شناسایی سریع و اختصاصی سرووار بیماری‌زای سالمونلا تیفی‌موریوم با استفاده از روش تکثیر هم‌دمای به‌واسطه حلقه (LAMP)

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 استادیار بیوشیمی، گروه زیست‌شناسی، دانشکده علوم، دانشگاه شهید باهنر کرمان، ایران

2 دانشجوی کارشناسی ارشد ییوشیمی، دانشگاه شهید باهنر کرمان، ایران

چکیده

مقدمه: باکتری سالمونلا تیفی‌موریوم یکی از بیماری‌زاهای غذایی مهم و از علل شایع سالمونلوزیس است که گاهی به عفونت خون یا حتی مرگ منجر می‌شود. در مطالعه حاضر، این سرووار بیماری‌زا با روش تکثیر هم‌دمای به‌واسطه حلقه (LAMP) شناسایی شد.
مواد و روش‏‏ها: از 6 پرایمر اختصاصی برای تکثیر ژن STM4497 و شناسایی سویه‌های سالمونلا تیفی‌موریوم و از روش‌های کدورت‌سنجی و ژل-‌الکتروفورز برای آشکارسازی محصول‌های واکنش استفاده شد. همچنین، کارایی روش LAMP برای شناسایی سویه‌های سالمونلا تیفی‌موریوم در نمونه‌های گوشت مرغ آلوده‌شده به‌شکل مصنوعی به این باکتری بررسی شد.
نتایج: اختصاصیت این روش روی جدایه‌های مختلف سالمونلا و غیر سالمونلا ارزیابی و نتایج مثبت تنها برای جدایه‌های سالمونلا تیفی‌موریوم حاصل شدند. حساسیت این روش برای سویه‌های یادشده، 10 کلنی در هر تیوب واکنش بود که نسبت به روش‌های ارائه‌شده پیشین برای شناسایی این سرووار بیشتر است. ارزیابی این روش روی نمونه‌های گوشت آلوده‌شده به‌شکل مصنوعی با سالمونلا تیفی‌موریوم نشان داد که روش حاضر، این باکتری را با حساسیت 103 کلنی در آغاز انکوباسیون و 10 کلنی پس از 4 ساعت انکوباسیون شناسایی می‌کند.
بحث و نتیجه‏گیری: با توجه به اختصاصیت و حساسیت زیاد روش حاضر و ارزان‌قیمت‌بودن آن به دلیل ‌نیازنبودن استفاده از دستگاه‌ گران‌قیمت ترموسیکلر و ژل-الکتروفورز نتیجه‌گیری می‌شود که این روش ابزاری قدرتمند، دقیق و ارزان برای شناسایی سرووار بیماری‌زای سالمونلا تیفی‌موریوم در آزمایشگاه‌های کنترل کیفی مواد غذایی و آزمایشگاه‌های تشخیصی با تجهیزات اندک است.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

A rapid and specific detection of pathogenic serovar Salmonella typhimurium by loop-mediated isothermal amplification method (LAMP)

نویسندگان [English]

  • Hadi Ravan 1
  • Mojdeh Amandadi 2
1 Assistant professor of Biochemistry, Department of Biology, Faculty of Science, Shahid Bahonar University of Kerman, Kerman, Iran
2 M.Sc. student of Biochemistry, Department of Biology, Faculty of Science, Shahid Bahonar University of Kerman, Kerman, Iran
چکیده [English]

Introduction:Salmonella serovar typhimurium is one of the most important foodborne pathogens and common causes of salmonellosis that in some conditions lead to septicemia or even death in humans. Therefore, the present study sought to detect this pathogenic serovar using loop-mediated isothermal amplification (LAMP) assay.
Materials and methods: In the present study, six special primers were used to amplify STM4497 gene and accordingly to detect Salmonella typhimurium strains. The detection of the amplified products was performed by both turbidity and gel electrophoresis methods. Furthermore, the efficiency of LAMP assay for the detection of Salmonella typhimurium strains was examined in several artificially contaminated chicken meat samples.
Results: The specificity of the assay was evaluated by various isolates of Salmonella and non-Salmonella, and positive results were only obtained from Salmonella typhimurium isolates. The detection limit of the assay was determined to be 10 CFU/reaction, which was lower than the previously developed competing assays. The results of the assay on artificially contaminated chicken meats showed that this assay enables detecting Salmonella typhimurium strains with a detection limit 103 CFU/mL without pre-enrichment and 10 CFU/mL after a four-hour pre-enrichment.
Discussion and conclusion: As a result of a high sensitivity and specificity of the method as well as its low cost per assay, it could be concluded that the present LAMP assay is a powerful, accurate, and efficient method for detecting pathogenic serovar Salmonella typhimurium in food-processing industries and diagnostic laboratories.

کلیدواژه‌ها [English]

  • Salmonella typhimurium
  • LAMP assay
  • STM4497 gene

مقدمه.

