تشخیص مولکولی سریع بیماری لکه قهوه‌ای مرکبات با استفاده از ژن ACT در Alternaria alternata

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 استادیار میکروبیولوژی، دانشکده زیست‌شناسی، پردیس علوم، دانشگاه تهران، ایران

2 دانشجوی کارشناسی ارشد زیست‌فناوری میکروبی، دانشکده زیست‌شناسی، پردیس علوم، دانشگاه تهران، ایران

3 استاد میکروبیولوژی، دانشکده زیست‌شناسی، پردیس علوم، دانشگاه تهران، ایران

چکیده

مقدمه: امروزه استفاده از روش‌های شناسایی سریع عوامل بیماری‌زای گیاهی در پیشگیری از شیوع آفت‌ها در کشاورزی اهمیت بسیاری دارد. بیماری لکه قهوه‌ای از رایج‌ترین بیماری‌های مرکبات در کشور است که جدایه‌های بیماری‌زای Alternaria alternataآن را ایجاد می‌کنند.‏‏
مواد و روش‏‏ها: در پژوهش حاضر، برای نخستین بار روش مولکولی مبتنی بر PCR برای تشخیص سریع بیماری لکه قهوه‌ای ارائه شده است. به این منظور، از باغ‌های مرکبات کشور نمونه‌گیری و 9 جدایه A. alternata در محیط PDA حاصل شدند. بررسی فعالیت بیماری‌زایی گیاهی جدایه‌های حاصل روی برگ‌های نارنگی نشان داد که این جدایه‌ها عامل ایجاد بیماری لکه قهوه‌ای هستند. واکنش PCR برای ژن توکسین اختصاصی ACT روی DNA استخراج‌شده جدایه‌های A. alternate همراه با 11 نمونه قارچ غیر از A. alternata (شاهد منفی) و 5 نمونه DNA استخراج‌شده از خاک انجام شد.
نتایج: نتایج پژوهش حاضر نشان داد که با پرایمرهای طراحی‌شده و انجام PCR اختصاصی روی ژن ACT توکسین، A. alternata عامل بیماری لکه قهوه‌ای با‌دقت زیادی نسبت به انواع غیربیماری‌زا شناسایی می‌شود. نتایج روش PCR آشیانه‌ای نیز تأییدکنندۀ واکنش اولیه و اختصاصی‌بودن واکنش برای A. alternata عامل لکه قهوه‌ای بود. براساس نتایج PCR، برای نمونه شاهد هیچ‌یک از جدایه‌های استاندارد قارچی بجز A. alternata باند تکثیری مشاهده نشد. همچنین نمونه DNA استخراج‌شده از خاک باغ‌های آلوده حضور توکسین ACT را تأیید کرد.‏
بحث و نتیجه‏گیری: روش مولکولی ارائه‌شده در این پژوهش در تشخیص سریع و پیشگیری از عفونت لکه قهوه‌ای در باغ‌های مرکبات کشور استفاده می‌شود.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Rapid Molecular detection of citrus brown spot disease using ACT gene in Alternaria alternata

نویسندگان [English]

  • Hamid Moghimi 1
  • Amir Moradi 2
  • Javad Hamedi 3
1 Assistant professor in Microbiology, School of Biology, College of Science, University of Tehran, Tehran, Iran
2 M.Sc student in Microbial Biotechnology, School of Biology, College of Science, University of Tehran, Tehran, Iran
3 Professor of Microbiology, School of Biology, College of Science, University of Tehran, Tehran, Iran
چکیده [English]

Introduction:Using rapid detection methods is important for detection of plant pathogens and also prevention through spreading pests in agriculture. Citrus brown spot disease caused by pathogenic isolates of Alternaria alternata is a common disease in Iran.
Materials and methods: In this study, for the first time a PCR based molecular method was used for rapid diagnosis of brown spot disease. Nine isolates of A. Alternata were isolated in PDA medium from different citrus gardens. The plant pathogenic activity was examined in tangerine leaves for isolates. Results showed that these isolates are the agents of brown spot disease. PCR amplification of specific ACT-toxin gene was performed for DNA extracted from A. alternata isolates, with 11 different fungal isolates as negative controls and 5 DNA samples extracted from soil.
Results: Results showed that A. alternata, the causal agent of brown spot disease, can be carefully distinguished from other pathogenic agents by performing PCR amplification with specific primers for ACT toxin gene. Also, the results from Nested-PCR method confirmed the primary reaction and the specificity of A. alternata for brown spot disease. PCR results to control samples of the other standard fungal isolates, showed no amplification band. In addition, PCR with the DNA extracted from contaminated soils confirmed the presence of ACT toxin gene.
Discussion and conclusion: Molecular procedure presented here can be used in rapid identification and prevention of brown spot infection in citrus gardens all over the country.

