تأثیر توکسین پاراسپورال باسیلوس تورنجینسیس بر تحریک تولید سایتوکاین‌های اینترلوکین-2 و اینترلوکین-5

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 دانشجوی کارشناسی ارشد میکروبیولوژی، واحد علوم و تحقیقات فارس، دانشگاه آزاد اسلامی، شیراز، ایران

2 استادیار میکروبیولوژی، گروه میکروبیولوژی، واحد شیراز، دانشگاه آزاد اسلامی، شیراز، ایران

3 استادیار ایمونولوژی، مرکز تحقیقات میکروب‌شناسی بالینی استاد البرزی، دانشگاه علوم پزشکی شیراز، شیراز، ایران

چکیده

مقدمه: باسیلوس تورنجینسیس باکتری گرم مثبت و بی‌هوازی اختیاری است که طی اسپورزایی، پروتئین پاراسپورال بلوری تولید می‌کند. اگرچه برخی از پروتئین‌های یادشده توانایی حشره‌کشی ندارند، برخی سلول‌های سرطانی را در انسان و حیوان نابود می‌کنند. هدف مطالعه حاضر، بررسی تأثیر پاراسپورال سیتوسیدال باسیلوس تورنجینسیس بر تحریک سلول‌های تک‌هسته‌ای خون محیطی و توانایی تولید سایتوکاین‌های اینترلوکین-2 و اینترلوکین- 5 است.
مواد و روش‏‏ها: توکسین باسیلوس تورنجینسیسبا ویژگی ضد سرطانی جداسازی و با آنزیم پروتیناز کا تیمار شد. سلول‌های تک‌هسته‌ای خون محیطی کشت و با پروتئین بلوری فعال‌شده تیمار شدند. تولید سایتوکاین‌ها با دستگاه فلوسیتومتری ارزیابی شد.
نتایج: در مطالعه حاضر، توکسین تحریک‌کننده سیستم ایمنی، کرای-1،شناسایی و باعث افزایش تولید سایتوکاین اینترلوکین-2 و توقف تحریک سایتوکاین مهاری اینترلوکین-5 شد.
بحث و نتیجه‏گیری: با توجه به ویژگی ضد سرطانی و تحریک‌کنندگی سیستم ایمنی توکسین باسیلوس تورنجینسیس، با مطالعه‌های بیشتر روی این توکسین می‌توان آن را داروی ایمنوتراپی در درمان سرطان پیشنهاد کرد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Effect of Bacillus thuringiensis parasporal toxin on stimulating of IL-2 and IL-5 cytokines production

نویسندگان [English]

  • Marzieh Soleimany 1
  • Elham Moazamian 2
  • Manoochehr Rasouli 3
1 MS.c of Microbiology, Department of Microbiology, Faculty of Science, Science and research branch, Islamic Azad University, Fars, Iran
2 Assistant Professor of Microbiology, Department of Microbiology, Shiraz Branch, Islamic Azad University, Shiraz, Iran
3 Assistant Professor of Immunology, Medical microbiology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran
چکیده [English]

Introduction:Bacillus thuringiensis, is a Gram-positive spore-forming bacterium that produces crystalline parasporal protein (Cry) during sporulation. Some of these Cry toxins do not show cytotoxicity against insects but they are capable to kill some human and animal cancer cells. The aim of this study was to verify whether cytocidal parasporal of B thuringiensis strains have immunostimulatory activity on human peripheral blood mononuclear cells (PBMNC) and to evaluate the ability of IL-2 and IL-5 production.
Materials and methods: B. thuringiensis toxin with cytocidal activity was isolated and treated with proteinase K. PBMNC was cultured and treated with activated crystal proteins. We evaluated the ability of different cytokines production with Flow Cytometry.
Results: In this study, immune stimulatory toxins Cry1 were distinguished. This toxin can stimulate production of cytokines IL-2 and stop production of IL-5.
Discussion and conclusion: According to anti-cancer effect of B. thuringiensis toxins and also immune stimulatory effect, with more research these toxins can be introduced as immunotherapy drug in cancer treatment.

