریشه  تیموس ولگاریس رابا ارزیابی تغییرات نسبی میزان بیان ژنHWP1 سنجیدند. نتایج نشان دادند که گیاه یادشده موجب کاهش بیان ژن HWP1در رقت‌های مختلف MIC شده است.

موسوی‌نژاد[xvi]، تأثیر ضد کاندیدیایی گیاهان آویشن شیرازی[xvii] و وشا[xviii] را ارزیابی (31) و تأثیر عصاره‌های الکلی گیاهان یادشده را بر میزان بیان ژن‌های MDR1 و ERG11 بررسی کرد. نتایج نشان دادند که  MICعصاره الکلی آویشن شیرازی و وشا در جدایه‌های بالینی کاندیدا آلبیکانس بهترتیب 256 و 64 میلی گرم در میلی‌لیتر و MFC عصاره الکلی آویشن شیرازی و وشا در جدایه‌های بالینی کاندیدا آلبیکانس به‌ترتیب 512 و 128 میلی‌گرم در میلی‌‌لیتر بوده است. گیاه آویشن شیرازی، ژن‌های MDR1 و ERG11 را مهار کرد و عصاره وشا روی هر دو ژن تأثیری نداشت.

در دهه‌های اخیر به دلیل مقاومت‌های دارویی، عوارض جانبی داروهای شیمیایی و الزام‌های زیست‌محیطی، گرایش به استفاده از گیاه‌درمانی رو به افزایش است.مطالعه حاضر نشان داد که میزان بیان ژن ERG11 در تیمارهای مختلف تفاوت معناداری داشته است. از آنجا که ژن ERG11 یکی از مهم‌ترین ژن‌های دخیل در بیوسنتز ارگوسترول غشای سلولی کاندیدا آلبیکانس است، هدف مؤثری برای تأثیر عوامل ضد کاندیدیایی محسوب می‌شود. با توجه به نتایج پژوهش حاضر و با انجام آزمایش‌های تکمیلی، ترکیب تیموس ولگاریس و منتا اسپیکاتا می‌تواندجایگزین داروهای شیمیایی ‌شود.

 

سپاسگزاری

نویسندگان مقاله حاضر از مسئولان محترم دانشگاه آزاد اسلامی واحد یاسوج برای همکاری صمیمانه در اجرای این طرح و از شرکت دارویی زرد بند یاسوج برای همکاری در شناسایی و تهیه عصاره گیاهی، کمال امتنان را دارند.



[1]- Candida albicans

[2]- Candidiasis

[3]- Candida albicans

[4]- Lamiaceae

[5]- Thymus vulgaris

[6]- Mentha spicata

[7]- Sabouraud Dextrose Agar (SDA)

[8]- Sabouraud Dextrose Broth (SDB)

[9]- Viable count

[10]- Broth microdilution

[11]- Minimum Inhibitory Concentration (MIC)

[12]- Khodavandi 

[xiii]- Aslani

[xiv]- Echinophora platyloba

[xv]- Satureja bachtiarica

[xvi]- Mosavinejad

[xvii]- Zataria multiflora 

[xviii]- Dorma ammoniacum

 

(1) Khodavandi A., Nazira Adila BT., Poh WC., Phelim YVC., Alizadeh F., Harmal NS., Chong PP. Antifungal activity of Rhizome coptidis and Alpinia galangal against Candida species. Journal of Pure and Applied Microbiology 2013; 7(3): 1725-1730.

(2) Khodavandi A., Alizadeh F., Namvar F., Rosfarizan M., Chong, PP. Anti-Candida potential of Allium ascalonicum Linn: antibiofilm activity and biomolecular mechanism of action. Journal of Pure and Applied Microbiology 2014; 8(2): 349-356.

(3) Han Y. Synergic effect of grape seed extract with amphotericin B against disseminated candidiasis due to Candida albicans. Phytomedicine 2007; 14(11): 733-738.

 

(4) Vandeputte P., Ferrari S., Coste AT. Antifungal resistance and new strategies to control fungal infections. International Journal of Microbiology 2012; doi:10.1155/2012/713687.

(5) Kruppa M. Quorum sensing and Candida albicans. Mycoses 2008; 52: 1-10.

(6) Khodavandi A., Harmal NS., Alizadeh F., Scully OJ., Sidik SHM., Othman F., et al. Ng KP, Chong PP. Comparison between allicin and fluconazole in Candida albicans biofilm inhibition and in suppression of HWP1 gene expression. Phytomedicine 2011; 19: 56-63.

(7) Khan MSA., Ahmad I., Aqil F., Owais M., Shahid M., Musarrat J. Virulence and pathogenicity of fungal pathogens with special reference to Candida albicans. In: Ahmad I., Owais M.,  Shahid M., Aqil F., editors. Combating Fungal Infections Problems and Remedy. New York: Springer; 2010: 21-45.

(8) Pierson CA., Eckstein J., Barbuch R., Bard, M. Ergosterol gene expression in wild-type and ergosterol-deficient mutants of Candida albicans. Medical  Mycolology 2004; 42(4): 385-389.

(9) Hudaib M., Speroni E., Di Pietra AM., Cavrini V. GC/MS evaluation of thyme (Thymus vulgaris L.) oil composition and variations during the vegetative cycle. Journal of Pharmaceutical and Biomedical Analysis 2002; 29(4): 691-700.

(10)           Dorman HJD., Koşar M., Kahlos K., Holm Y., Hiltunen R. Antioxidant properties and composition of aqueous extracts from Mentha species, hybrids, varieties, and cultivars. Journal of Agricultural and Food Chemistry 2003; 51(16): 4563-4569.