کلیدواژه‌ها [English]

  • Brown spot
  • Molecular identification
  • Alternaria alternate
  • ACT toxin

مقدمه.

آفت‌ها مهم‌ترین چالش و عامل اصلی کاهش محصولات مختلف کشاورزی در دنیا محسوب می‌شوند. امروزه از آفت‌کش‌های شیمیایی مختلف نظیر انواع علف‌کش‌ها، حشره‌کش‌ها و قارچ‌کش‌ها به‌وفور استفاده می‌شود (1). از مهم‌ترین مشکلات استفاده از ترکیبات یادشده، مشکلات زیست‌محیطی و سمیت این ترکیبات و نیز مقاوم‌شدن عوامل بیماری‌زا نسبت به آنها هستند. جلوگیری از شیوع بیماری با شناسایی سریع و دقیق عوامل بیماری‌زا در مراحل ابتدایی بیماری و یا پیش از آن ازجمله راهکارهای مؤثر برای کاهش میزان استفاده از آفت‌کش‌ها و مشکلات ناشی از مصرف آنها و نیز کاهش میزان هدررفت محصول است. بر اساس این، روش‌های مختلفی پیشنهادشده که به‌کارگیری روش‌های شناسایی مبتنی بر اسیدهای نوکلئیک و به‌ویژه روش PCR بیشترین توجه و موفقیت را داشته است (2).

عوامل بیماری‌زای قارچی براساس توکسین‌هایی که تولید می‌کنند به دو دسته‌ عوامل بیماری‌زای اختصاصی برای میزبان و انواع غیراختصاصی دسته‌بندی می‌شوند (3). تا کنون، 20 توکسین اختصاصی میزبان در قارچ‌ها شناسایی شده‌اند که Alternaria alternata 7 نمونه از آنها را تولید می‌کند (4). جدول 1، طبقه‌بندی پاتوتایپ‌های گونه A. alternata را بر‌اساس توکسین‌های اختصاصی نشان می‌دهد؛ جدایه‌های مختلف A. alternata با تولید توکسین‌های متفاوت می‌توانند گیاهان مختلف را بیمار کنند و تقسیم‌بندی بر‌اساس الگوی تولید توکسین و بیماری‌زایی اختصاصی در گیاه تنها راه تشخیص این جدایه‌ها از یکدیگر است (5).‌

 

 

جدول 1‌- انواع پاتوتایپ‌های تولید‌کننده توکسین‌های اختصاصی میزبان در Alternaria alternata

منبع

توکسین

پاتوتایپ

میزبان

بیماری

4

AM توکسین I،II و III

پاتوتایپ سیب

سیب

بیماری لکه سیب

4

AF توکسین I، II و III

پاتوتایپ توت‌فرنگی

توت‌فرنگی

بیماری لکه سیاه توت‌فرنگی

7

AK توکسین I و II

پاتوتایپ گلابی ژاپنی

گلابی ژاپنی

بیماری لکه سیاه گلابی ژاپنی

5 و 6

ACT توکسین I و II

پاتوتایپ نارنگی

نارنگی

بیماری لکه قهوه‌ای نارنگی

6 و 8

ACR توکسین I

پاتوتایپ لیمو

لیمو

بیماری لکه برگ لیمو

7

AAL توکسین Ta و Tb

پاتوتایپ گوجه

گوجه فرنگی

Alternaria ایجاد‌کننده

غده در ساقه گوجه

6

AT توکسین

پاتوتایپ تنباکو

تنباکو

بیماری لکه قهوه‌ای تنباکو

 

 

 

 

تمام پاتوتایپ‌های A. alternataکه توکسین اختصاصی میزبان تولید می‌کنند آنامورف بوده و‌ از نظر ریخت‌شناسی بسیار به یکدیگر شبیه هستند (5). شناسایی‌نشدن از راه ریخت‌شناسی و ویژگی‌های میکروسکوپی ازجمله مشکلات شناسایی پاتوتایپ‌های مختلف A. alternata است و دلیل اصلی آن وجود تنها عامل تمایزی Aژن‌های تولید توکسین اختصاصی@ است؛ بر این اساس به‌طور رایج از روش سنجش فعالیت بیماری‌زایی و سنجش زیستی در گیاه میزبان برای شناسایی پاتوتایپ‌های مختلف A. alternataاستفاده می‌شود که روشی زمان‌بر و همراه باخطاست (5). امروزه ثابت شده توکسین‌های اختصاصی که این جدایه‌ها روی برگ و میوه گیاه تولید می‌کنند ازجمله عوامل ایجاد سرطان در انسان هستند.

