ارزیابی رنگ‌زدایی زیستی ترکیبات رنگی آزو توسط آرکی‌های نمک‌دوست

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 دانشجوی کارشناسی ارشد میکروبیولوژی، دانشگاه تهران، تهران، ایران

2 استاد میکروبیولوژی، دانشگاه تهران، ایران

3 استادیار بیوتکنولوژی، پردیس علوم، دانشگاه تهران، ایران

چکیده

مقدمه: رنگ‌های آزو بزرگ‌ترین گروه رنگی را تشکیل می‌دهند که وجود پیوندهای N = N متصل به گروه‌های آروماتیک، از ویژگی‌های بارز این رنگ‌ها است. تاکنون مطالعات زیادی در رنگبری زیستی توسط میکروارگانیسم‌ها صورت گرفته است؛ اما مطالعۀ رنگبری توسط آرکی‌های نمک‌دوست برای اولین بار گزارش شده است.‏‏
مواد و روش‏‏ها: از میان 15 سویۀ جداشده از غارنمکی قشم ایران و7 سویۀ تایپ نگهداری‌شده در مرکز ملی ذخایر ژنتیکی و زیستی ایران، 2 سویه توانایی بالایی در رنگبری از رنگ‌های آزو را از خود نشان دادند. اثر فاکتورهای مختلف شامل ) pH9-5 (، دمای) 50-30)، غلظت نمک (30-5/12درصد)، غلظت‌های مختلف رنگ (5000-400 میلی‌گرم بر لیتر)، منابع کربن و نیتروژن و هوادهی مختلف در این دو سویۀ منتخب پس از چهار روز گرماگذاری در شرایط ایستا بررسی شد. همچنین اثر سمیت رنگ بر آرکی‌ها انجام شد. هم‌زمان با میزان رنگبری، رشد نیز سنجیده شد. از آزمون آماری آنوا به‌منظور مشخص‌کردن اختلاف معنادار استفاده شد. ‏‏
نتایج: سویۀ A با درصد شباهت 1/99 بهborinquense Halogeometricum و سویۀ B با درصد شباهت 4/99 بهHaloferax mediterranei بهترین سویه‌های رنگبر بودند. هر دوی سویه‌ها در NaCl بین 15 تا 5/17درصد، pH 7، شرایط ایستا و بهترین رنگبری را در حضور عصاره مخمر به‌عنوان منبع نیتروژن داشتند. اگرچه بررسی‌ها در دمای 45 درجه و منبع کربن ساکارز و گلوکز برای borinquense Halogeometricum بیشترین رنگبری را نشان می‌داد؛ Haloferax mediterranei  بهترین رنگبری را در دمای40 درجه و منبع کربن‌پروپیونیک‌اسید داشت. هر دو سویه در غلظت‌های حدود 1000 میلی‌گرم بر لیتر قابلیت رنگبری داشتند و تا غلظت 5000 میلی‌گرم بر لیتر رنگ را تحمل می‌کردند.‏
بحث و نتیجه‏گیری: نتایج به‌دست‌آمده نشان داد که آرکی‌های نمک‌دوست توانایی زیادی در رنگبری دارند. با توجه به شوری پساب‌های نساجی، استفاده از این میکروارگانیسم‌ها مهم به نظر می‌رسد.‏‏

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Evaluation of biodecolorization of the textile azo dye by halophilic archaea

نویسندگان [English]

  • Masoomeh Selseleh Hassan-Kiadehi 1
  • Mohammad Ali Amoozegar 2
  • Sedigheh Asad 3
1 MSc of Microbiology, University of Tehran, Tehran, Iran
2 Professor of Microbiology, University of Tehran, Tehran, Iran
3 Assistant professor of Biotechnology, University of Tehran, Tehran, Iran
چکیده [English]

Introduction: Azo dyes are the biggest group of colors. One of the special characteristic of this group of dye is the presence of double bonds of Nitrogen (N=N). Several studies reported biodecolorization using microorganisms, so far. However, it is for the first time to our knowledge that decolorization by halophilic archaea have been reported.
Materials and methods: Among the 15 strains of archaea isolated from Qeshm saline cave and 7 type strains from Iranian biological resource center, 2 strains showed high ability in decolorization of azo dye. Effects of different factors including pH (5-9), temperature (30-50 °C), various salt concentrations (12.5-30%), different concentrations of dye (400-5000 mg/L), different carbon sources and several nitrogen sources and agitation have been measured after 4 days of incubation in static condition. Moreover, the toxicity tolerance of halo archaeal strains to dye, growth and decolorization rates were studied. Statistical significance was assessed by ANOVA Tukey’s multiple comparison test.
Results: Strain A with 99.1 % similarity to Halogeometricum borinquense and strain B with 99.4 % similarity to Haloferax mediterranei were the best decolorizing strains. Both strains had their highest decolorization rate in the presence of NaCl (15-17.5 %), pH 7, microaerophilic condition and yeast extract as nitrogen source. Halogeometricum borinquense showed higher decolorization rate in the presence of saccharose and glucose as carbon sources at 45 oC temperature and for Haloferax mediterranei temperature of 40 oC and propionic acid as carbon source were best decolorizing conditions. These strains were able to decolorize dyes at 1000 mg/L concentration and tolerate dye concentrations to the highest level of 5000 mg/L.
Discussion and conclusion: In conclusion, our results indicate that halophilic archaea have very high potential to decolorize azo dyes. Regarding high amounts of salts in textile wastewaters, using such microorganisms which can tolerate the harsh environment in order to decolorize azo dyes, could be a new approach in this field.

کلیدواژه‌ها [English]

  • Azo dyes
  • halophilic archaea
  • decolorization
  • Haloferax mediterranei
  • Halogeometricum borinquense

مقدمه.