بیماری‌زاهای مواد غذایی یکی از عمده‌ترین عوامل بیماری‌زا در کشورهای در حال توسعه و نیز در کشورهای توسعه‌یافته با استانداردهای بالای بهداشتی هستند. باکتری سالمونلا[1] یکی از بیماری‌زاهای غذایی مهم در سراسر جهان و از علل اصلی مسمومیت غذایی در انسان و دارای سرووار‌های مختلفی است که بر اساس پروفایل‌های آنتی‌ژنی ویژه خود، بیماری‌های مختلفی ایجاد می‌کنند و میزبان‌های مختلفی دارند. تمایز این سرووار‌ها از یکدیگر برای شناخت اپیدمیولوژی مربوط به هر یک و تشخیص سریع منبع آلودگی در بهبود و کنترل بیمار‌ی‌های ناشی از آنها ضروری است (1). از میان سرووار‌های مختلف سالمونلا، سرووار سالمونلا تیفی‌موریوم[2] یکی از شایع‌ترین علل سالمونلوزیس یا عفونت‌های سالمونلایی غیرتیفوئیدی در انسان است که گاهی به عفونت خون یا حتی مرگ منجر می‌شود (2 و 3). با توجه به شیوع بسیار زیاد این بیماری‌زا، ارائه روش تشخیصی سریع، اختصاصی و با حساسیت زیاد برای شناسایی این سرووار بیماری‌زا به منظور کنترل بیماری‌های ناشی از مواد غذایی آلوده ضروری است.

روش‌های مرسوم برای جداسازی و شناسایی این باکتری شامل ترکیبی از چند روش میکروبی و آزمون‌های تأییدی بیوشیمیایی و سرولوژیکی هستند (4) که به دلیل پیچیدگی، زمان‌بربودن و نیازمندی به نیروی انسانی متخصص کارایی کمی دارند (5). همچنین، تغییرهای مورفولوژیکی و بیوشیمیایی بین سویه‌های مختلف سالمونلا باعث افزایش قطعیت‌نداشتن نتایج آزمون‌ها و در نتیجه کاهش کارایی روش‌ها می‌شوند (6). با توجه به ناکارآمدی روش‌های یادشده و نظر به پیشرفت‌های حاصل در زیست‌شناسی مولکولی، امروزه روش‌های مولکولی متعدد مبتنی بر PCR برای شناسایی این بیماری‌زا ارائه شده‌اند که ژن‌های بیماری‌زای متعددی ازجمله fliC،fljB،invA،rfbJ،STM2755 و STM2235 را هدف قرار می‌دهند (1 و 7-13). با وجود دقت و سرعت زیاد روش‌های مبتنی بر PCR در شناسایی بیماری‌زاهای مختلف، متأسفانه بسیاری از روش‌های ارائه‌شده برای شناسایی این بیماری‌زا به دلیل اختصاصیت‌نداشتن کافی ژن‌های استفاده‌شده، نیازمندی به تجهیزات پیشرفته و گران‌قیمت آزمایشگاهی، نیاز به استفاده از روش‌های وقت‌گیر و هزینه‌بر برای آشکار‌سازی و تشخیص محصول‌های واکنش و حساسیت کمتر این روش‌ها نسبت به برخی روش‌های موجود، دچار چالش جدی شده‌اند (14). به‌تازگی، روش‌های متعدد مبتنی بر تکثیر هم‌دمای نوکلئیک‌اسید برای شناسایی سریع و ساده بیماری‌زاها ارائه شده‌اند و از میان این روش‌ها، روش تکثیر هم‌دمای به‌واسطه حلقه [3](LAMP) به دلیل سرعت، حساسیت، اختصاصیت و کم‌هزینه‌بودن محبوبیت بیشتری یافته است (15-17). در این روش، تکثیر DNA با آنزیم DNA پلیمراز Bst[4] که بدون نیاز به مرحله واسرشت‌شدن حرارتی، توانایی جایگزینی رشته و تکثیر را به‌طور همزمان دارد و با استفاده از 4 تا 6 پرایمر اختصاصی که توانایی اتصال کاملاً اختصاصی به 6 تا 8 ناحیه از توالی هدف را دارند طی مدت زمان 60 دقیقه و شرایط هم‌دما انجام می‌شود (17 و 18). با توجه به مزایای گفته‌شده، به‌کارگیری این روش با استفاده از ژن اختصاصی که به سرووار سالمونلا تیفی‌موریوم منحصر است، ابزاری قدرتمند، دقیق و ارزان برای شناسایی این سرووار بیماری‌زا در آزمایشگاه‌های تشخیصی به‌ویژه آزمایشگاه‌های دارای تجهیزات اندک و آزمایشگاه‌های سیار است. از این رو، با توجه به مطالعات بیوانفورماتیکی، مقایسه‌های ژنومی و تأییدهای آزمایشگاهی که کیم[5] و همکاران انجام دادند و ژن STM4497 را مارکری اختصاصی برای سرووار سالمونلا تیفی‌موریوم معرفی کردند (5)، در پژوهش حاضر سعی شده است تا برای نخستین بار در دنیا با روش سریع، دقیق و حساس LAMP، این مارکر ژنی هدف قرار داده شود و روشی کارآمد با اختصاصیت و حساسیت زیاد برای شناسایی سویه‌های مربوط به سرووار سالمونلا تیفی‌موریوم ارائه شود. نتایج پژوهش حاضر نشان دادند که مجموعه پرایمرهای طراحی‌شده برای این ژن در مطالعه حاضر به‌طور منحصربه‌فردی سویه‌های سالمونلا تیفی‌موریوم را از سایر سویه‌های آزمایش‌شده متمایز می‌کنند.