بیماری لکه قهوه‌ای از بیماری‌های رایج مرکبات به‌ویژه نارنگی در سراسر دنیاست که پاتوتایپ بیماری‌زای نارنگی A. alternataآن را ایجاد می‌کند. این بیماری میزان محصول را کاهش می‌دهد و به‌ویژه در کشورهای آفریقای جنوبی، ترکیه، فلسطین اشغالی، ایران، اسپانیا، ایتالیا، یونان، برزیل، آرژانتین، پرو و کلمبیا بسیار گزارش شده است (5). ACT توکسین اختصاصی و عامل بیماری‌زای اصلی این پاتوتایپ است که روی درخت نارنگی و میوه آن تأثیر می‌گذارد (3). این توکسین از سه بخش اپوکسی دکاتری‌انوئیک اسید[1] (EDA)، آمینواسید والین و یک پلی‌کتاید با همکاری آنزیم‌های مختلف ساخته می‌شود (6). شکل 1، تصویر توکسین‌های اختصاصی میزبان ازجمله ACT توکسینی را نشان می‌دهد که پاتوتاتیپ‌های A. alternata تولید می‌کنند.

 

 

 

شکل 1- ساختار توکسین‌های اختصاصی میزبان که پاتوتایپ‌های A. alternata تولید می‌کنند

 

 

 

پژوهش‌های میاموتو[2] و همکاران در سال 2010 و آجیرو[3] و همکاران در سال 2010 نشان دادند ژن‌های actts2 و actts3 که به‌ترتیب کد‌کننده آنزیم‌های انویل‌ردکتاز[4] و پلی‌کتاید‌سنتاز[5] هستند فقط در پاتوتایپ تولید‌کننده توکسین اختصاصی ACT دیده می‌شوند (7 و 8).

براساس اطلاعات موجود، هدف پژوهش حاضر استفاده از ژن actts2 مولد توکسین ACT به‌عنوان نشانگر مولکولی برای تشخیص مولکولی مبتنی بر PCR قارچ بیماری‌زای‌ گیاهی A. alternata عامل بیماری لکه قهوه‌ای در مرکبات است.

 

‏‏مواد و روش‏ها.

نمونه‌برداری: 20 نمونه آلوده برگ و میوه نارنگی از مؤسسه تحقیقات مرکبات کشور در شهر رامسر برای جداسازی جدایه‌های بیماری‌زا جمع‌آوری شد. از عمق 3 تا 15 سانتی‌متری سطح خاک درختان سالم و بیمار مؤسسه تحقیقات مرکبات کشور نیز 5 نمونه برای استخراج DNA از خاک جمع‌آوری شد. نمونه‌های جمع‌آوری‌شده پس از انتقال به آزمایشگاه در دمای 4 درجه سانتی‌گراد قرار گرفتند.

کشت و جداسازی جدایه‌های بیماری‌زا: برای حذف‌کردن میکروفلور بومی، برگ‌های نکروزه و بیمار گیاه و بافت‌های آسیب‌دیده با محلول هیپوکلریدسدیم 5 درصد ضدعفونی سطحی شدند (9). سپس، نمونه‌ها در پلیت‌های حاوی محیط‌کشت [6]PDA و [7]PCA کشت و در دمای 20 درجه سانتی‌گراد قرار داده شدند. پس از 7 روز انکوباسیون جدایه، کلنی‌های حاصل خالص و در مجموعه میکروارگانیسم‌های دانشگاه تهران [8]UTMC ثبت و نگهداری شدند.

بررسی ریخت‌شناسی جدایه‌ها: شناسایی جدایه‌های جنس Alternariaبا بررسی ویژگی‌های ریخت‌شناسی جدایه‌های حاصل از طریق تهیه اسلاید‌ کالچر و رنگ‌آمیزی با لاکتوفنول کاتن بلو زیر میکروسکوپ و بر‌اساس کلید شناسایی (10) انجام شد.

سنجش زیستی بیماری‌زایی در گیاه: ابتدا، جدایه‌ها همراه با 4 نمونه قارچ‌ استاندارد غیربیماری‌زا در محیط PCA کشت شدند. نمونه‌های تشخیص داده شده جنس Alternaria 7 روز در دمای 18 درجه سانتی‌گراد و سایر نمونه‌های شاهد در دمای 28 درجه سانتی‌گراد گرماگذاری شدند. سپس با اسپورکش، کنیدی‌های قارچ‌ها جمع‌آوری و با لام نئوبار شمارش شدند و غلظت 105 اسپور در میلی‌لیتر در محلول بافر فسفات با اسیدیته 7 آماده شد. 1 میلی‌لیتر از محلول اسپوری آماده‌شده روی برگ‌های جوان و ضد‌عفونی‌شده نارنگی اسپری و برگ‌های تلقیح‌شده در محفظه‌های دارای رطوبت اشباع قرار داده شدند. برای نمونه شاهد منفی از قارچ‌های استاندارد و غیر از Alternaria به‌همراه محلول بافر فسفات به‌تنهایی استفاده شد. پلیت‌های آماده‌شده 3 روز در تاریکی نگهداری شدند و هر روز از نظر بروز علایم بیماری ارزیابی شدند. سنجش بیماری‌زایی روی برگ‌های نارنگی برای 20 جدایه بیماری‌زا و غیربیماری‌زا در دو آزمایش مستقل و در سه تکرار انجام شد.