رنگ‌های آزو با پیوند دوگانۀ نیتروژن متصل به گروه‌های آروماتیک، شناخته می‌شوند (1). دست‌کم 3000 نوع رنگ آزو در صنایع نساجی، کاغذ، غذایی، آرایشی و دارویی استفاده می‌شوند. از میان کاربردهای متنوع رنگ‌های سنتتیک، سالیانه بیش از 30000 تن مواد رنگی مختلف در جهان تولید می‌شوند که در میان آنها رنگ‌های آزو بیش از 60درصد رنگ‌ها را در کارخانه‌ها تشکیل می‌دهند (2). رنگ‌ها براساس کاربرد و ساختار شیمیایی دسته‌بندی می‌شوند. آنها حاوی کروموفور و اگزوکروم هستند. کروموفورها به گروه‌هایی از اتم‌ها گفته می‌شود که عامل رنگی، رنگ‌ها هستند. اگزوکروم‌ها شامل یک الکترون کشنده و یک دهندۀ الکترون هستند که موجب افزایش رنگ کروموفور می‌شوند. از مهم‌ترین کروموفورها، آزو (-N=N-)، کربونیل (C=O-)، متین (C=H)، نیترو (-NO2) و رنگ‌های کوئینوئیدی می‌توان اشاره کرد و از مهم‌ترین اگزوکروم‌ها، آمین (-NH3)، کربوکسیل (-COOH)، سولفونات (-SO3H) و هیدروکسیل (-OH) هستند (3). روزانه مقادیر زیادی از این رنگ‌ها درنتیجۀ فعالیت‌های مختلف صنعتی (به‌ویژه کارخانه‌های نساجی) وارد پساب‌ها می‌شوند که این رنگ‌ها بر منابع آبی، خاک و ارگانیسم‌ها آثار مخرب می‌گذارند (4). در طول فرآیند رنگرزی همۀ رنگ‌ها به فیبرها وصل نمی‌شود و مقداری از رنگ‌ها در حمام رنگ باقی می‌ماند؛ به‌طوری که 20درصد رنگ‌های اسیدی، 30درصد رنگ‌های مستقیم و 50درصد رنگ‌های راکتیو در پساب‌ها آزاد می‌شوند (5). مقدار رنگی که استفاده شده ناچیز است؛ ولی مشکل اصلی پایداری این رنگ‌ها در پساب‌هاست که درنتیجه با داشتن یک یا چند گروه سولفونیک‌اسید در حلقۀ آروماتیک آنها باعث مهار رشد یا مهار سنتز اسیدهای نوکلئوتید می‌شوند (6). مقاومت رنگ‌های آزو به‌دلیل وجود پیوند شدیداً الکترون‌کشندۀ آزو به اکسیژنازها و وجود گروه‌های آروماتیکی بزرگ متصل به پیوند آزو است (1). میزان رنگ‌زدایی به نوع، وزن مولکولی و گروه‌های جانشین رنگ بستگی دارد. ترکیبات آزو با گروه‌های هیدروکسی و آمینو نسبت به متیل، متوکسی، سولفور و نیترو بیشتر تمایل به تخریب دارند (7). روش‌های تیمار آنزیمی و میکروبی، به‌منظور رنگبری و تجزیۀ رنگ‌ها، نسبت به روش‌های فیزیکی و شیمیایی، از امتیازات بالایی برخوردار است؛ از آن جمله می‌توان به موارد زیر اشاره کرد: 1. قیمت پایین؛ 2. تولید لجن با مقدار کم؛ 3. تولید محصولات فاقد سمیت؛ 4. سازگار با طبیعت؛ 5. نیاز به آب کمتر در پاک‌سازی در مقایسه با روش‌های فیزیکی شیمیایی (8). باکتری‌ها، قارچ‌ها، جلبک‌ها، اکتینومیست‌ها، مخمرها و گیاهان، میکروارگانیسم‌هایی هستند که تاکنون رنگبری در آنها مطالعه شده است (2). نمک‌های مختلفی در صنعت نساجی به کار می‌روند، به‌طور عمومی کارخانه‌های نساجی در استفاده از رنگ‌های راکتیو، غلظتی حدود 100-60 گرم بر لیتر نمک به کار می‌برند، درنتیجه میکروارگانیسم‌ها باید قابلیت تحمل این شرایط نمکی را به‌منظور فرآیند رنگبری داشته باشند (9). نخستین مطالعات بر توانایی رنگبری در نمک‌دوست‌ها و تحمل‌کنندۀ آن بر گونه‌های جنس Halomonas انجام گرفته است (10). هدف این پژوهش، مطالعۀ توانمندی آرکی‌های نمک‌دوست در رنگبری رنگ آزو به‌منظور استفاده از آنها در پاک‌سازی پساب‌های نساجی است.

 

‏‏مواد و روش‏ها.

مواد شیمیایی استفاده‌شده: نمک‌ها و مواد استفاده‌شده از شرکت مرک[1] خریداری و رنگ‌ها از شرکت سیبا[2] تهیه شدند.

سویه‌های میکروبی، جداسازی و خالص‌سازی: از مجموع 22 سویه، 15 سویه جداشده از مناطق پرشور ایران و7 سویه تایپ نگهداری‌شده در مرکز ملی ذخایر ژنتیکی ایران هستند.

به‌منظور جداسازی آرکی‌های نمک‌دوست، نمونه‌برداری از مناطق پرشور ایران صورت گرفت. برای غربالگری تلقیح نمونۀ آب به دو صورت مستقیم و سانتریفوژشده و نمونه‌های رسوب و نمک با تهیۀ سریال رقت تا رقت7 10 بر محیط ­MGM با 23درصد نمک (در یک لیتر آب مقطر: NaCl 9/183گرم؛ MgCl2 29/2 گرم ؛ MgSO4 68/2 گرم؛ KCl  36/5 گرم؛ پپتون 1گرم، عصارۀ مخمر 2/0 گرم) انجام گرفت. pH نمونه با Tris یک مولار روی 2/7 تنظیم و در انکوباتور با دمای 40 درجه سانتیگراد برای یک ماه گرماگذاری شدند و بعد از یک ماه به محیط جدید MGM دارای 23درصد نمک انتقال داده شد و تا خالص‌شدن آنها این کار ادامه پیدا کرد.