 

‏‏مواد و روش‏ها.

سویه‌های باکتریایی و آماده‌سازی DNA: در مطالعه حاضر، از 12 جدایه باکتریایی شامل 3 جدایه از سرووار سالمونلا تیفی‌موریوم، 7 جدایه از سایر سرووارهای سالمونلا شامل بلیگدوم[6]، انتریتیدیس[7]، کویلسرویر[8]، نیجریا[9]، پاراتیفیA[10]، راستاک[11] و تیفی[12] و 2 جدایه از جنس‌هایی غیر از سالمونلا شامل اشیریشیا کلای[13] و شیگلا[14] (با سروتایپ‌های نامشخص) استفاده شد. سویه‌های باکتریایی یادشده از گروه دامپزشکی دانشگاه شهید باهنر کرمان، آزمایشگاه میکروبیولوژی دانشگاه علوم پزشکی سیستان‌وبلوچستان و آزمایشگاه بیوشیمی دانشگاه علوم پزشکی کرمان جمع‌آوری شدند. برای آماده‌سازی DNA ژنومی، یک تک کلون از هر باکتری در محیط TSB[15] (لیوفیلچم[16]-ایتالیا) کشت داده و به مدت 16 ساعت در دمای 37 درجه سانتی‌گراد انکوبه شد. برای تعیین تعداد باکتری‌ها در محلول کشت، مقدار معینی از هر سوسپانسیون باکتریایی به‌شکل سریالی در mM10 بافر فسفات سالین (PBS) استریل با اسیدیته 4/7 رقیق‌سازی و برای شمارش تعداد باکتری‌ها با روش استاندارد رقیق‌سازی متوالی استفاده شد. استخراج DNA با روش جوشاندن به مدت 10 دقیقه در دمای 95 درجه سانتی‌گراد انجام شد.

طراحی پرایمرهای LAMP: ژن STM4497 از ژنوم سالمونلا تیفی‌موریوم سویه LT2 به‌عنوان هدف برای طراحی پرایمرهای LAMP استفاده شد. برای شناسایی این ژن، 6 پرایمر شامل دو پرایمر درونی (FIP و BIP)، دو پرایمر بیرونی (F3 و B3) و دو پرایمر لوپ (FLP و BLP) با نرم‌افزار پرایمر اکسپلورر نسخه 4[17] طراحی شدند؛ توالی پرایمرهای طراحی‌شده در جدول 1 نشان داده شده است. اختصاصیت پرایمرهای طراحی‌شده با نرم‌افزار BLAST در پایگاه NCBI[18] تأیید شد.

 

 

جدول 1- پرایمرهای استفاده‌شده در واکنش LAMP

موقعیت توالی هدف در ژنوم سالمونلا تیفیموریوم سویه LT2

)5’-3’توالی نوکلئوتیدی پرایمرها (

پرایمر

4751102-4751085

GTGCGTGAACACCTGAAG

F3

4750663-4750646

GATTCAATGTCGCCGCAG

B3

(4751025-4751008)- (4750979-4750960)

CCGACTTTCACTTCCTGCTGCATCGTCGACATGCTCAC

FIP

(4750750-4750733)- (4750819-4750802)