.استخراج DNA از نمونه‌های جدا‌شده و خالص‌شده: جدایه‌های حاصل و نمونه‌های شاهد 48 ساعت در محیط PDB[9] و دمای 28 درجه سانتی‌گراد گرماگذاری شدند و سپس با سانتریفیوژ، میسیلیوم‌های قارچ از محیط‌کشت جدا شدند. زیست‌توده حاصل با سرم فیزیولوژی شسته شد و سلول‌ها با روش کوبیدن زیست‌توده منجمدشده با ازت مایع به‌شکل فیزیکی شکسته شدند. DNA قارچ از مخلوط سلولی حاصل به روش استخراج فنل و کلروفرم جداسازی شد (11).

استخراج DNA از خاک: برای بررسی وجودداشتن یا نداشتن قارچ مدنظر، 5 نمونه خاک‌ جداشده از مناطق مختلف جمع‌آوری و روش زیر برای استخراج DNA از خاک استفاده شد: 1/0 گرم خاک در هاون ریخته شد و 500 میکرولیتر محلول بافر Z (Na2HPO4، NaH2PO4 KCl، MgSO4، β- مرکاپتواتانول) و 100 میلی‌لیتر ازت مایع به آن اضافه و در حالت انجماد کوبیده شد. مخلوط حاصل به داخل ویال منتقل و هم‌وزن نمونه اولیه خاک،گلوله‌های شیشه‌ای (سیگما، آمریکا) به آن اضافه شد؛ ویال 5 مرتبه و هر بار 2 دقیقه ورتکس شد. در مرحله بعد، به محلول واکنش 1 درصد [10]CTAB اضافه و 30 دقیقه در دمای 37 درجه سانتی‌گراد گرماگذاری شد. سپس، 130 میکرولیتر محلول SDS 20 درصد به آن اضافه و 2 ساعت در دمای 65 درجه سانتی‌گراد گرماگذاری شد. محلول حاصل در 15000 دور در دقیقه سانتریفیوژ شد و پروتئین و لیپیدهای سلولی با افزدون فنل و کلروفرم از سوپرناتانت استخراج و DNA باقیمانده با اتانول رسوب داده شد (12).

.طراحی پرایمر و انجام واکنش زنجیره‌ای پلیمراز: طراحی پرایمرهای اختصاصی براساس ابتدا و انتهای ژن actts2 و با نرم‌افزار پرایمر-بلاست[11] انجام و دمای اتصال پرایمرها 52 درجه سانتی‌گراد محاسبه شد. همچنین، برای تأیید و شناسایی مولکولی جدایه‌های مثبت و بیماری‌زا از PCR ژن 18S rRNA به‌کمک پرایمرهای عمومی این ژن استفاده شد. هر واکنش PCR، حاوی 200 نانوگرم DNA به همراه 20 پیکومول از هر پرایمر بود و واکنش PCR برای ژن ACT توکسین در دمای اتصال پرایمر 52 درجه سانتی‌گراد و برای ژن 18S rRNA در دمای 51 درجه سانتی‌گراد انجام شد. جدول2، پرایمرهای استفاده‌شده در پژوهش حاضر را نشان می‌دهد.

واکنش زنجیره‌ای پلیمراز آشیانه‌ای[12]: برای تأیید تکثیر اختصاصی ژن actts2، واکنش زنجیره‌ای پلیمراز آشیانه‌ای با پرایمرهای داخلی طراحی ‌شده و به‌کمک نرم‌افزار پرایمر-بلاست انجام و دمای اتصال پرایمرها 54 درجه سانتی‌گراد محاسبه شد؛ ترتیب پرایمرها در جدول 2 مشاهده می‌شود و طول قطعه‌ای که این دو تکثیر انجام می‌دهند، 663 نوکلئوتید در نظر گرفته شد.