کلیدواژه‌ها [English]

  • Bacillus thuringiensis
  • Crystal proteins
  • Immune system
  • Cytokines

مقدمه

باسیلوس تورنجینسیس، باکتری گرم مثبت، بی‌هوازی اختیاری و تولید‌کننده اسپور است. این موجود، پروتئین‌های سمی حشره‌کش را در بلورهای پاراسپورال طی مرحله اسپورزایی تولید می‌کند. ژن‌های کدکننده پروتئین‌های کرای[1] بیشتر روی پلاسمید قرار دارند و اندازه آنها بین 4-3 تا 150 مگادالتون متغیر است. تاکنون بیش از 100 ژن کرای تعیین توالی و به‌تازگی، بر اساس شباهت نوکلئوتیدی و محدوده اختصاصیت میزبان در 53 گروه مختلف دسته‌بندی شده‌اند.

در مطالعه‌های اخیر، تعداد بسیاری از سویه‌های باسیلوس تورنجینسیس جداسازی شده‌اند که ویژگی حشره‌کشی ندارند و پراکندگی آنها از باسیلوس تورنجینسیس‌های حشره‌کش بیشتر است (1). در سال 1999، برای نخستین بار میزوکی[2] دانشمند ژاپنی سویه‌هایی از باسیلوس تورنجینسیس را جداسازی کرد که توکسین آنها غیرهمولیتیک بود اما ویژگی سیتوسیدالی علیه سلول‌های سرطانی انسان داشتند. در سال 2006 نیز سایتو[3] و همکاران با بررسی تأثیر پروتئین بلوری روی رده سلول‌های خون انسانی گزارش کردند که پروتئین بلوری فعالیت سیتوسیدالی قوی در برابر سلول‌های ویژه انسانی دارد. این توکسین به سطح سلول‌های سرطانی مستعد اتصال می‌یابد و به سلول‌های سالم متصل نمی‌شود (2 و 3). اگرچه اثر مستقیم توکسین بلوری باسیلوس تورنجینسیس روی سلول‌های سرطانی گزارش شده، تاکنون مطالعه‌ای درباره واکنش ایمنی آن انجام نشده است. در پژوهش حاضر، تأثیر توکسین باسیلوس تورنجینسیس با ویژگی سیتوسیدالی روی رده سلولی سرطان سینه بر تحریک تولید دو سایتوکاین اینترلوکین-2 و اینترلوکین-5 سیستم ایمنی ارزیابی شد.

 

مواد و روش‌ها

تهیه سویه باسیلوس مؤثر بر سلول‌های سرطانی: در پژوهش حاضر با توجه به مطالعه‌های پیشین، جدایه باسیلوس تورنجینسیس به نام Goh1 با ویژگی سیتوسیدالی روی رده سلولی سرطان سینه از بخش میکروب‌شناسی دانشگاه آزاد اسلامی واحد پردیس شیراز تهیه شد. رنگ‌آمیزی گرم، رنگ‌آمیزی توکسین و شناسایی ژنوتیپی با واکنش زنجیره‌ای پلیمراز (4 و 5) برای تأیید جدایه مدنظر انجام شدند.

رنگ‌آمیزی توکسین بلوری: برای مشاهده توکسین بلوری باکتری، رنگ‌آمیزی توکسین باکتری پس از کشت باکتری در محیط نوترینت آگار در دمای 27 درجه سانتی‌گراد و ورود به مرحله اسپورزایی انجام شد. در این روش، نمونه باکتری روی لام شیشه‌ای تثبیت و رنگ‌آمیزی با محلول حاوی رنگ 133/0 درصد بریلینت‌آبی[4]حل‌شده در استیک‌اسید 50 درصد انجام می‌شود. توکسین بلوری پس از مرحله شست‌وشو با آب مقطر در بزرگنمایی 100 میکروسکوپ نوری مشاهده شد (6 و 7).