GCCATGAGCTGATGAGCGGATCGTGTCCGCTATAGG

BIP

4751003-4750733

GCGGTCAAATAACCCACG

FLP

4750801-4750784

CCTTGCAGGACGTGATGG

BLP


واکنش LAMP: واکنش LAMP برای حجم نهایی 50 میکرولیتر انجام شد. هر تیوب واکنش شامل 6/1 میکرومولار از هر یک از پرایمرهای FIP و BIP، 2/0 میکرومولار از هر یک از پرایمرهای F3 و B3، 8/0 میکرومولار از هر یک از پرایمرهای FLP و BLP (جدول 1)، 4/1 میلی‌مولار از هر یک از دئوکسی نوکلئوتید تری فسفات‌ها، 8/0 مولار بتائین (شرکت سیگما[19]،B0300- ایالات متحده آمریکا)، غلظت 6 میلی‌مولار از منیزیم‌سولفات، 1 میکرولیتر از بافر LAMP 10X، 8 واحد از قطعه بزرگ آنزیم DNA پلیمراز Bst (نیو اینگلند بیولبز[20]،M0275S- ایالات متحده امریکا) و 10 میکرولیتر از DNA هدف بود. تمام مخلوط‌های واکنش به مدت 60 دقیقه در دمای 65 درجه سانتی‌گراد درون ترموسیکلر (بیو-رد[21]) و برای ارزیابی امکان‌پذیر‌بودن واکنش بدون نیاز به دستگاه ترموسیکلر درون حمام آب گرم با تنظیم دمایی مشابه انکوبه شدند. سپس، واکنش با افزایش دما تا 80 درجه سانتی‌گراد به مدت 2 دقیقه متوقف شد. شناسایی و آشکارسازی محصول‌های واکنش به‌شکل چشمی و با مشاهده کدورت ناشی از رسوب منیزیم پیروفسفات در محیط واکنش انجام شد. برای ارزیابی دقیق واکنش LAMP، 5 میکرولیتر از محصول‌های واکنش در ژل آگارز 5/2 درصد الکتروفورز شد و در نهایت با پارامتر آماری کای مربع، میزان وابستگی واکنش LAMP (برای نمونه‌هایی که به‌شکل مصنوعی آلوده شده بودند) به زمان آنالیز شد (P-value

 

نتایج.

اختصاصیت واکنش LAMP: تمام جدایه‌‌های باکتریایی متعلق به سرووار سالمونلا تیفی‌موریوم و سرووارهای غیر سالمونلا تیفی‌موریوم با واکنش LAMP بررسی شدند. پس از انجام واکنش LAMP، کدورت ایجادشده در تیوب‌های آزمون حاوی جدایه‌های سالمونلا تیفی‌موریوم، تکثیر موفق ژن هدف را در این جدایه‌ها نشان داد. برای تأیید بیشتر، محصول‌های واکنش با روش ژل-الکتروفورز ارزیابی شدند. مشاهده الگوی نردبانی حاصل از محصول‌های LAMP روی ژل نشان داد که پرایمر‌های طراحی‌شده به‌طور موفق و اختصاصی ژن STM4497 را در جدایه‌‌های سالمونلا تیفی‌موریوم تکثیر کرده‌اند در حالی که جدایه‌های غیر سالمونلا تیفی‌موریوم هیچ‌گونه کدورت یا باندی روی ژل الکتروفورز با شرایط آزمایشی مشابه نشان ندادند (شکل 1).

حساسیت واکنش LAMP: میزان حساسیت واکنش LAMP با استفاده از رقت‌های سریالی تعداد مشخصی جدایه‌‌های سالمونلا تیفی‌موریوم ارزیابی شد. نتایج این ارزیابی نشان دادند که در آزمون کشت خالص، حد تشخیص این روش 10 کلنی در هر تیوب واکنش است (شکل 2). نتایج حاصل با استفاده از هر دو روش کدورت‌سنجی و الکتروفورز در ژل تأیید شدند.

ارزیابی روش LAMP برای شناسایی باکتری سالمونلا تیفی‌موریوم در نمونه‌هایی که به‌شکل مصنوعی آلوده شده‌اند: به منظور ارزیابی روش LAMP برای شناسایی سویه‌های سالمونلا تیفی‌موریوم در نمونه‌هایی که به‌شکل مصنوعی به باکتری آلوده شده‌اند، 1 گرم گوشت مرغ با 9 میلی‌لیتر TSB هموژنه شد و نمونه‌های هموژنه‌شده با صفر تا 104 واحد تشکیل‌دهنده کلنی از باکتری سالمونلا تیفی‌موریوم آلوده شدند (0 CFU/mL شاهد منفی و تعداد تکرار هر نمونه 10 عدد بود). هموژنه گوشتی آلوده به این باکتری در زمان‌های 4، 6 و 24 ساعت در دمای 37 درجه سانتی‌گراد انکوبه شد. نتایج با استفاده از پارامتر آماری کای مربع برای 10 تکرار از نمونه‌های آلوده‌شده نشان دادند که نمونه‌هایی با 103≤ واحد تشکیل‌دهنده کلنی در آغاز انکوباسیون (زمان صفر) دارای نتایج مثبت بودند. علاوه بر این، در سطوح پایین آلودگی، روش LAMP حاضر قادر به تشخیص 10 واحد تشکیل‌دهنده کلنی پس از 4 ساعت انکوباسیون بود.

 

 

شکل 1- نتایج حاصل از آنالیز الکتروفورزی (ژل آگارز 5/2 درصد) و کدورت‌سنجی محصول‌های واکنش LAMP برای سرووارهای مختلف سالمونلا؛ 1. شاهد منفی، 2. پاراتیفی A، 3 و 4. جدایه‌های مختلف سالمونلا تیفیموریوم. کدورت ایجادشده در تیوب‌ها، تکثیر ژن طی واکنش LAMP را نشان می‌دهد (تنها نتایج تعدادی از جدایه‌ها نشان داده شده است).