شناسایی مولکولی سویه‌های میکروبی: شناسایی سویه‌ها، از طریق توالی ژن 16S rRNA، DNA کلنی‌های تازه‌رشدکرده بر محیط MGM با استفاده از روش تغییریافتۀ مارمور[3]، استخراج شد (11). تأیید استخراج DNA، از طریق بارگذاری 10درصد از نمونه همراه با رنگ (با نسبت 6 به 1) بر ژل آگاروز (7/0درصد) در دستگاه الکتروفورز افقی انجام شد. برای انجام واکنش زنجیره‌ای پلیمراز[4]، از پرایمرهای 5' TCCGGTTGATCCTGCCG 3' 20F و 5' AGGATCAAGTGTCCGGGTGCG 3' 1530R برای آرکی‌ها استفاده شد. واکنش زنجیره‌ای پلیمراز در سویه‌های جداسازی‌شده، به این روش صورت گرفت: واسرشت‌سازی اولیه به‌مدت 3 دقیقه در دمای 94 درجه سانتیگراد انجام و سپس، مرحلۀ تکثیر آغاز شد که شامل 30 چرخۀ تکرارشونده با دمای دناتوراسیون 94 درجه سانتیگراد به‌مدت 15 ثانیه، دمای اتصال 51 درجه سانتیگراد به‌مدت 30 ثانیه و دمای سنتز 72 درجه سانتیگراد به‌مدت 52 ثانیه بود. درانتها، به‌منظور تکمیل نهایی ساختارهای تکثیرشده، یک مرحله سنتز به‌مدت 7 دقیقه در دمای 72 درجه سانتیگراد، به مراحل افزوده شد. پس از تکثیر توالی موردنظر با استفاده از پرایمرهای استفاده‌شده، نمونۀ محصول PCR برای تعیین توالی به شرکت Bioneer در کره، فرستاده شد و توالی‌های به‌دست‌آمده با نرم‌افزار Chromas Proبررسی و با توالی‌های ثبت‌شده در پایگاه اطلاعات ژنومیEzTaxon مقایسه شد و میزان شباهت آن با سویه‌های مختلف ثبت‌شده، تعیین و برای بررسی‌های بعدی ذخیره گردید.

بررسی اولیۀ رنگبری: ابتدا رنگبری 22 سویه بر رنگ Remazol black B انجام شد سپس بعد از انتخاب چهار سویه با بیشترین رنگبری، بررسی رنگبری بر رنگ مونو آزو Acid blue 161 انجام شد و درنهایت دوسویه با بیشترین رنگبری انتخاب شدند. میزان رنگ حذف‌شده از محیط طی یک هفته به‌روش اسپکتروفتومتری شیمادزو بررسی شد.

هرکدام از 22 سویۀ آرکی‌های نمک‌دوست به لوله‌های کشت حاوی 10 میلی‌لیتر از محیط کشت رنگبری MGM 23درصد (حاوی 83/1 گرم سدیم‌کلراید، 22/0 گرم منیزیم‌کلراید، 26/0 گرم منیزیم‌سولفات، 053/0 گرم پتاسیم‌کلراید، 02/0 گرم عصارۀ مخمر و 1/0 گرم پپتون گوشت، pH توسط Tris یک مولار روی 7 تنظیم شد )، با غلظت 5درصد مایع تلقیح (از کدورت 5/0 مک‌فارلند آرکی معادل 108 × 5/1) افزوده شدند و در دمای 40 درجه سانتیگراد گرماگذاری شدند. رنگ‌های آزو جدا از محیط کشت سترون شد سپس با مقدار 50 میلی‌گرم بر لیتر به محیط‌ها اضافه شد.

.بررسی ویژگی‌های فنوتیپی آرکی‌های منتخب: ریخت‌شناسی کلنی‌ها در محیط MGM 23درصد بعد از یک هفته بررسی شد. رنگ‌آمیزی گرم (12) و آزمایش گرم در KOH 3درصد تأیید شد (13). حرکت آرکی‌ها ازطریق روش‌های لام مرطوب (12) تعیین شد. فعالیت کاتالاز با تولید حباب در محلول 3درصد هیدروژن‌پراکسید ارزیابی شد و فعالیت اکسیداز با استفاده از دیسک‌های آماده از شرکت Himedia تعیین شد. تحمل نمک سدیم‌کلرید در حضور تراکم 5 تا 30درصد در همان محیط پایۀ ذکرشده سنجش شد. رشد در دماهای 25 تا 50درصد در محیط پایه بررسی شد و محدودۀ pH برای رشد با تنظیم آن توسط Tris یک مولار بین 4 تا 9درصد تعیین شد.

بررسی اثر فاکتورهای مختلف بر رنگبری: اثر فاکتور مختلف با تغییر یک عامل در هر آزمایش در شرایط پایۀ ذکرشده انجام شد و از رنگ Remazol black B به‌عنوان نمایندۀ رنگ‌های آزو استفاده شد. اثر عوامل مختلف در روز چهارم بررسی گردید. همچنین هم‌زمان با بررسی اثر فاکتورهای مختلف بر رنگبری، رابطۀ بین رشد آرکی‌ها و رنگبری در حضور همان فاکتور نیز سنجیده شده است. رشد آرکی‌ها ازطریق تراکم نوری (OD) و توسط اسپکتروفوتومتر شیمادزو بررسی شد. براساس آزمون آنوا معناداربودن همۀ فاکتورها بررسی شد.

به‌منظور بررسی شرایط هوازی، دو حالت هوادهی با شیکر دور rpm 150 و ایستا در انکوباتور آزمایش شد، محیط پایه در لوله‌ها در شیکر و انکوباتور گرماگذاری شدند. دما از فاکتور مهم در بررسی به شمار می‌رود که رنگبری در دماهای 30-35-40-45-50 بررسی شد؛ همچنین برای سنجش pH با pH متر Sartorius مدل PB-11، رنگبری در pHهای مختلف 9-5 بررسی شد. غلظت‌های مختلف NaCl از 5/12 تا 30درصد بررسی شد؛ سپس منابع کربن ساده گلوکز، ساکارز، لاکتوز، مالتوز و اسیدهای آلی شامل استات سدیم، اسیدسیتریک و پروپیونیک اسید با غلظت نهایی 1درصد در محیط MGM بررسی شد. در ادامه از سه منبع نیتروژن آلی شامل عصارۀ مخمر، عصاره سویا، پپتون و دو منبع نیتروژن معدنی شامل اوره و سولفات آمونیوم با غلظت نهایی 5/0درصد همراه با بافر 50 میلی‌مولار Tris-Hcl استفاده شدند و برای بررسی تحمل‌پذیری غلظت‌های رنگ، غلظت‌های مختلفی از رنگ بررسی شد که این غلظت‌ها شامل 400، 600، 800، 1000، 2000 و 5000 میلی‌گرم بر لیتر بود. تمام آزمایش‌ها با سه بار تکرار انجام شد و محیط‌های رنگ‌دار تلقیح‌نشده به‌عنوان شاهد استفاده شدند.

برای به‌دست‌آوردن طیف جذبی هر رنگ ابتدا طیف جذبی هر رنگ از محدودۀ 200 تا 800 نانومتر با استفاده از دستگاه اسپکتروفوتومتر رسم شد تا حداکثر طول‌موج جذبی هر رنگ مشخص شود. از لوله‌های گرماگذاری‌شده در زمان ذکرشده 1 میلی‌لیتر نمونه برداشت و با دور g11500 به‌مدت 15 دقیقه سانتریفوژ شد. میزان جذب هر رنگ در حداکثر طول‌موج جذبی آن اندازه‌گیری شد.