 

جدول 2- پرایمرهای استفاده‌شده در پژوهش حاضر

ژن هدف

اندازه (باز)

توالی (5'-3' )

پرایمر

پرایمرهای ژن actts2

ACTTS2

21

ATGTTGACTCGTCGTGCTCTC

Ac-F

ACTTS2

19

TTAATCGATCTTGTACACC

Ac-R

پرایمرهای ژن 18S rRNA

18S rDNA

24

TGGAATAATRRAATAGGAGCATTA

Nu-SSU-0717

18S rDNA

20

ATTGCAATGCYCTATCCCCA

Nu-SSU-1536

پرایمرهای PCR آشیانه‌ای

ACTTS2

19

CAAAGTCAAAGCTGTAGCC

Acn-F

ACTTS2

18

ATAGGTAGCAGCGCAGTG

Acn-R


توالی‌یابی محصول تکثیرشده: برای بررسی نتایج، محصول تکثیرشده PCR روی ژل آگارز 1 درصد الکتروفورز شد و پس از رنگ‌آمیزی، عکس ژل تهیه شد. همچنین برای توالی‌یابی باند‌های مد‌نظر از ژل با کمک کیت استخراج از ژل (ژل آل-کره جنوبی[13]) استخراج انجام و به شرکت ماکروژن کره جنوبی[14] ارسال شد. نتایج تعیین ترادف در بانک ژنی و از طریق هم‌ردیفی توالی ارزیابی شدند.

نتایج.

کشت و جداسازی جدایه‌های قارچی بیماری‌زا: در مرحله جداسازی قارچ بیماری‌زا، 15 جدایه حاصل شد که پس از مشاهدات میکروسکوپی و بررسی ویژگی‌های کلنی و شناسایی مولکولی، 9 نمونه از آنها به‌عنوان A. alternata شناسایی شدند. شکل 2، ریخت‌شناسی کلنی در محیط PDA و تصویر میکروسکوپی یکی از جدایه‌ها را نشان می‌دهد. جدایه‌های حاصل در مجموعه میکروارگانیسم‌های دانشگاه تهران ثبت و نگهداری شدند. از سویه A. alternataاستاندارد و بیماری‌زا در سایر گیاهان استفاده شد و سویه‌های استاندارد قارچی غیر از Alternaria، نمونه‌های شاهد بودند.

سنجش زیستی بیماری‌زایی جدایه‌ها روی برگ گیاه: برای بررسی توانایی تولید توکسین و قابلیت جدایه‌ها برای ایجاد بیماری در گیاه، آزمایش فیتوپاتوژنسیتی روی برگ‌های تازه نارنگی با اسپور 20 قارچ مختلف لیست‌شده در جدول 3 انجام شد. شکل 3، نتیجه تست بیماری‌زایی تعدادی از جدایه‌ها را روی برگ‌های نارنگی نشان می‌دهد؛ پس از 5 روز، در برگ‌های شاهد که تنها با بافر اسپری شده‌ بودند و برگ‌های تلقیح‌شده با جدایه‌هایی غیر از A. alternata پاتوتایپ نارنگی تغییری مشاهده نشد ولی در برگ‌های تلقیح‌شده با اسپورهای جدایه‌های جداشده از نمونه‌های بیمار تغییر‌‌ رنگ و بافت برگ و ایجاد بیماری به‌وضوح دیده شد. نتایج سنجش بیماری‌زایی جدایه‌های آزمایش‌شده روی برگ‌های نارنگی در جدول 3 مشاهده می‌شود.

 

 

 

شکل 2- 1- برگ‌های بیمار گیاه نارنگی استفاده‌شده برای جداسازی Alternaria، 2. میسلیوم‌های رشدکرده قارچ A. alternata روی پلیت‌های PDA پس از 7 روز انکوباسیون، 3. کنیدی‌های A. alternata زیر میکروسکوپ با بزرگنمایی 400

 

 

شکل 3- نتایج حاصل از سنجش بیماری‌زایی روی برگ‌های نارنگی پس از 5 روز؛ 1. برگ اسپری‌شده با بافر به‌تنهایی، 2. برگ اسپری شده با A. alternata UTMC 5014 (پاتوتایپ گلابی)، 3. برگ اسپری‌شده با A.alternata UTMC 5016 (پاتوتایپ سیب)، 4. برگ اسپری‌شده با Aspergillus niger UTMC 5020، 5. برگ اسپری‌شده با  Fusarium oxysporum UTMC 5019، 6. برگ اسپری‌شده با A.alternata UTMC 5005 (پاتوتایپ نارنگی)، 7. برگ اسپری‌شده با A.alternata UTMC 5006 (پاتوتایپ نارنگی)، 8. برگ اسپری‌شده با A.alternata UTMC 5009 (پاتوتایپ نارنگی)، 9. برگ اسپری‌شده با A. alternata UTMC 5010 (پاتوتایپ نارنگی) و 10. برگ اسپری‌شده با A. alternata UTMC 5012 (پاتوتایپ نارنگی)

 


واکنش زنجیره‌ای پلیمراز و PCR آشیانه‌ای[15]با پرایمرهای اختصاصی ژن ACT توکسین: در شکل 4-1 نتایج واکنش PCR با پرایمرهای اختصاصی طراحی‌شده برای ژن ACT توکسین در 14 نمونه مشاهده می‌شود. نتیجه PCR برای 8 جدایه بیماری‌زا و 2 نمونه خاک، حضور یک باند 1000 نوکلئوتیدی را نشان می‌دهد. نتیجه PCR ژن اختصاصی actts2 برای پاتوتایپ‌های سیب، گوجه، لیمو و گلابی A. alternata و همچنین سایر قارچ‌های شاهد غیر از A. alternataمنفی بود و هیچ تکثیری مشاهده نشد. تعیین توالی محصول PCR حاصل از ژن actts2 و انجام هم‌ردیفی آن در بانک ژنی نشان داد که محصول حاصل ژن مولد توکسین ACT بوده و توالی حاصل با شماره دسترسی KM198326 در بانک ژنی به ثبت رسید.