 

 

شکل 2- حساسیت واکنش LAMP برای شناسایی ژن STM4497 در رقت‌های مختلف (cfu/reaction) از باکتری سالمونلا تیفی موریوم. 1، 2، 3 و 4 به‌ترتیب رقت‌های 5، 10، 102 و 103 کلنی در هر تیوب واکنش هستند.


بحث و نتیجه‏‏گیری.

سرووار سالمونلا تیفی‌موریوم یکی از شایع‌ترین علل سالمونلوزیس یا عفونت‌های سالمونلایی غیرتیفوئیدی در انسان است. با توجه به شیوع زیاد این بیماری‌زا و اهمیت شناسایی آن برای کنترل بیماری‌های ناشی از مواد غذایی آلوده، ارائه روش تشخیصی سریع، اختصاصی و با حساسیت زیاد برای شناسایی این سرووار بیماری‌زا ضروری است. در مطالعه حاضر، از روش LAMP و مارکر ژنی STM4497 برای شناسایی دقیق سویه‌های سالمونلا تیفی‌موریوم استفاده شد. تاکنون روش‌های تشخیصی متعددی با استفاده از روش LAMP برای شناسایی این باکتری ارائه شده‌اند (19-21)؛ ازجمله چن[xxii] و همکاران، ژن STM4495 را با روش LAMP هدف قرار دادند و حد تشخیص این روش را با استفاده از روش ژل الکتروفورز، cfu/reaction7/16 ارزیابی کردند (19). با مقایسه میزان حساسیت روش یادشده با آزمایش LAMP حاضر و با توجه به میزان حساسیت یافت‌شده در روش حاضر (cfu/reaction 10) به‌شکل چشمی و بی‌نیازی از ژل-الکتروفورز نتیجه گرفته می‌شود که روش حاضر حساسیت زیادی دارد.

علاوه بر روش‌های تشخیصی مبتنی بر واکنش LAMP، تاکنون روش‌های زیادی بر مبنای واکنش PCR با استفاده از ژن STM4495 و ژن‌های دیگری از جمله invA، fliC، fljB، rfbJ، STM2755وSTM2235 ارائه شده‌اند (19-21). متأسفانه بسیاری از این ژن‌ها به دلیل اختصاصیت‌نداشتن ژن‌های هدف استفاده‌شده دچار چالش جدی شده‌اند؛ برای نمونه، ژن invA یک مارکر ژنتیکی عمومی برای شناسایی سرووارهای سالمونلا انتریکا است و به‌عنوان مارکری اختصاصی برای شناسایی سویه‌های سالمونلا تیفی‌موریوم استفاده نمی‌شود. ژن‌هایfliC، fljB و rfbJ که به‌ترتیب به واریانت‌های H1 و H2 آنتی‌ژن H و آنتی‌ژن O4 مربوط هستند، علاوه بر اینکه در سویه‌های سالمونلا تیفی‌موریوم وجود دارند، به‌ترتیب در سویه‌های متعلق به سرووارهای سالمونلا کنتاکی[xxiii]، آریزونا[xxiv] و ابونی[xxv] نیز یافت می‌شوند (10). به‌طور مشابه، ژن‌های STM2755 و STM2235 نیز علاوه بر سویه‌های سالمونلا تیفی‌موریوم به‌ترتیب در سایر سرووار‌های سالمونلا از جمله پاراتیفی B[xxvi] و هیدلبرگ[xxvii] یافت می‌شوند. مطالعه‌های بسیاری حساسیت روش‌های LAMP و PCR را مطالعه و حساسیت بیشتر روش LAMP نسبت به PCR را اثبات کرده‌اند (22-24). مقایسه نتایج آزمایش LAMP حاضر با روش‌های مبتنی بر PCR پیشین، حساسیت بیشتر این روش را نشان می‌دهد؛ برای نمونه، مقایسه آزمایش LAMP حاضر با روش Multiplex-PCR که به‌تازگی شانگسوند[xxviii] و همکاران بر اساس ژن‌های iroB، invA، STM2755 و STM4497ارائه کرده‌اند (10)، حساسیت بیشتر روش حاضر را نشان می‌دهد ( CFU/reaction10 در برابر CFU/reaction400-350). علاوه بر این، روش‌های مبتنی بر Multiplex-PCR، محدودیت‌های متعددی ازجمله پیچیدگی، کارایی کم تکثیر، کارایی متغیر DNA‌های الگو برای تکثیر و گران‌قیمت‌بودن را دارند (25 و 26). مقایسه روش حاضر با روش PCR که موسوی[xxix] و همکاران بر اساس ژن STM4497 ارائه کردند (9)، حساسیت بیشتر آزمایش حاضر را نشان می‌دهد (CFU/reaction10 در برابر CFU/reaction100). روش حاضر نسبت به روش PCR که لیو[xxx] و همکاران با استفاده از ژن STM4495 ارائه کردند (با حد تشخیص CFU/reaction23-22) نیز حساسیت بیشتری نشان می‌دهد (27).