درصد رنگبری طبق فرمول زیر محاسبه شد:

D (%)= (A-Ao)/A×100

 A= جذب در محیط، پس از رنگبری

Ao= جذب محیط شاهد (رنگی)

 D= درصد رنگبری

به‌منظور بررسی میزان رشد باکتری بعد از رنگبری ابتدا 1 میلی‌لیتر از نمونه‌ها برداشته شد و تراکم نوری (OD) آنها با دستگاه اسپکتروفوتومتری شیمادزو در طول‌موج 620 نانومتر جذب آنها خوانده شد و بعد از سانتریفوژ با دور g 11500 به مدت 15 دقیقه جذب آنها در همین طول‌موج خوانده شد. درنهایت با تفریق این داده‌ها میزان رشد در محیط رنگبری به دست آمد.

بررسی سمیت رنگبر آرکی‌ها: پس از قرارگرفتن آرکی‌ها به‌مدت 20 روز در محیط دارای رنگ، محیط مایع با استفاده از سانتریفوژ با دور g 11500 به‌مدت 15 دقیقه رسوب‌گذاری شد و رسوب حاصل، در محیط جامد کشت داده شد و رشد بعد از یک هفته بررسی شد.

نتایج.

.سویه‌های میکروبی و شناسایی سویه‌های جداشده: سویه‌های تایپ نگهداری‌شده در مرکز ملی ذخایر ژنتیکی و زیستی ایران[5] شامل Haloarchaeobius iranensis IBRC-M 10013، Halovivax limisalsi IBRC-M 10022، Halovivax certinus IBRC-M 10256، Halopenitus persicus IBRC-M 10041، Halorienticus persicus IBRC-M 10043، Halovenus aranensis IBRC-M 10015وHalopenitus Malekzadehii IBRC-M 10418 بودند.

 بررسی‌های مولکولی از سویه‌های جداشده از مناطق مختلف پرشور ایران صورت گرفت و 15 سویه آرکی‌های نمک‌دوست شناسایی شدند. آنها در محدودۀ نمک 5/12 تا 30درصد رشد می‌کنند. جدول 1، نتایج شناسایی مولکولی سویه‌های آرکی و میزان شباهت آنها با نزدیک‌ترین گونه‌های شناخته‌شده را نشان می‌دهد.

 

 

جدول 1- مقایسۀ توالی ژن 16S rRNA سویه‌های آرکی‌های نمک‌دوست جداشده

ردیف

نام سویه

بیشترین میزان شباهت به گونه‌های تایپ

درصد شباهت براساس ژن 16S rRNA

1

A

Halogeometricum borinquense DSM11551 (T)

1/99

2

B

Haloferax mediteranei CGMCC1.2087 (T)

4/99

3

C

HaloarculasalariaHST01-2R (T)

4/97

4

D

Haloarcula salariaHST01-2R (T)

1/97

5

E

Haloferax alexandrius TM (T)

8/99

6

F

Haloarcula marismortui ATCC43049 (T)

3/97

7

G

Haloarcula japonica JCM 7785 (T)

7/98

8

H

Halogeometricum borinquense DSM11551 (T)

99

9

I

Haloferax mediterranei CGMCC1.2087 (T)

3/99

10

J

Haloarcula salaria HST01-2R (T)

98

11

K

Haloarcula hispanica ATCC33960 (T)

8/97

12

L

Haloarcula hispanica ATCC33960 (T)

6/99

13

M

Haloferax prahovense TL6 (T)

100

14

N

Haloferax alexandrius TM (T)

9/99

15

O

Halococcus morrhuae ATCC17082 (T)

5/98


آزمون رنگبری: رنگبری رنگ‌های آزو در 22 سویه بررسی شد و نتایج در شکل 1، 2 و 3 نشان داده شده است. از میان 22 سویۀ آرکی‌ نمک‌دوست، چهار سویه به‌عنوان سویه‌های برتر در رنگبری رنگ دی آزو Remazol black B شناسایی شدند که شامل سویه‌های N با شباهت 9/99 به آرکی Haloferax alexandrius، سویۀ L با شباهت 6/99 به آرکی نمک‌دوست Haloarcula hispanica، سویۀ A با شباهت 1/99 به Halogeometricum borinquense وسویۀ B با شباهت 4/99 به آرکی Haloferax mediteraneiبودند. در مرحلۀ بعد توانایی رنگبری چهار سویۀ برتر بر رنگ مونو آزو Acid blue 161 بررسی شد که در شکل 3 نشان داده شده است و درنهایت سویۀ A وسویۀ B به‌عنوان سویه‌های برتر انتخاب شدند. رنگبری دو سویۀ برتر A و B را در شکل 1 (الف)، 3 و 4 مشاهده می‌کنید.

 

 

 

شکل 1- بررسی اولیۀ رنگبری آرکی‌های نمک‌دوست بر رنگ Remazol black B با اسپکتروفتومتری (حذف رنگ برحسب درصد) الف.سویه‌های منتخب از روز سوم تا هفتم ب.سویه‌های جداشده از غارنمکی در روز هفتم

 

شکل 2- بررسی اولیۀ رنگبری آرکی‌های تایپ (از مرکز ملی ذخایر ژنتیکی و زیستی ایران گرفته شد) بر رنگ Remazol black B در روزهفتم با اسپکتروفتومتری (حذف رنگ برحسب درصد)

 

 

شکل 3- رنگبری چهار آرکی‌ نمک‌دوست منتخب بر رنگ 161 Acid blue در روزهفتم با روش اسپکتروفتومتری (حذف رنگ برحسب درصد)

 

 

 

شکل 4- رنگبری دوسویه آرکی برتر Halogeometricum strain A و strain B Haloferax mediterrane در محیط پایۀ رنگبری با Remazol black B از چپ به راست به‌ترتیب: محیط شاهد حاوی Remazol black B (بدون تلقیح سویۀ موردنظر)، محیط پایه بدون تلقیح سویه و رنگ، محیط حاوی رنگ Remazol Black B به‌همراه تلقیح strain B Haloferax mediterrane پس از 4 روز، محیط حاوی رنگ Remazol Black B به‌همراه تلقیح strain A Halogeometricum borinquense پس از 4 روز

 

اثر فاکتورهای مختلف در سویه‌های منتخب

اثر هوادهی بر رنگبری: اثر هوادهی بر رنگ بری بررسی شد و نتایج در شکل 5 و 6 نشان داده شده است. رنگبری هم در شرایط ایستا و هم در شرایط هوادهی صورت می‌گیرد. در سویۀ  Bدر شرایط هوازی رشد بیشتری دارد اما در شرایط بی‌هوازی رنگبری بهتری نشان داده شده است. در سویۀ A در شرایط ایستا هم رشد و هم رنگبری بهتری دیده شد.