 

 

شکل 4- 1- تصویر ژل الکتروفورز محصول PCR ژن actts2 در تعدادی از جدایه‌های آزمایش‌شده، 2. تصویر محصول تکثیر‌شده PCR مربوط به ژن 18S rRAN، 3. تصویر ژل الکترفورز مربوط به  نستد PCR برای تعدادی از جدایه‌های آزمایش‌شده. اعداد نمایش داده شده کد ثبت‌شده جدایه‌ آزمایش‌شده هستند و نام کامل جدایه در جدول 3 آورده شده است. نمونه‌های خاک نیز با S1 تا S5 نشانه‌گذاری شده‌اند

شکل 4-2-  نتیجه انجام PCR ژن 18S rRNA با پرایمرهایnu-SSU-0817 و nu-SSU-1536 را برای تعدادی از جدایه‌های آزمایش‌شده روی ژل 1 درصد آگارز نشان می‌دهد. تکثیر ژن 18S rRNA در این جدایه‌ها، شاهد مثبت واکنش PCR و کیفی بودن نمونه‌های DNA استخراج‌شده از جدایه‌های مختلف در نظر گرفته شد و درستی شناسایی جدایه‌ها با تعیین ترادف ژن تکثیرشده در نمونه‌های جداسازی‌شده و انطباق توالی با بانک ژنی تأیید شد.

شکل 4-3- نتایج حاصل از انجام واکنش زنجیره‌ای پلیمراز آشیانه‌ای با پرایمرهای طراحی‌شده در قسمت داخلی ژن actts2 برای چهار جدایه مثبت A. alternata پاتوتایپ نارنگی را نشان می‌دهد. طبق انتظار واکنش انجام‌شده، قطعه‌ای به طول 663 نوکلئوتید تکثیر شد که بسیار اختصاصی‌بودن پرایمرهای طراحی‌شده را نشان می‌دهد.

 


بحث و نتیجه‏‏گیری.

جنس Alternaria دارای گونه‌های بیماری‌زا و غیربیماری‌زا است. 7 سویه از A. alternata که به سویه‌های Keissler شهرت دارند قابلیت تولید مایکوتوکسین‌های اختصاصی گیاه را دارند و نمی‌توان آنها را براساس ویژگی‌های ریخت‌شناسی تشخیص داد (8)؛ به همین دلیل، این سویه‌ها به‌نام پاتوتایپ‌های مختلف A. alternata شناخته می‌شوند. این پاتوتایپ‌ها میزبان‌های محدودی دارند و براساس توکسین‌های اختصاصی طبقه‌بندی می‌شوند که در آنها برای ایجاد بیماری ضروری هستند (3).

به‌طور کلی، پذیرش عمومی برای دسته‌بندی پاتوتایپ‌های تولیدکننده توکسین اختصاصی میزبان در A. alternataوجود ندارد (13 و 14) و دلیل این امر، طبقه‌بندی براساس ریخت‌شناسی کنیدی است که برای تشخیص پاتوتایپ‌ها ناتوان است (8).

 

جدول 3- فهرست جدایه‌های استفاده‌شده در آزمایش بیماری‌زایی روی برگ‌های نارنگی و نتیجه حاصل از انجام واکنش PCR روی ژن actts2 آنها

نوع قارچ

پاتوتایپ

نوع بیماری

توکسین اختصاصی

بیماری‌زایی درگیاه نارنگی

PCR

A. alternata (UTMC 5005)

نارنگی

لکه قهوه‌ای

ACTتوکسین

+

+

جدایه 1

(UTMC 5006)

نارنگی

لکه قهوه‌ای

ACTتوکسین

+

+

جدایه 2

(UTMC 5007)

نارنگی

لکه قهوه‌ای

ACTتوکسین

+

+

جدایه 3

(UTMC 5008)

نارنگی

لکه قهوه‌ای

ACTتوکسین

+

+

جدایه 4

(UTMC 5009)

نارنگی

لکه قهوه‌ای

ACTتوکسین

+

+

جدایه 5

(UTMC 5010)

نارنگی

لکه قهوه‌ای

ACTتوکسین

+

+

جدایه 6

(UTMC 5011)

نارنگی

لکه قهوه‌ای

ACTتوکسین

+

+

جدایه 7

(UTMC 5012)