کارایی روش‌های تشخیصی مختلف برای شناسایی سویه‌های سالمونلا تیفی‌موریوم در موارد بسیاری ازجمله گوشت و فراورده‌های گوشتی و نمونه‌های کلینیکی آلوده ارزیابی شده است (4، 6، 10 و 28). در مطالعه حاضر، کارایی روش LAMP در گوشت مرغ چرخ‌شده‌ای ارزیابی شد که به‌شکل مصنوعی به باکتری سالمونلا تیفی‌موریوم آلوده شده بود. نتایج نشان دادند که این روش نمونه‌هایی با 103≤ واحد تشکیل‌دهنده کلنی در آغاز انکوباسیون (زمان صفر) و 10 واحد تشکیل‌دهنده کلنی پس از 4 ساعت انکوباسیون را تشخیص می‌دهد. مطالعه‌هایی که تاکنون روی گوشت آلوده انجام شده‌اند، حدود تشخیص متفاوتی نشان می‌دهند؛ برای نمونه، حدود تشخیص روش‌هایی که تچتوانن[xxxi] و شانگسوند ارائه‌ کرده‌اند cfu/25g 100 پس از 10 ساعت انکوباسیون در گوشت خوک و cfu/g 60< پس از 16 ساعت انکوباسیون در مرغ آلوده گزارش شده است (10 و 20). فریتاس[xxxii] و همکاران نیز روش PCR با استفاده از ژن spyراارائه کرده‌اند که حساسیت cfu/mL1/0 در گوشت مرغ آلوده پس از 24 ساعت انکوباسیون دارد (6). آنالیزهای مطالعه حاضر روی توالی ژن spy با استفاده از BLASTn در پایگاه NCBI نشان دادند که این ژن با نواحی ژنی بسیاری از سویه‌های دیگر سالمونلا از جمله پاراتیفی A، کلرایسیس[xxxiii] و دوبلین[xxxiv] شباهت 100 درصدی دارد و بنابراین، مارکری اختصاصی برای تمایز سویه‌های سالمونلا تیفی‌موریوم نیست. از این رو، باوجود حساسیت زیاد این روش، به دلیل استفاده‌نشدن مارکر ژنی اختصاصی دچار چالش شده است. پارک[xxxv] و همکاران، روشی از Real-time PCR ارائه کردند که دارای حد تشخیص cfu/mL5/4 در گوشت مرغ آلوده بود (28). با وجود کارایی و حساسیت زیاد روش‌های مبتنی بر Real-time PCR، این روش‌ها همانند سایر روش‌های مبتنی بر PCR، نیازمند سیکل‌های حرارتی زیاد و در نتیجه استفاده از دستگاه‌های گران‌قیمت ترموسیکلر برای تکثیر DNA هستند و همچنین استفاده از ابزارهای گران‌قیمت و افراد متخصص برای آشکارسازی و تشخیص محصول‌ها در این روش نیاز است (14 و 29)؛ این در حالی است که روش استفاده‌شده در پژوهش حاضر بر پایه روش‌های تکثیر هم‌دمای DNA است و در این روش ساده (LAMP)، DNA به‌طور اختصاصی، با کارایی و حساسیت زیاد (10 کلنی در هر تیوب آزمون) در مدت زمان 1 ساعت و در شرایط هم‌دما تکثیر می‌‌شود. در این روش، به دستگاه‌های گران‌قیمت ترموسیکلر نیاز نیست و واکنش با استفاده از حمام آب گرم یا بلوک حرارتی بسیار ساده و ارزان‌ ساخت داخل کشور در دمای واحد (65 درجه سانتی‌گراد) انجام می‌شود. در این روش، آشکارسازی و شناسایی محصول‌های واکنش با مشاهده کدورت حاصل از فرایند تکثیر ژن‌ها که ناشی از رسوب منیزیم پیروفسفات در محیط واکنش است، به‌شکل چشمی و بدون نیاز به هیچ ابزاری امکان‌پذیر است و این قابلیت در بین تمام روش‌های مولکولی تکثیر DNA بی‌نظیر است (30). تجهیزات آزمایشگاهی و انکوباسیون ساده در این روش نیز آن را نسبت به سایر روش‌های مولکولی ازجمله Real-time PCR ساده‌تر و امکان انجام آن را با کمترین امکانات آزمایشگاهی فراهم می‌کند و این، گزینه‌ای حیاتی برای آزمایشگاه‌های سیار و آزمایشگاه‌های تشخیصی با تجهیزات اندک است. طراحی پرایمرهای اختصاصی و مناسب در هر واکنش LAMP، نقشی اساسی در افزایش کارایی واکنش دارد (31). نتایج حاصل از روش LAMP حاضر نشان دادند که پرایمر‌های طراحی‌شده به‌طور موفق و اختصاصی ناحیه مدنظر از ژن STM4497 را تکثیر می‌کنند. استفاده از پرایمر‌های لوپ علاوه بر پرایمر‌های داخلی و خارجی در آزمایش LAMP حاضر، اختصاصیت را افزایش و زمان لازم برای انجام واکنش را کاهش می‌دهند. در مجموع، روش حاضر ابزاری قدرتمند، دقیق و ارزان است که برای شناسایی سویه‌های سالمونلا تیفی‌موریوم در آزمایشگاه‌های کنترل کیفی مواد غذایی و آزمایشگاه‌های تشخیصی با تجهیزات اندک استفاده می‌شود.