شناسایی مولکولی: استخراج DNA با استفاده از کیت ویژه استخراج DNA ژنوم باکتریایی طبق دستور‌عمل شرکت سازنده (یکتا طب تجهیز، ایران) انجام شد. برای انجام واکنش زنجیره‌ای پلیمراز با حجم 25 میکرولیتر، 18 میکرولیتر آب مقطر استریل، 2/5 میکرولیتر بافر PCR با غلظت 10 برابر (سیناژن، ایران)، 75/0 میکرولیتر کلرید‌منیزیم (سیناژن، ایران) با غلظت 10 میکروگرم بر میکرولیتر، 5/0 میکرولیتر dNTP (سیناژن، ایران) با غلظت میکروگرم بر میکرولیتر، 1 میکرولیتر از پرایمرهای رفت و برگشت با غلظت 10 پیکومول بر میکرولیتر (جدول 1)، 25/0 میکرولیتر آنزیم پلیمراز (سیناژن، ایران) و 1 میکرولیتر DNA الگو با غلظت 10 میکروگرم بر میکرولیتر مخلوط شدند. برای آغاز فرایند پلیمریزاسیون در این روش، دستگاه ترمال سیکلر بیوراد[5] به مدت 1 دقیقه روی دمای 94 درجه سانتی‌گراد تنظیم شد و سپس، 35 چرخه PCR به‌شکل 94 درجه سانتی‌گراد برای 1 دقیقه، 54 درجه سانتی‌گراد برای 30 ثانیه و 72 درجه سانتی‌گراد برای 1 دقیقه اجرا شد. در پایان، عمل طویل‌سازی نهایی به مدت 4 دقیقه در 72 درجه سانتی‌گراد انجام شد. برای اطمینان از تکثیر ژن 16S rDNA، الکتروفورز روی ژل آگارز 1 درصد حاوی بافر TBE 1X به مدت 60 دقیقه در ولتاژ 90 ولت انجام و از دستگاه UV ترانس لومیناتور برای مشاهده نتایج ژل استفاده شد (8). در پایان، محصول PCR برای تعیین توالی به شرکت ماکروژن کره جنوبی فرستاده شد. نتایج تعیین توالی با استفاده از نرم‎افزار بلاست[6] BLAST همولوژی تحلیل شدند.

 

جدول 1- توالی پرایمرهای ژن‌های پاراسپورین باسیلوس تورنجینسیس (9)

نام ژن

پرایمر رفت

پرایمر برگشت

پاراسپورین 1

ATCAAGAATTTTCCGATAATC

CCAAAAGTGCCAGAATG

پاراسپورین 4

AGTGGTCTCCAGGCTCATACTGG

TGATATTCCCGAACCTGCCCT

کرای 1

CATGATTCATGCGGCAGATAAAC

TTGTGACACTTCTGCTTCCCATT

 

جداسازی و فعال‌سازی پروتئین بلوری: برای استخراج پروتئین باسیلوس تورنجینسیس، کشت‌های اسپورزای باکتری جمع‌آوری و در نمک طعام 1 مولار حاوی 1/0 درصد تریتون[7] X-100 حل و سپس سه مرتبه با آب مقطر استریل شست‌وشو شدند. برای خالص‌سازی پروتئین بلوری، مخلوط اسپور و پروتئین در محلول حاوی 50 میلی‌مولار کربنات‌سدیم با اسیدیته همراه با 10 میلی‌مولار دی‌تیوتریتول[8] و اتیلن‌دی‌آمین‌تترا‌استیک‌اسید[9] 1 میلی‌مولار به مدت 1 ساعت در 37 درجه سانتی‌گراد درون انکوباتور شیکردار گرمخانه‌گذاری شد و سپس به مدت 20 دقیقه در 4 درجه سانتی‌گراد با دور rpm16000 سانتریفوژ شد. از دستگاه نانودراپ برای تعیین غلظت توکسین بلوری استفاده شد (2 و 10).