اثر دماهای مختلف بر رنگبری: اثر دما بر رنگبری در سویه‌های منتخب در شکل 7 نشان داده شده است. بهترین دمای رنگبری در Haloferax strain B (در دمای 40) با 77درصد رنگبری گزارش شد. با توجه به آزمون آنوا ازنظر آماری تفاوت معناداری در رنگبری بین دماهای 40، 45 و 50 درجه سانتیگراد وجود ندارد؛ اما تفاوت معناداری بین دمای 40 با دماهای 35 و 30 درجه سانتیگراد وجود دارد. ازآنجاکه در دمای 40 میزان رشد کمتری نسبت به دمای 45 و 50 دارد، بهینۀ رنگبری در دمای 40 درجه سانتیگراد در نظر گرفته شد. در آرکی Halogeometricum strain Aدر دمای 45 درجه سانتیگراد 94درصد رنگبری مشاهده شد که تفاوت معناداری با بقیۀ دماها داشت.

 

 

   

شکل 5- مقایسۀ رشد و رنگبری در شرایط هوازی و ایستا در strain B Haloferaxالف. رشد ب. رنگبری

 

   

شکل 6- مقایسۀ رشد و رنگبری در شرایط هوازی و ایستا در A Halogeometricum strain الف. رشد ب. رنگبری

 

   

شکل 7- رابطۀ بین رشد و رنگبری در دماهای مختلف الف. در A Halogeometricum strain ب. strain B Haloferax

 


اثر pHهای مختلف بر رنگبری: اثر pH بر رنگبری در سویه‌های آرکی منتخب در شکل 8 نشان داده شده است. در آرکی Halogeometricum strain A در pH 7 بیشترین رنگبری و رشد میکروارگانیسم مشاهده شد و در آرکی منتخب Haloferax strain Bنیز در همین pH بیشترین رنگبری دارد.

 

 

اثر غلظت‌های مختلف از NaCl: غلظت‌های مختلف NaCl از 5/12 تا 30درصد بررسی شد. همان‌طور که در شکل 9 نیز ملاحظه می‌شود Halogeometricum strain A به‌دلیل اینکه تفاوت معنی‌داری بین 15درصد با 5/17درصد نمک هم در رنگبری و هم در رشد ندارد و بهترین رنگبری و رشد در هردو درصدهای نمک است. در strain B Haloferax در غلظت نمک 5/17درصد بیشترین رنگبری و رشد دارد.

 

   

شکل 8- نمودار اثر pH مختلف بر رنگبری الف. A Halogeometricum strain ب.strain B Haloferax

 

   

شکل 9- نمودار اثر غلظت‌های مختلف نمک بر رنگبری الف. A Halogeometricum strain ب. strain B Haloferax

 


اثر منابع مختلف کربن بر رنگبری: اثر منابع مختلف کربنی بر رشد و رنگبری سویه‌های منتخب در شکل 10 نشان داده شده است. در سویۀ strain B Haloferax براساس آزمون آنوا تفاوت معناداری بین قندها در رنگبری به‌جز سیتریک‌اسید وجود ندارد؛ ولی با توجه به اینکه تفاوت معناداری در رشدشان دیده می‌شود، در حضور قند پروپیونیک‌اسید با داشتن کمترین رشد بهترین شرایط را به خود اختصاص می‌دهد. در سویۀ Halogeometricum strain A ساکارز تفاوت معنی‌داری با گلوکز و استات‌سدیم در رنگبری ندارد و رشدش با استات‌سدیم تفاوت معنادار دارد؛ اما با گلوکز این‌گونه نیست؛ پس ساکارز و گلوکز هردو منبع کربن مناسب برای این سویه هستند.

 

   

شکل 10- نمودار اثر منابع کربن مختلف بر رنگبری الف. Halogeometricum strain A ب. strain B Haloferax

 


اثر منبع نیتروژن بر رنگبری: اثر منابع مختلف نیتروژن بر رشد و رنگبری رنگ ریمازول بلک توسط سویه‌های آرکی منتخب در شکل 11 نشان داده شده است در این آزمایش از سه منبع نیتروژن آلی شامل عصاره مخمر، عصاره سویا، پپتون و دو منبع نیتروژن معدنی شامل اوره و سولفات آمونیوم همراه با بافر 50 میلی‌مولار Tris-Hcl استفاده شدند. همان‌طور که مشاهده می‌شود، در حضور مخمر رشد و رنگبری بیشترین درصد را به خود اختصاص داده است. پس از مخمر، پپتون گوشت و پپتون سویا بیشترین میزان رنگبری را دارند. در حضور اوره رنگبری کاهش یافته و در حضور آمونیوم سولفات رنگبری دیده نشده است.

 

 

   

شکل 11- نمودار اثر منابع نیتروژن متفاوت بر رنگبری الف. Halogeometricum strain A ب. strain B Haloferax

 

 

 


اثر غلظت‌های مختلف رنگ: رنگبری در غلظت‌های مختلف بررسی شد. این غلظت‌ها شامل 2000، 1000، 800، 600، 400 و 5000 میلی‌گرم بر لیتر است که در شکل 12درصد رنگبری‌شان گزارش داده شده است. ازآنجا‌که همۀ فاکتورها در روز 4 بررسی شده است، در بررسی غلظت رنگ، به‌دلیل اینکه در غلظت 1000 میلی‌گرم بر لیتر رنگبری در روز چهارم مشاهده نشد، در روز دهم بررسی‌ها صورت گرفته است. گفتنی است که در غلظت 2000 و5000 میلی‌گرم بر لیتر رنگبری در هیچ‌کدام از سویه‌ها مشاهده نشد.

بررسی سمیت رنگ بر آرکی‌ها: پس از 20 روز که آرکی‌ها در محیط دارای رنگ قرار گرفت، با سانتریفوژ g11500 به‌مدت 15 دقیقه، رسوب در محیط جامد کشت داده شد و باگذشت دو هفته هر دو سویۀ منتخب در غلظت 5000 میلی‌گرم بر لیتر رشد کردند.