(11)           Fayad NK., AL-Obaidi OHS., Al-Noor TH., Ezzat MO. Water and alcohol extraction of thyme plant (Thymus vulgaris) and activity study against bacteria, tumors and used as anti-oxidant in margarine manufacture. Innovation Union- European Commission 2013; 4(1): 41-51.

(12)           Yousuf PMH., Noba NU., Shohel M., BhattacherjeeR., Das B.K. Analgesic, anti-inflammatory and antipyretic effect of Mentha spicata (spearmint). British Journal of Pharmaceutical Research 2013; 3(4): 854-864.

(13)           Mohsenipour Z., Hassanshahian M. The inhibitory effect of Thymus vulgaris extracts on the planktonic form and biofilm structures of six human pathogenic bacteria. Avicenna Journal of Phytomedicine 2015; 5(4): 309-318.

(14)           White TC., Holleman S., Dy F., Mirels LF., Stevens DA. Resistance mechanisms in clinical isolates of Candida albicans. Antimicrobial Agents and Chemotherapy 2002; 46: 1704-1713.

(15)           Borecka-Melkusova S., Moran GP., Sullivan DJ., Kuchariova S., Chorvat Jr D., Bujdakva H. The expression of genes involved in the ergosterol biosynthesis pathway in Candida albicans and Candida dubliniensis biofilms exposed to fluconazole. Mycoses 2009; 52: 118-128.

(16)           Khodavandi A., Alizadeh F., Aghai Vanda N., Karimi G., Chong, PP. Possible mechanisms of the antifungal activity of fluconazole in combination with terbinafin against Candida albicans. Pharmaceutical Biology 2014; 52: 1505-1509.

(17)           Khodavandi A., Alizadeh F., Shahinipor M. Relative quantitation of hyphae-specific gene HWP1 expression in inhibition of Candida albicans biofilm. Journal of Microbial World 2016; 9 (1): 22-33.

(18)           Clinical and Laboratory Standards Institute (CLSI), Method for Antifungal Disk Diffusion Susceptibility Testing of Yeasts: Approved Guideline-Second ed. CLSI M44–A2.

(19)           Clinical and Laboratory Standards Institute (CLSI), Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts; Approved Standard-Third ed. CLSI M27–A3.

(20)           Giordani R., Regli P., Kaloustian J., Mikaïl C., Abou L., Portugal H. Antifungal effect of various essential oils against Candida albicans. Potentiation of antifungal action of amphotericin B by essential oil from Thymus vulgaris. Phytotherapy Research 2004; 18(12): 990-995.

(21)           Duarte MCT., Figueira G., Sartoratto A., Delarmelina G. Anti-Candida activity of Brazilian medicinal plants. Journal of Ethnopharmacology 2005; 97(2): 305-311.

(22)           Ghasemi Pirbalouti A., Bahmani M., Avijgan M. Anti-Candida activity of some of the Iranian medicinal plants. Electronic Journal of Biology 2009; 5(4): 85-88.

(23)           Sharanappa R., Vidyasagar GM. Anti-Candida activity of medicinal plants. a review. International Journal of Pharmacy and Pharmaceutical Sciences 2013; 5(4): 9-16.

(24)           Pinto E., Pina-Vaz C., Salgueiro L., Goncalves MJ. Costa-de-Oliveira S., Cavaleiro C., et al. Antifungal activity of the essential oil of Thymus pulegioides on Candida, Aspergillus and dermatophyte species. Journal of Medical Microbiology 2006; 55(Pt 10): 1367-1373.

(25)           Sanglard D., Ischer F., Parkinson T., Falconer D., Bille J. Candida albicans mutations in the ergosterol biosynthetic pathway and resistance to several antifungal agents. Antimicrobial Agents and Chemotherapy 2003; 47(8): 2404-2412.

(26)           Pam VK., Akpan JU., Oduyebo OO., Nwaokorie FO., Fowora MA., Oladele RO., et al. Fluconazole susceptibility and ERG11 gene expression in vaginal Candida species isolated from lagos Nigeria. International Journal of Molecular Epidemiology and Genetics 2012; 3(1): 84-90.

(27)           He X., Zhao M., Chen J., Wu R., Zhang J., Cui R., et al. Overexpression of both ERG11 and ABC2 genes might be responsible for itraconazole resistance in clinical isolates of Candida krusei. Public Library of Science One 2015; 10(8): e0136185.

(28)           Teymuri M., Mamishi S., Pourakbari B., Mahmoudi S., Ashtiani MT., Sadeghi RH., et al. Investigation of ERG11 gene expression among fluconazole-resistant Candida albicans: first report from an Iranian referral paediatric hospital. British Journal of Biomedical Science 2015; 72(1): 28-31.

(29)           Xu Y., Sheng F., Zhao J., Chen L., Li C. ERG11 mutations and expression of resistance genes in fluconazole-resistant Candida albicans isolates. Archives of Microbiology 2015; 197(9): 1087-1093.

(30)           Aslani P., Yadegari MH., Rajabi Bazl M. Investigation the effect of Echinophora platyloba and Satureja bachtiarica on MDR1 and ERG11 gene expression in fluconazole resistance clinical isolates Candida albicans using real time PCR. European Journal of Experimental Biology 2014; 4(1): 375-379.

(31)           Mosavinejad SR. Investigation the effect of Zataria multiflora and Dorma ammoniacum on MDR1 and ERG11 gene expression in fluconazole resistance clinical isolates Candida albicans. [Dissertation]. Tehran: Aja University of Medical Sciences; 2014.