پروتئین جداسازی‌شده با آنزیم پروتئیناز کا با غلظت 300 میلی‌گرم بر میلی‌لیتر تیمار و 90 دقیقه در دمای 37 درجه سانتی‌گراد گرمخانه‌گذاری شد. برای توقف فعالیت پروتئازی از محلول فنیل‌متیل‌سولفونید‌فلوراید[10] 1 میلی‌مولار استفاده شد (3).

جداسازی و کشت رده سلول‌های تک‌هسته‌ای: برای جداسازی سلول‌های تک‌هسته‌ای از خون، 10 میلی‌لیتر خون انسانی حاوی ماده ضد انعقاد هپارین تهیه و سپس 5 میلی‌لیتر نرمال‌سالین سرد به آن اضافه و به‌آرامی مخلوط شد، به‌طوری که خون لیز نشود. فایکول در لوله سانتریفیوژ تمیزی ریخته و 8 تا 10 میلی‌لیتر خون رقیق‌شده با نرمال‌سالین سرد به‌آرامی به آن افزوده شد. سپس لوله حاوی فایکول و خون 20 دقیقه در دور rpm14000 سانتریفیوژ شد و لایه حاوی سلول‌های تک‌هسته‌ای که بین فایکول در زیر و نرمال‌سالین در بالاست، با پییت شارژی جدا و به لوله تمیزی منتقل شد. سلول‌های تک‌هسته‌ای دو بار با نرمال‌سالین شسته و پس از آخرین شست‌وشو به حجم 1 میلی‌لیتر رسانده شدند و سپس 1 قطره از آن برای شمارش استفاده شد. در ادامه، سلول‌ها در محیط‌کشت آر‌پی‌ام‌آی 1640[11] حاوی 10 درصد آلبومین سرم گاوی، 2 میلی‌مولار ال-گلوتامین، 100 میکروگرم در میلی‌لیتر استرپتومایسین و 100 میکروگرم در میلی‌لیتر پنی‌سیلین کشت داده شدند (9 و 10).

.تیمار سلول‌های تک‌هسته‌ای با توکسین فعال‌شده: برای بررسی میزان تحریک سیستم ایمنی و اندازه‌‌گیری تولید سایتوکاین‌های مختلف، ابتدا سلول‌های تک‌هسته‌ای کشت داده شدند و 9 میکرولیتر محیط‌کشت حاوی تعداد 105×2 سلول در هر پلیت 96 خانه‌‌ای اضافه شد. سپس دوزهای مختلف توکسین با غلظت‌های 10 و 50 میکروگرم بر میلی‌لیتر به سلول‌ها اضافه شدند (8). در این آزمایش، سلول‌های فاقد توکسین برای شاهد منفی و میتوژن داینابید برای شاهد مثبت استفاده و نتایج با دستگاه فلوسیتومتری تحلیل شدند. برای اندازه‌گیری مقدار تحریک سایتوکاین‌های سیستم ایمنی و تأثیرگذاری توکسین‌های باسیلوس تورنجینسیس از کیت (Multi Analyte flow Assay kit – LEGEND Plex TM) ساخت کشور آمریکا بر اساس پروتکل تعریف‌شده آن استفاده شد و داده‌ها با نرم‌افزار کیت بیوساینس[12] تحلیل شدند.

 

نتایج

تعیین ویژگی‌های فنوتیپی باسیلوس تورنجینسیس: بر اساس مشاهده‌های ماکروسکوپی، باکتری باسیلوس تورنجینسیس دارای کلنی کوچک تا بزرگ، سفیدرنگ مایل به کرم، برجسته، گرد و مات شبیه به تخم‌مرغ نیمرو است. در مشاهده‌های میکروسکوپی، باسیل گرم مثبت و حاوی توکسین بلوری بیضی‌شکل چسبیده به اسپور مشاهده شد. در شکل 1، کلنی باسیلوس تورنجینسیس، رنگ‌آمیزی گرم و رنگ‌آمیزی توکسین بلوری دیده می‌شوند.

شکل 1- سمت راست. کلنی باسیلوس تورنجینسیس، وسط. ساختار باکتری، سمت چپ. ساختار توکسین بلوری. توکسین تیره و اسپور شفاف دیده می‌شوند.