 

 

   

شکل 12- نمودار اثر غلظت‌های مختلف رنگ بر رنگبری الف. Halogeometricum strain A ب. strain B Haloferax

 


بحث و نتیجه‏‏گیری.

سالانه میلیون‌ها تن از رنگ‌های آزو تولید می‌شود و 10 تا 15درصد آن وارد پساب‌ها و درنتیجه وارد محیط اطرافمان می‌شود و حیات موجودات و محیط‌زیست را با خطر جدی روبه‌رو می‌کند (14).

مطالعاتی مبنی بر رنگبری توسط آرکی‌های غیرِنمک‌دوست صورت گرفته است از آن جمله در بررسی رنگبری آرکی‌های غیرِنمک‌دوست می‌توان به آرکی‌های متانوژنیک (در کنسرسیوم بی‌هوازی ترموفیل) اشاره کرد. این آرکی‌ها شامل M.barkeri، Methanococcus voltaei و Methanospirillum hungat JF1 بودند که اثر رنگبری آنها بر رنگ‌های راکتیو بررسی شد (15). در مطالعات دیگر رنگبری رنگ‌های آزو توسط گروهی از آرکی‌ها با استفاده از راکتور ZVI-UASB صورت گرفته است، نام این آرکی‌ها ذکر نشده است اما از گروه متانوژن بودند (16). در رابطه با میکروارگانیسم‌های نمک‌دوست در باکتری‌های نمک‌دوست رنگبری گزارش شده است، نخستین بار اسد[vi] و همکارانش باکتری‌های نمک‌دوست Halomonas sp. D2، Halomonas sp. A3، Halomonas sp. Gb را جداسازی کردند که قادر به رنگبری تا مقادیر بالای 15درصد نمک NaCl بود (10).

خلید[vii] و همکارانش، نشان دادند که Shewanella putrefaciens AS96 قادر به رنگبری رنگ‌های آزو تا 100 درصد در مدت‌زمان 8 ساعت در غلظت نمکی 4درصد است (17).

سالا[viii] و همکارانش، پاک‌سازی زیستی ازطریق Gracilibacillus sp. GTY. بر رنگ Acid red B در غلظت نمکی 15درصد را بررسی کرده‌اند (18).

 مطالعاتی مبنی بر حضور آرکی‌های نمک‌دوست در تجزیۀ زیستی هیدروکربن‌های نفتی وجود دارد، از آن جمله به Halobacterium sp می‌توان اشاره کرد. از گزارش‌های دیگر سویه آرکی EH4 است که قادر به متابولیزه‌کردن ترکیبات هیدروکربن‌های اشباع است. تعدادی از آرکی‌ها مثل Haloferax sp. هم قادر به تجزیۀ اسیدهای آروماتیک هستند (19). آرکی نمک‌دوست Halorubrumسویۀ  Ha25آنزیم آمیلوپولولاناز خارج سلولی نمک‌دوست و مقاوم به حلال را در غلظت بالای نمک سدیم‌کلراید تولید می‌کند (20).

 در این پروژه بررسی رنگبری و اثر عوامل مختلف بر رنگبری رنگ‌های آزو (مهم‌ترین رنگ نساجی) در 22 سویه آرکی‌های نمک‌دوست که دوسویه به‌عنوان سویۀ برتر انتخاب شد. از میان 22، دو سویۀ A و B که براساس شباهت‌های فیلوژنی دارای بیشترین قرابت به گونه‌های آرکی Haloferax mediterraneو Halogeometricum borinquenseدارند، انتخاب شدند. هم‌زمان با بررسی اثر عوامل مختلف با رنگبری، میزان رشد و رنگبری نیز به‌طور هم‌زمان برای هر عامل مطالعه شد. با استفاده از آزمون آماری آنوا معنی‌داربودن داده‌ها بررسی شد. در نتایج به‌دست‌آمده در این پژوهش، شرایط هوادهی تفاوت چندانی با رنگبری در شرایط ایستا وجود ندارد اما باوجود رشد کمتر در شرایط ایستا، این شرایط مناسب‌تر در نظر گرفته شده است. رشد کمتر به این دلیل اهمیت دارد که جمعیت کمتری از این آرکی‌ها در پساب وجود دارند و راحت‌تر و با هزینۀ کمتری از پساب‌ها، در مراحل انتهایی تصفیۀ پساب، جمع‌آوری می‌شوند. ممکن است رنگبری در شرایط هوازی این سویه‌ها، به این دلیل باشد که آنزیم دخیل در رنگبری این آرکی‌های نمک‌دوست، فعالیتش در حضور اکسیژن مهار نشود. در بررسی منابع کربن مختلف، سیتریک‌اسید اثر کمی در رنگبری در Haloferax سویۀ B بدون تأثیر در رنگبری Halogeometricumسویۀ A داشته است، بقیۀ منابع اثر قابل‌توجهی در رنگبری داشته‌اند. Haloferax سویۀ B در حضور قند پروپیونیک‌اسید بهترین شرایط رنگبری را به خود اختصاص می‌دهد. در Halogeometricumسویۀ A ساکارز و گلوکز هردو منبع کربن مناسب برای این سویه هستند. رنگبری در گلوکز بیشتر گزارش شده است. گلوکز با افزایش رشد و درنتیجه افزایش تنفس و مصرف اکسیژن از محیط، شرایط بی‌هوازی را برای رنگبری فراهم می‌کند (21).

سویۀB در دمای 40 و سویۀA در دمای 45 درجه رنگبری بیشتری دارند. هردو سویه در دمای 30 تا 50 درجه توانایی رنگبری دارند. بررسی اثر دما بر رنگبری نشان داد که افزایش دما و کاهش دما باعث کاهش رنگبری می‌شود و بهینه فعالیت آنزیم رنگبر در دماهای به‌دست‌آمده است. در مطالعات بر قارچ‌ها افزایش دما در ازبین‌رفتن سلول و تخریب آنزیم‌های آزوردوکتاز نقش دارد (22). هرچند برخی از گزارش‌ها حاکی از وجود آزوردوکتازهای پایدار در دمایی بالا هستند که قادر است تا دمای 60 پایدار بماند (23). با توجه به داده‌های به‌دست‌آمده از آرکی‌های نمک‌دوست این گروه از میکروارگانیسم‌ها توانایی بسیاری در رنگبری در دماهای بالاتر از 40 درجه دارند و این سویه‌ها بهترین رشد را در این دماها دارند. رنگبری در سویۀ B تا دماهای 50 درجه، بدون کاهش در درصد رنگبری صورت گرفت. با توجه به اینکه مطالعه بر آنزیم‌های رنگبری در آرکی‌های نمک‌دوست صورت نگرفته است، آنزیم موجود در این آرکی‌ها از پایداری بالایی در دماهای بالا برخوردار است و این با توجه به اینکه فرایند رنگریزی در صنایع نساجی در دماهای بالا صورت می‌گیرد یک مزیت به حساب می‌آید. همچنین با توجه به اینکه این سویه‌ها در غلظت‌های بالای 15درصد توانایی رنگبری دارند و اینکه پساب‌های نساجی شوری بالایی دارند از دیگر مزایای استفاده از این آرکی‌ها است.