[1]- Salmonella

[2]- Salmonella typhimurium

[3]- Loop-mediated isothermal amplification

[4]- Bst DNA polymerase

[5]- Kim

[6]- Blegdom

[7]- Enteritidis

[8]- Kuilsrivier

[9]- Nigeria

[10]- ParatyphiA

[11]- Rostock

[12]- Typhi

[13]- Escherichia coli

[14]- Shigella

[15]- Tryptic Soy Broth

[16]- Liofilchem

[17]- http://primerexplorer.jp/elamp4.0.0/index.html (PRIMER EXPLORER V4)

[18]- http://www.ncbi.nlm.nih.gov/

[19]- Sigma

[20]- New England Biolabs

[21]Bio-Rad

[xxii]Chen

[xxiii]Kentucky

[xxiv]Arizonae

[xxv]Abony

[xxvi]Paratyphi B

[xxvii]Heidelberg

[xxviii]Shanmugasund

[xxix]Mousavi

[xxx]Liu

[xxxi]Techathuvanan

[xxxii]Freitas

[xxxiii]Choleraesuis

[xxxiv]Dublin

[xxxv]Park

 

(1)              Dilmaghani M., Ahmadi M., Zahraei-Salehi T., Talebi A., editors. Detection of Salmonella enterica Serovar Typhimurium from avians using multiplex-PCR. Veterinary Research Forum 2012.

(2)              Xia S., Hendriksen RS., Xie Z., Huang L., Zhang J., Guo W., et al. Molecular characterization and antimicrobial susceptibility of Salmonella isolates from infections in humans in Henan province, China. Journal of clinical microbiology 2009; 47(2): 401-409.

(3)              Yang B., Qu D., Zhang X., Shen J., Cui S., Shi Y., et al. Prevalence and characterization of Salmonella serovars in retail meats of marketplace in Shaanxi, China. International journal of food microbiology 2010; 141(1): 63-72.

(4)              Jamshidi A., Kalidari G., Hedayati M. Isolation and identification of Salmonella Enteritidis and Salmonella Typhimurium from the eggs of retail stores in Mashhad, Iran using conventional culture method and multiplex PCR assay. Journal of food safety 2010; 30(3): 558-568.

(5)              Kim H., Park S., Lee T., Nahm B., Chung Y., Seo K., et al. Identification of Salmonella enterica serovar Typhimurium using specific PCR primers obtained by comparative genomics in Salmonella serovars. Journal of Food Protection 2006; 69(7): 1653-1661.

(6)              de Freitas CG., Santana AP., da Silva PH., Gonçalves VS., Barros Mde A., Torres FA., et al. PCR multiplex for detection of Salmonella enteritidis, typhi and typhimurium and occurrence in poultry meat. International journal of food microbiology 2010; 139(1): 15-22.

(7)              Akiba M., Kusumoto M., Iwata T. Rapid identification of Salmonella enterica serovars Typhimurium, Choleraesuis, Infantis, Hadar, Enteritidis, Dublin and Gallinarum, by multiplex PCR. Journal of microbiological methods 2011; 85(1): 9-15.

(8)              Lim Y-H., Hirose K., Izumiya H., Arakawa E., Takahashi H., Terajima J., et al. Multiplex polymerase chain reaction assay for selective detection of Salmonella enterica serovar Typhimurium. Japanese journal of infectious diseases 2003; 56(4): 151-155.

(9)              Mousavi SL., Rasooli I., Nazarian S., Amani J. Simultaneous detection of Escherichia coli O157: H7, toxigenic Vibrio cholerae, and Salmonella typhimurium by multiplex PCR. Archives of Clinical Infectious Diseases 2009; 4(2): 97-103.

(10)          Shanmugasundaram M., Radhika M., Murali H., Batra H. Detection of Salmonella enterica serovar Typhimurium by selective amplification of fliC, fljB, iroB, invA, rfbJ, STM2755, STM4497 genes by polymerase chain reaction in a monoplex and multiplex format. World Journal of Microbiology and Biotechnology 2009; 25(8): 1385-1394.

(11)          Soumet C., Ermel G., Rose N., Rose V., Drouin P., Salvat G., et al. Evaluation of a multiplex PCR assay for simultaneous identification of Salmonella sp., Salmonella Enteritidis and Salmonella Typhimurium from environmental swabs of poultry houses. Letters in Applied Microbiology 1999; 28(2): 113-117.