نارنگی

لکه قهوه‌ای

ACTتوکسین

+

+

جدایه 8

(UTMC 5013)

نارنگی

لکه قهوه‌ای

ACTتوکسین

+

+

A. alternata (UTMC 5016)

سیب

خال و لکه سیب

توکسین AM

-                       

-                       

A. alternata

(UTMC 5015)

گوجه

خوره ساقه گوجه

توکسین AAL

-                       

-                     

A. alternate (UTMC 5017)

لیمو

لکه برگ لیمو

توکسین ACR

-                       

-                       

A. alternata

(UTMC 5014)

گلابی

لکه سیاه

توکسین AK

-                       

-                       

Fusarium oxysporum

(UTMC 5019)

گوجه فرنگی

-

-

-                       

-                       

Aspergillus niger

(UTMC 5020)

-

-

-

-                       

-                       

Rhizoctonia solani (UTMC 5022)

لوبیا

-

-

-                       

-                       

Ulocladium Sp (UTMC 5018)

-

-

-

-                       

-                       

Fusarium equiseti

(UTMC 5001)

-

-

-

-                       

-                       

Metarhizium anisopliae

(UTMC 5002)

-

-

-

-                       

-                       

Phaeosphaeria Sp (UTMC 5003)

-

-

-

-                       

-                       

نمونه خاک 1

-

-

-

-

-                       

نمونه خاک 2

-

-

-

-

+

نمونه خاک 3

-

-

-

-

-                       

نمونه خاک 4

-

-

-

-

-                       

نمونه خاک 5

-

-

-

-

+

             

 

 

 نتایج پژوهش حاضر نشان داد که PCR با پرایمرهای ژن actts2 می‌تواند به‌طور اختصاصی در تشخیص پاتوتایپ نارنگی استفاده شود. همچنین، برای تشخیص مولکولی سویه‌های بیماری‌زای A. alternataنیزتلاش‌هایی انجام شده است؛ برای مثال، کونیناگا[xvi] و همکاران نشان دادند که هیبریدکردن DNA با DNA بین سویه‌های A. alternataغیربیماری‌زا و سویه‌های تولیدکننده توکسین ارتباط نزدیکی وجود دارد (15). همچنین آنالیزهای RFLP بین سویه‌های تولیدکننده توکسین اختصاصی میزبان و گونه‌های غیربیماری‌زا نشان داد که با این روش نمی‌توان گونه‌های مختلف را از یکدیگر جدا کرد (16). نتایج تکثیر نواحی ITS نیز در تشخیص پاتوتایپ‌ها ناتوان بود (17). نمونه‌های موفقی نیز گزارش شده است؛ برای مثال، امباگا[xvii] و همکاران در سال 2011 از PCR نواحی ITS برای تشخیص A. alternataعامل بیماری از انواع غیربیماری‌زا در گیاه یاس خوشه‌ای استفاده کردند (18).در سال 2000 نیز در پژوهش جانسون[xviii] و همکاران A. alternataپاتوتایپ سیب به‌شکل اختصاصی با PCR و پرایمرهای اختصاصی برای AM-toxin  شناسایی شد (5). در مطالعه دیگری که با روش RAPD-PCR و مقایسه الگوی DNA بین پاتوتایپ‌های مختلف A. alternata انجام شد، 5 الگوی مختلف با میزان شباهت بیش از 85 درصد گزارش شد (19). بر‌اساس نتایج جدول 3 و شکل 4 می‌توان گفت که انجام PCR روی ژن actts2 کاملاً اختصاصی بوده و با این روش می‌توان به‌آسانی پاتوتایپ‌های A. alternataمولد بیماری در سیب، گلابی، لیمو و گوجه فرنگی را از پاتوتایپ نارنگی و همچنین سایر انواع قارچ‌ها تشخیص داد. همچنین، براساس نتایج DNA خاک، چنانچه سویه مولد بیماری در خاک وجود داشته باشد می‌توان حضور آن را ثابت کرد (شکل 4). براساس نتایج بررسی DNA حاصل از خاک، دو نمونه خاک حضور ژن actts2 را نشان دادند و 3 نمونه حضور ژن مدنظر را نشان ندادند. این نتایج نشان داد که می‌توان حضور میکروارگانیسم بیماری‌زا در خاک را با این روش تشخیص داد و این نتیجه می‌تواند در پیشگیری از گسترش بیماری در مراحل ابتدایی شیوع آن مفید باشد. گفتنی است که نمونه‌های قارچی نسبت به نمونه‌های خاک با دقت بیشتری حضور عامل بیماری لکه قهوه ای را نشان می‌دهند.