تعیین ویژگی‌های مولکولی باسیلوس تورنجینسیس: نتیجه شناسایی مولکولی نمونه باکتری باسیلوس تورنجینسیس در پژوهش حاضر مشخص کرد که نمونه Goh1 دارای پروتئین بلوری کرای-1 است. در شکل 2، نتایج ژل الکتروفورز دیده می‌شوند. بر اساس پرایمر استفاده‌شده، باند با اندازه 280 جفت باز حاصل شد و نتایج تعیین توالی ژن کرای-1 باسیلوس تورنجینسیس را تأیید کرد.

شکل 2- تصویر ژل الکتروفورز ژن کرای-1. ستون اول. نشانگر 100 جفت بازی شرکت سیناژن، ستون دوم. نمونه Goh1 است که دارای باند 278 جفت بازی و نشان‌دهنده حضور ژن کرای-1 است.

تیمار سلول‌های تک‌هسته‌ایبا توکسین باسیلوس تورنجینسیس در شرایط آزمایشگاهی: توکسین جدایهGoh1  باسیلوس تورنجینسیس با غلظت 10 و 50 میکروگرم بر میلی‌لیتر به سلول‌های تک‌هسته‌ای اضافه شد و نتایج با دستگاه فلوسیتومتری خوانده شدند. نتایج حاصل از فلوسیتومتری با نرم‌افزار بیوساینس محاسبه و برای تحلیل آماری داده‌ها از نرم‌افزار اس‌پی‌اس‌اس[13] نسخه 21 و آزمون کراس‎کالوالیس Kruskal walis استفاده شد. نتایج نشان دادند که بیشترین قدرت تحریک توکسین جداسازی‌شده از نمونه Goh1 در غلظت 50 میکروگرم بر میلی‌لیتر بوده و حتی محرک بسیار قوی‌تری نسبت به شاهد مثبت دینابید در تولید اینترلوکین-2 است. با توجه به تحلیل واریانس انجام‌شده (003/0P=  و 111/6 F=) با ضریب اطمینان 95 درصد، نتایج (شکل 3) از نظر آماری معنادار خواهند بود.

توکسین بلوری نمونه، توانایی تحریک تولید سایتوکاین اینترلوکین-5 را در دو غلظت 10 و 50 میکروگرم بر میلی‌لیتر نداشت و با توجه به تحلیل واریانس انجام‌شده (00/0P=  و 111/6F=) با ضریب اطمینان 95 درصد، نتایج (شکل 4) از نظر آماری معنادار نیستند.

 شکل 3- نمودار تحریک تولید اینترلوکین-2 توسط توکسین بلوری جدایه Goh1

شکل 4- نمودار تحریک تولید اینترلوکین-5 توسط توکسین کریستالی ایزوله Goh1

بحث و نتیجه‌گیری

استفاده از ایمنی‌درمانی یا ایمونوتراپی در درمان سرطان یکی از روش‌های مطالعه‌شده، مؤثر و متمرکز بر تقویت سیستم ایمنی است؛ تقویت سیستم ایمنی موجب کاهش رشد و جلوگیری از گسترش سلول‌های سرطانی می‌شود. درمان‌های حاضر برای سرطان بیشتر با داروهایی انجام می‌شوند که سلول‌های سرطانی را می‌کشند یا از تقسیم آنها جلوگیری می‌کنند؛ این درمان‌ها، آثار جانبی شدیدی روی سلول‌های سالم دارند و در نتیجه، درمان سرطان با ناخوشی و مرگ‌ومیر درخور توجهی همراه است (11). ایمنی‌شناسان امیدوارند که بیماران مبتلا به سرطان را با راهکارهای ایمونولوژیک درمان کنند، زیرا ممکن است پاسخ‌های ایمنی ضد توموری ویژه آنتی‌ژن‌های توموری باشند و به سلول‌های طبیعی آسیب نرسانند. ایمونوتراپی، ویژه‌ترین روش درمان ضد سرطان است. با وجود اهمیت زیاد سیستم ایمنی در پاسخ به درمان سرطان، تاکنون گزارشی درباره چگونگی تحریک سیستم ایمنی با توکسین بلوری باسیلوس تورنجینسیس ثبت نشده است. اگرچه درمان با آنتی‌ژن‌های تحریک‌کننده سیستم ایمنی برای بسیاری از سرطان‌ها مفید است، هنوز مطالعه بیشتری در این زمینه نیاز است. فعال‌کردن سلول‌های سیستم ایمنی در بدن و استفاده از آنها در برابر سلول‌های سرطانی، ابزار بهتری برای شکست سرطان است. در آینده، ایمنی‌درمانی بخشی از درمان سرطان خواهد بود و بنابراین، مهم است که پژوهشگران بهترین شیوه‌های ایمنوتراپی را برای مبارزه با سرطان استفاده کنند (12).