 

(12)          Zahraei Salehi T., Tadjbakhsh H., Atashparvar N., Nadalian M., Mahzounieh M. Detection and identification of Salmonella typhimurium in bovine diarrhoeic fecal samples by immunomagnetic separation and multiplex PCR assay. Zoonoses and public health 2007; 54(6‐7): 231-236.

(13)          Ardestani H., Mousavi Gargari SL., Nazarian S., Amani J. Rapid and Specific detection of Salmonella typhimurium by PCR-ELISA. Modares Journal of Medical Sciences: Pathobiology 2007; 10: 51-62.

(14)          Liu D. Molecular detection of foodborne pathogens: CRC Press; 2009.

(15)          Mothershed EA., Whitney AM. Nucleic acid-based methods for the detection of bacterial pathogens: present and future considerations for the clinical laboratory. Clinica Chimica Acta 2006; 363(1): 206-220.

(16)          Okamura M., Ohba Y., Kikuchi S., Suzuki A., Tachizaki H., Takehara K., et al. Loop-mediated isothermal amplification for the rapid, sensitive, and specific detection of the O9 group of Salmonella in chickens. Veterinary microbiology 2008; 132(1): 197-204.

(17)          Ravan H., Yazdanparast R. Development and evaluation of a loop-mediated isothermal amplification method in conjunction with an enzyme-linked immunosorbent assay for specific detection of Salmonella serogroup D. Analytica chimica acta 2012; 733: 64-70.

(18)          Notomi T., Okayama H., Masubuchi H., Yonekawa T., Watanabe K., Amino N., et al. Loop-mediated isothermal amplification of DNA. Nucleic acids research 2000; 28(12): e63-e.

(19)          Chen Z., Zhang K., Yin H., Li Q., Wang L., Liu Z. Detection of Salmonella and several common Salmonella serotypes in food by loop-mediated isothermal amplification method. Food Science and Human Wellness. 2015; 4(2): 75-79.

(20)          Techathuvanan C., Draughon FA., D'Souza DH. Loop‐mediated isothermal amplification (LAMP) for the rapid and sensitive detection of Salmonella typhimurium from Pork. Journal of food science 2010; 75(3): M165-M72.

(21)          Pavan Kumar P., Agarwal R., Thomas P., Sailo B., Prasannavadhana A., Kumar A., et al. Rapid detection of Salmonella enterica subspecies enterica serovar Typhimurium by loop mediated isothermal amplification (LAMP) test from field chicken meat samples. Food Biotechnology 2014; 28(1): 50-62.

(22)          Feng P. Identification of Escherichia coli serotype O157: H7 by DNA probe specific for an allele of uid A gene. Molecular and cellular probes 1993; 7(2): 151-154.

(23)          Ravan H., Yazdanparast R. Development of a new loop-mediated isothermal amplification assay for prt (rfbS) gene to improve the identification of Salmonella serogroup D. World Journal of Microbiology and Biotechnology 2012; 28(5): 2101-2106.

(24)          Li X., Zhang S., Zhang H., Zhang L., Tao H., Yu J., et al. A loop-mediated isothermal amplification method targets the phoP gene for the detection of Salmonella in food samples. International journal of food microbiology 2009; 133(3): 252-258.

(25)          Xu W., Bai W., Luo Y., Yuan Y., Zhang W., Guo X., et al. A novel common single primer multiplex polymerase chain reaction (CSP‐M‐PCR) method for the identification of animal species in minced meat. Journal of the Science of Food and Agriculture 2008; 88(15): 2631-2637.

(26)          Wen D., Zhang C. Universal multiplex PCR: a novel method of simultaneous amplification of multiple DNA fragments. Plant methods 2012; 8(1): 1.

(27)          Liu B., Zhou X., Zhang L., Liu W., Dan X., Shi C., et al. Development of a novel multiplex PCR assay for the identification of Salmonella enterica Typhimurium and Enteritidis. Food Control. 2012;27(1):87-93.

(28)          Park HJ., Kim HJ., Park SH., Shin EG., Kim JH., Kim HY. Direct and quantitative analysis of Salmonella enterica serovar Typhimurium using real-time PCR from artificially contaminated chicken meat. Journal of Microbiology and Biotechnology 2008; 18(8): 1453-1458.

(29)          Shahhosseiny MH., Ghahri M., Mahmoudi MA., Moslemi E. Standardization of diagnostic PCR by internal amplification control. Biological Journal of Microorganism 2015; 4(15): 55-68.

(30)          Karami A., Moradi A., Sorouri R., Ahmadi Z. Evaluation of LAMP (Loop-mediated isothermal DNA amplification) for molecular detection of Salmonella. Journal of Ilam University of medical sciences. 2009; 17(9): 1-9.

(31)          Ravan H., Amandadi M., Sanadgol N. A highly specific and sensitive loop-mediated isothermal amplification method for the detection of Escherichia coli O157: H7. Microbial pathogenesis 2016; 91: 161-165.