 اگرچه بعضی از باکتری‌ها مثل هالوموناس‌ها (10) توانایی زندگی در محیط‌های شور دارند و مطالعات زیادی مبنی بر رنگبری توسط آنها وجود دارد؛ اما گزارشی از رنگبری توسط آرکی‌ها موجود نیست با وجود اینکه آرکی‌ها در شرایط شور و سخت محیطی بر باکتری‌ها غالب هستند و شانس زنده‌ماندن آنها در این شرایط نسبت به باکتری‌ها بیشتر است (24)

در بررسی pH در هردو سویه بیشترین رنگبری در شرایط خنثی بود و این حداکثر رنگبری هماهنگ با رشد بیشتر سویه‌ها در pH 7 بود. طبق داده‌های به‌دست‌آمده آنزیم رنگبر و بیشترین مقدار رشد آرکی‌ها در pH خنثی است. با افزایش pH میزان رشد نیز کاهش می‌یافت. بیشترین رنگبری گزارش‌شده در باکتری‌ها در pH 6-10 و در قارچ‌ها pH خنثی و اسیدی گزارش شده است (22).

در بررسی غلظت‌های مختلف نمک NaCl، بهترین رنگبری در غلظت 15 تا 5/17درصد نمک مشاهده شد و این حداکثر رنگبری هماهنگ با رشد سویه‌های آرکیایی بود. افزایش بیشتر درصد نمک بر رشد سویه‌های آرکیایی اثر مثبت داشت؛ اما در فعالیت رنگبری کاهش نشان داد. درنتیجه غلظت‌های بالاتر بر رنگبری اثر مستقل از رشد میکروارگانیسم دارد. افزایش نمک بر بار سطحی آنزیم‌ها مؤثر است.

این سویه‌ها غلظت رنگ را تا 5000 میلی‌گرم بر لیتر را تحمل می‌کنند. همان‌طور که از داده‌های شکل 12 مشاهده می‌شود این سویه‌ها در غلظت‌های 1000 میلی‌گرم بر لیتر باوجود رشد کم، درصد رنگبری بالای 40 درصد دارند. در مطالعات صورت‌گرفته در رنگبری Direct red 81 درEnterococcus faecalis YZ 66غلظت‌های موردبررسی تا 700 میلی‌گرم بر لیتر گزارش شد (25). در مطالعات مربوط به مجموعه‌ای از باکتری‌ها در یک محیط رنگبری گزارش شده که این مجموعه قادر به رنگبری حدود 87درصد در حضور 1500 میلی‌گرم در لیتر رنگ است (9) ولی با توجه به اینکه آرکی‌های بررسی‌شده در این پژوهش خود به‌تنهایی در حضور 1000 میلی‌گرم رنگ تا 50درصد رنگبری می‌کنند، توانایی این میکروارگانیسم‌ها نسبت به سایر میکروارگانیسم‌ها در غلظت‌های بالای رنگ نشان می‌دهد. توانایی رنگبری در غلظت‌های بالای رنگ از صفاتی است که کمتر در سویه‌هایی با این توانایی گزارش شده است (26). کاهش رنگبری و رشد در غلظت‌های بالای رنگ ممکن است به‌دلیل سمی‌بودن رنگ برای آرکی‌ها و مهار فعالیت متابولیکی آنها باشد. همچنین رنگ‌ها سنتز نوکلئیک‌اسیدها را مهار می‌کنند (27). با توجه به نتایج به‌دست‌آمده در شکل 10 در غلظت‌های بالای رنگ با کاهش رشد، رنگبری نیز کاهش می‌یابد. با توجه به مطالعات بر سایر میکروارگانیسم‌ها، عصارۀ مخمر بهترین منبع نیتروژن است که منجر به تولید NADH می‌شود و به‌عنوان دهندۀ الکترون عمل می‌کند و باعث کاهش رنگ آزو توسط میکروارگانیسم می‌شود (22). براساس نتایج به‌دست‌آمده در پژوهش‌های ما در آرکی‌های نمک‌دوست نیز عصارۀ مخمر بهترین منبع نیتروژن در رنگبری است.

مقایسۀ رشد و رنگبری نشان می‌دهد که با افزایش رشد، رنگبری نیز افزایش یافته اما همه‌جا صادق نیست مثلاً در شرایط هوازی و ایستا با وجود رشد بیشتر در شرایط هوازی رنگبری تقریباً برابر شرایط ایستا است چون فرایند رنگبری، فرآیندی بی‌هوازی است.

 میکروارگانیسم‌های نمک‌دوست و تحمل‌کنندۀ نمک در بیوتکنولوژی دارای اهمیت هستند. ازآنجاکه کارخانه‌های نساجی از نمک استفاده می‌کنند (غلظتی حدود 100-60 گرم بر لیتر نمک (9). استفاده از این میکروارگانیسم‌ها اهمیت دارد و به‌علاوه این میکروارگانیسم‌ها قادر به تحمل تنش‌های ناشی از فلزات سنگین و اکسی‌آنیون‌های سمی که معمولاً در پساب‌ها وجود دارند، هستند. براساس دانش کنونی ما تاکنون گزارشی از رنگبری رنگ‌های آزو توسط آرکی‌های نمک‌دوست منتشر نشده است. با توجه به اینکه آرکی‌ها در گروه‌های فیزیولوژیکی وسیعی تقسیم‌بندی می‌شوند (نمک‌دوست، گرمادوست، اسیددوست، متانوژن و مصرف‌کننده‌های نیتروژن) (24) و هرکدام از این گروه‌ها در شرایط سخت توانایی زندگی دارند و همچنین با توجه به نتایج به‌دست‌آمده از این پروژه، این گروه از میکروارگانیسم‌ها در شرایط مشابه به صنایع نساجی دما، نمک بالا و دیگر شرایط سخت توانایی رنگبری دارند، شرایطی که برای میکروارگانیسم‌های دیگر غیرقابل‌تحمل است.