[1]- Epoxy-decatrienoic acid

[2]- Miyamoto

[3]- Ajiro

[4]- Enoyl reductase

[5]- Polyketide synthase

[6]- Potato Dextrose Agar

[7]- Potato Carrot Agar

[8]- University of Tehran Microorganisms Collection

[9]- Potato Dextrose Broth

[10]- Cetyltrimethylammonium bromide

[11]- Primer-BLAST

[12]- Nested PCR

[13]- Gene all, South Korea

[14]- Macro gene, South Korea

[15]- Nested PCR

[xvi]- Kuninaga

[xvii]- Mmbaga

[xviii]- Johnson

(1)              Bull D. A growing problem: pesticides and the Third World poor. Oxford: 1982.

(2)              Henson JM., French RC. The polymerase chain reaction and plant disease diagnosis. Annual Review of Phytopathology 1993; 31(1): 81-109.

(3)              Tsuge T., Harimoto Y., Akimitsu K., Ohtani K., Kodama M., Akagi Y., et al. Host‐selective toxins produced by the plant pathogenic fungus Alternaria alternata. FEMS microbiology reviews 2013; 37(1): 44-66.

(4)              Walton JD. Host-selective toxins: agents of compatibility. The plant cell 1996; 8(10): 1723-1733.

(5)              Johnson R., Johnson L., Kohmoto K., Otani H., Lane C., Kodama M. A polymerase chain reaction-based method to specifically detect Alternaria alternata apple pathotype (A. mali), the causal agent of Alternaria blotch of apple. Phytopathology 2000; 90(9): 973-976.

 

 

(6)              Kohmoto K., Itoh Y., Shimomura N., Kondoh Y., Otani H., Kodama M., et al. Isolation and biological activities of two host-specific toxins from the tangerine pathotype of Alternaria alternata. Phytopathology 1993; 83(5): 495-502.

(7)              Ajiro N., Miyamoto Y., Masunaka A., Tsuge T., Yamamoto M., Ohtani K., et al. Role of the host-selective ACT-toxin synthesis gene actts2 encoding an enoyl-reductase in pathogenicity of the tangerine pathotype of Alternaria alternata. Phytopathology 2010; 100(2): 120-126.

(8)              Miyamoto Y., Masunaka A., Tsuge T., Yamamoto M., Ohtani K., Fukumoto T., et al. actts3 encoding a polyketide synthase is essential for the biosynthesis of ACT-toxin and pathogenicity in the tangerine pathotype of Alternaria alternata. Molecular plant-microbe interactions 2010; 23(4): 406-414.

(9)              Hamedi J., Moghimi H., Papiran R., Mohammadipanah F. Screening of phytotoxic activity and nlp genes from rhizosphere actinomycetes. Annals of Microbiology 2014; 1-6.

(10)          Watanabe T. Pictorial atlas of soil and seed fungi: morphologies of cultured fungi and key to species. 3rd ed.  Boca Raton: CRC Press/Taylor and Francis; 2010.

(11)          Green MR., Sambrook J. Molecular cloning: A Laboratory Manual. 4th ed. Cold Spring Harbor, N. Y.: Cold Spring Harbor Laboratory Press; 2012.

(12)          Zhou J., Bruns MA., Tiedje JM. DNA recovery from soils of diverse composition. Applied and environmental microbiology 1996; 62(2): 316-322.

(13)          Nishimura S., Kohmoto K. Host-specific toxins and chemical structures from Alternaria species. Annual Review of Phytopathology 1983; 21(1): 87-116.

(14)          Nishimura S., Sugihara M., Kohmoto K., Otani H. Two different phases in pathogenicity of the Alternaria pathogen causing black spot disease of Japanese pear. Journal of the Faculty of Agriculture, Tottori University 1978; 13(1): 1-10.

(15)          Kuninaga S., Yokosawa R. Studies on the taxonomy of plant pathogenic fungi by a comparison of DNA homology. I. Genetic relatedness among species in the genus Alternaria. Annals of the Phytopathological Society of Japan 1987; 53(1): 368-369.

(16)          Kusaba M., Tsuge T. Nuclear ribosomal DNA variation and pathogenic specialization in Alternaria fungi known to produce host-specific toxins. Applied and environmental microbiology 1994; 60(9): 3055-3062.

(17)          Kusaba M., Tsuge T. Phologeny of Alternaria fungi known to produce host-specific toxins on the basis of variation in internal transcribed spacers of ribosomal DNA. Current Genetics 1995; 28(5): 491-498.

(18)          Mmbaga MT., Kim MS. Identification of Alternaria alternata as a causal agent for leaf blight in Syringa species. The Plant Pathology Journal 2011; 27(2): 120-127.

(19)          Kakvan N., Zamanizadeh H., Morid B., Taheri H., Hajmansor S. Study on pathogenic and genetic diversity of Alternaria alternata isolated from citrus hybrids of Iran, based on RAPD-PCR technique. European Journal of Experimental Biology 2012; 2(3):570-576.