در بررسی سایتوکاین‌ها و نقش آنها در درمان سرطان، دسته‌بندی سایتوکاین‌های درمانی و سایتوکاین‌های خون‌ساز وجود دارد. سایتوکاین‌های درمانی شامل سایتوکاین‌هایی هستند که تزریق آنها به بیمار باعث تقویت سیستم ایمنی ذاتی یا اکتسابی در رویارویی با سلول‌های توموری می‌شود. بیشتر این سایتوکاین‌ها به‌طور طبیعی از سلول‌های T در بدن ترشح می‌شوند و تزریق سیستمیک آنها به بیمار باعث تحریک راه‌اندازی مسیرهای کمکی سلول‌های T یا سلول‌های عرضه‌کننده آنتی‌ژن می‌شود (12 و 13).

اینترلوکین-2، سایتوکاین درمانی و از خانواده سایتوکاین‌های مرتبط با عوامل رشد سلول T است که روی سلول‌هایNK ، TCD8 و TCD4 اثر می‌گذارد و سیستم ایمنی را به سمت Th1[xiv] سوق می‌دهد. اثر این سایتوکاین در درمان کارسینوم ملانوما اثبات شده است؛ تزریق دوز زیاد آن در 15 تا 20 درصد بیماران در مرحله پیشرفته ملانوما تأثیرگذار بود (14). همچنین، این سایتوکاین در درمان سرطان کلیه و روده نیز کاربرد و آثار ضد رگ‌زایی و ضد التهابی دارد (12 و 15). در پژوهش حاضر نیز توکسین باسیلوس تورنجینسیس، سایتوکاین اینترلوکین-2 را تحریک کرد.

برخی سایتوکاین‌ها در سرطان پروتوموری یا توموروژنیک دخالت دارند یا مانع فعالیت‌های ضد توموری سیستم ایمنی می‌شوند. فعال‌شدن یا مهار سلول‌های T به نوع و میزان سایتوکاین‌های تولید‌شده در محیط پیرامون تومور بستگی دارد (16). سایتوکاین اینترلوکین-5 ازجمله سایتوکاین‌های مهاری است که باعث سرکوب فعالیت سایتوکاین‌های ضد توموری می‌شود. اینترلوکین-5 نیز مانند اینترلوکین-10، فعالیت متضاد با اینترفرون گاما دارد و جز سایتوکاین‌های با راهبرد مهاری است (12). خوشبختانه در پژوهش حاضر، افزایش تحریک تولید این سایتوکاین مهاری به‌وسیله توکسین باسیلوس تورنجینسیس مشاهده نشد. با توجه به ویژگی‌های منحصر‌به‌فرد توکسین باسیلوس تورنجینسیس و همه‌گیری سرطان در جهان و همچنین تمایل بشر به درمان‌های زیستی و کم‌خطر، امید است که با گسترش فهم ما از ایمونوبیولوژی و ترسیم نقش هر یک از سلول‌های ایمنی، پژوهش‌های آتی در این زمینه به سمت استفاده بشر و کمک به بالابردن سطح بهداشت عمومی پیش روند.