[1]- Merck

[2]- CIBA

[3]- Marmur

[4]- Polymerase Chain Reaction (PCR)

[5]- Iranian Biological Resource Center

[vi]- Asad

[vii]- Khalid

[viii]- Salah

(1)              Patil PS., Shedbalker UU., Kalyani DC., Jadhav JP. Biodegradation of Reactive Blue 59 by isolated bacterial consortium PMB11. Journalof industrial microbiology & biotechnology2008; 35 (10): 1181-1190.

(2)              Madhuri M., Rijuta G., Ganesh D., Girish R. Decolorization and detoxification of sulfonated toxic diazo dye CI Direct Red 81 by Enterococcus faecalis YZ 66. Journal of Environmental Health Science and Engineering 2014; 12 (1): 151.

(3)              Dos Santos AB., Cervantes FJ., van Lier JB. Review paper on current technologies for decolourisation of textile wastewaters: perspectives for anaerobic biotechnology. Bioresource Technology 2007; 98 (12): 2369-2385.

(4)              Saratale RG., Saratale GD., Chang JS., Govindwar SP. Bacterial decolorization and degradation of azo dyes: A review.Journal of the Taiwan Institute of ChemicalEngineers 2011; 42 (1): 138-157.

(5)              Rani C., Jana A., Bansal A. Potential of different white rot fungi to decolourize textile azo dyes in the absence of external carbon source. Environmental technology 2012; 33 (8): 887-896.

(6)              Chen K., Wu J., Liou D., Hwang S. Decolorization of the textile dyes by newly isolated bacterial strains. Journal of Biotechnology 2003; 101 (1): 57-68.

(7)              Nigam P., Banat IM., Singh D., Marchant R. Microbial process for the decolorization of textile effluent containing azo, diazo and reactive dyes. Process Biochemistry 1996; 31 (5): 435-442.

 

 

(8)              Rathod JV. Cloning and heterologous expression of genes involved in azo dye decolorization and metabolic engineering for efficient bioremediation. [Dissertation]. India: University of Baroda; 2013.

(9)              Balapure KH., Jain K Chattaraj S., Bhatt NS., Madamwar D. Co-metabolic degradationof diazo dye—Reactive blue 160 by enriched mixed cultures BDN. Journal of hazardous materials 2014; 279: 85-95.

(10)          Asad S., Amoozegar MA., Pourbabaee AA., Sarboloki MN., Dastgheib SMM. Decolorization of textile azo dyes by newly isolated halophilic and halotolerant bacteria. Bioresource technology 2007; 98 (11): 2082-2088.

(11)          Marmur J. A procedure for the isolation of deoxyribonucleic acid from micro-organisms. Journal of molecular biology 1961; 3 (2): 208-218.

(12)          Gerhardt P., Murray R., Wood WA., Krieg NR. Methods for general and molecular bacteriolog: American Society for Microbiology Washington, DC; 1994.

(13)          Baron EJ., Finegold SM., Bailey, S. Diagnostic Microbiology. 8th ed. St.louis: Mosby; 1990.

(14)          Kagalkar AN., Jagtab UM., Jadhav JP., Bapat VA., Govindwar SP. Biotechnological strategies for phytoremediation of the sulfonated azo dye Direct Red 5B using Blumea malcolmii Hook. Bioresource technology 2009; 100 (18) : 4104-4110.

(15)          Dos Santos AB., De Madrid MP., De Bok FAM., Satms AJM., Van lier JB., Cervantes FJ. The contribution of fermentative bacteria and methanogenic archaea to azo dye reduction by a thermophilic anaerobic consortium. Enzyme and microbial technology 2006; 39 (1): 38-46.

(16)          Zhang Y., Jing Y., Zhange Jingxin., Sun L., Quan X. Performance of a ZVI-UASB reactor for azo dye wastewater treatment. Journal of chemical technology and biotechnology 2011; 86 (2): 199-204.

(17)          Khalid A., Arshad M., Crowley DE. Decolorization of azo dyes by Shewanella sp. under saline conditions. Appl MicrobiolBiotechnol 2008; 79 (6): 1053-1059.

(18)          Salah Uddin M., Zhou J., Qu Y., Guo J., Wang P., Zhao LH. Biodecolorization of azo dye acid red B under high salinity condition. Bull Environ Contam Toxicol 2007; 79 (4): 440-444.

(19)          Le Borgne S., Paniagua D., Vazquez-Duhalt R. Biodegradation of organic pollutants by halophilic bacteria and archaea. Journal of molecular microbiology and biotechnology 2008; 15 (2): 74-92.

(20)          Siroosi M., Amoozegar MA., Khajeh K., Habibi Rezaei M., Fazeli M. Purification and characterization of an extracellular halophilic and organic solvent-tolerant amylopullulanase from a haloarchaeon, Halorubrum sp. strain Ha25. Biological Journal of Microorganism 2013; 2 (7): 1-14.

(21)          Dhanve R., Shedbalkar U., Jadhav J. Biodegradation of diazo reactive dye Navy Blue HE2R (Reactive Blue 172) by an isolated Exiguobacterium sp. RD3. Biotechnology and Bioprocess Engineering 2008.13 (1): 53-60.

(22)          Khan R., Bhawana P., Fulekar MH. Microbial decolorization and degradation of synthetic dyes: a review. Reviews in Environmental Science and Bio/Technology 2013; 12 (1): 75-97.

(23)          Pearce CI., Loyd JR., Guthrie JT. The removal of colour from textile wastewater using whole bacterial cells: a review. Dyes and pigments 2003: 58 (3): 179-196.

(24)          Valentine DL. Adaptations to energy stress dictate the ecology and evolution of the Archaea. Nature Reviews Microbiology 2007; 5 (4): 316-323.

(25)          Sahasrabudhe MM., Salatale RG., Saratale GD., Pathade GR. Decolorization and detoxification of sulfonated toxic diazo dye CI Direct Red 81 by Enterococcus faecalis YZ 66. Journal of Environmental Health Science and Engineering 2014; 12 (1): 151.

(26)          Moosvi S., Kehaira H., Madamwar D. Decolorization of textile dye Reactive Violet 5 by a newly isolated bacterial consortium RVM 11.1. World Journal of Microbiology and Biotechnology 2005; 21 (5): 667-672.

(27)          Wuhrmann K., Mechsner KI., Kappeler Th. Investigation on rate determining factors in the microbial reduction of azo dyes.European journal of applied microbiology and biotechnology 1980; 9 (4): 325-338.