[1]- Cry

[2]- Mizuki

[3]- Cyto

[4]- Brilliant blue

[5]- BioRAD

[6]- BLAST

[7]- Triton

[8]- DTT (Dithiothritol)

[9]- EDTA (Ethylendiaminetetraacetic acid)

[10]- Phenyl methylsulfonyl fluoride

[11]- Roswell Park Memorial Institude Medium (RMPI)

[12]- Bioscience

[13]- SPSS

[xiv]- T Helper (Th)

 

(1)              Johnson DE., Oppert B., Mc-Gaughey WH. Spore coat protein synergies Bacillus thuringiensis crystal toxicity for the Inddianmeal moth (Plodia interpunctella). Current Microbiology 1998; 36(5): 278-282.

(2)              Mizuki E., Park YS., Saitoh H., Yamashita S., Akao T., Higuchi K., et al. Parasporin, a human leukemic cell-recognizing parasporal protein of Bacillus Thuringiensis. Clinical and Diagnostic Laboratory Immunology 2000; 7(4): 625-634.

(3)              Katayama H., Kusaka Y., Yokota H., Akao T., Kojima M., Nakamura O., et al. Parasporin1, a novel cytotoxic protein from Bacillus thuringiensis, Induces Ca2+ influx and a sustained elevation of the cytoplasmic Ca2+ concentration in toxin-sensitive cells. Journal of Biological Chemistry 2007; 282(10): 7742-7752.

(4)              Sambrok J., Russel DW. Molecular Cloning: A Laboratory Manual. 6th ed. New york: Cold Spring Harbor Laboratory Press; 2001.

(5)              Dahpahlevan S., Khara J., Mousivand M., Hashemi M. Determination and modeling the optimum conditions of beta glucanase Bacillus subtilis B5d activity with potential used as feed additive. Biological Journal of Microorganism 2016; 5(17): 1-14.

 

(6)              Ammons D. Usefulness of staining parasporal bodies when screening for Bacillus thuringiensis. Journal of Invertebrate Pathology 2002; 79: 203-204.

(7)              Babolmorad G., Emtiza G. Study of the surface layer and parasporal body of Bacillus thuringiensis Israelensis (MH14) and prediction of Cry4Ba stabilization by point mutation method based on bioinformatics findings. BJM. 2015; 4(14): 153-166.

(8)              Rampersad J., Ammons D. Bacillus thuringiensis isolation method utilizing a novel stain, low selection and high throughput produced atypical results. BMC Microbiology 2005; 24: 5-52.

(9)              Lenina NK., Naveenkumar A., Sozhavendan AE., Balakrishnan N., Balasubramani V., Udayasuriyan V. Characterization of parasporin gene harboring Indian isolates of Bacillus thuringiensis. Biotech 2014; 4(5): 545-551.

(10)          Moazamian E., Bahador N., Rasouli M., Azarpira N., Kalani M. Investigation of cytocidal activity of Bacillus thuringiensis parasporal toxin on CCRF-CEM cell line. Journal of Fasa University of Medical Sciences 2012; 2(4): 247-253.

(11)          Guerrero GG., Russell MW., Moreno-Fierros L. Analysis of the cellular immune response induced by Bacillus thuringiensis Cry1A toxins in mice: Effect of the hydrophobic motif from diphtheria toxin. Molecular Immunology 2007; 44(6): 1209-1217.

(12)          Pak F., Shokroallahi M., Barati M., Kokhaei PV. Tumor immunotherapy, history and achievements. Mazandaran University of Medical Sciences 2015; 25(128): 120-143.

(13)          Zou W. Regulatory T cells, tumor, immunity and immune therapy. Nature Reviews Immunology 2006; 6: 295-307.

(14)          Dranoff G. Cytokines in cancer pathogenesis and cancer therapy. Natural Review Cancer 2004; 4(1): 11-22.

 

(15)          Salekmoghdam A. Application of immunotherapy in cancer treatment. Razi Medical Science Journal 1994; 1(3): 162-170.

(16)          Devisser K., Eichten A., Paradoxiocal roles of the immune system during cancer development. Nature Reviews cancer 2006; 6: 24-37.