شناسایی نمونه‌ای از قارچ سپید پوساننده و ارزیابی توان آن در زیست‌بهسازی خاک‌های آلوده به هیدروکربن‌های نفتی

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 دانشجوی دکتری زیست‌فناوری، پژوهشکده زیست‌فناوری، سازمان پژوهش‌های علمی و صنعتی ایران، تهران، ایران

2 استاد زیست‌فناوری، پژوهشکده زیست‌فناوری، سازمان پژوهش‌های علمی و صنعتی ایران، تهران، ایران

3 استادیار ژنتیک مولکولی، پژوهشکده زیست‌فناوری، سازمان پژوهش‌های علمی و صنعتی ایران، تهران، ایران

4 استادیار مهندسی علوم خاک، پژوهشکده زیست‌فناوری، سازمان پژوهش‌های علمی و صنعتی ایران، تهران، ایران

5 استادیار ژنتیک، دانشگاه شهرکرد، شهرکرد، ایران

6 کارشناس ارشد مدیریت محیط‌زیست، پالایشگاه اصفهان، ایران

چکیده

مقدمه: زدودن هیدروکربن‌های نفتی از خاک و منابع طبیعی مانند آب یا کاهش دادن آنها از چالش‌های جدی کشورها به‌ویژه کشورهای نفت‌خیز جهان به شمار می‌رود. بهره‌گیری از کمپوست قارچ‌های سپید پوساننده می‌تواند در زیست‌بهسازی خاک‌های آلوده به هیدروکربن‌های نفتی کارایی داشته باشد. هدف از این پژوهش، شناسایی مولکولی نمونه‌ای از قارچ سپید پوساننده و ارزیابی توانایی آن در زیست‌بهسازی خاک‌های آلوده به هیدروکربن‌های نفتی است.‏‏
مواد و روش‏‏ها: پسماند کمپوست قارچ سپید پوساننده به نسبت 3، 5 و 10 درصد با نمونه خاک آلوده به هیدروکربن‌های نفتی آمیخته شد. تیمارها 3 ماه در دمای 23 تا 25 درجه سانتی‌گراد نگهداری و هر 48 ساعت مطابق با گنجایش خاک برای نگهداری آب، آبیاری و زیرورو شدند. کاهش میزان هیدروکربن‌های نفتی خاک به روش گازکروماتوگرافی بررسی و اکوتوکسیسیته خاک تیمارشده به روش جوانه‌زنی بذر ارزیابی شد. ‏‏
نتایج: برپایه ترادف ژنتیکی S rRNA18 قارچ بررسی‌شده، گانودرما لوسیدوم شناسایی و با شماره KX525204 در بانک جهانی ژن ثبت شد. درصد کاهش هیدروکربن‌های نفتی در خاک تیمارشده با کمپوست 3، 5 و 10 درصد بین 42 تا 71 درصد تعیین شد. جوانه‌زنی بذر در تیمارهای گوناگون خاک بین 8/20 تا 8/70 درصد بود. نتایج کروماتوگرافی گازی نیز کاهش ترکیبات هیدروکربنی خاک را نشان داد.‏
بحث و نتیجه‏گیری: پسماند قارچ سپید پوساننده گانودرما لوسیدوم توانایی زدودن هیدروکربن‌های نفتی را از خاک‌های آلوده دارد. با افزایش میزان کمپوست آمیخته‌شده با خاک آلوده، درصد زدودن هیدروکربن‌ها نیز افزایش یافت. تیمار خاک آلوده به هیدروکربن‌های نفتی با 10 درصد پسماند کمپوست قارچ گانودرما لوسیدوم طی 3 ماه برای زدودن آلودگی‌های نفتی خاک بهتر از تیمارهای دیگر است.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Molecular identification and potential of an isolate of white rot fungi in bioremediation of petroleum contaminated soils

نویسندگان [English]

  • Maryam Mohammadi-sichani 1
  • Mahnaz Mazaheri asadi 2
  • Abbas Farazmand 3
  • Mehran Kianirad 4
  • Ali mohammad Ahadi 5
  • Hadi Hadian Ghahderijani 6
1 PhD candidate for Biotechnology, Iranian Research Organization for Science & Technology (IROST), Tehran, Iran
2 Professor of Industrial and environmental biotechnology, Iranian Research Organization for Science & Technology (IROST), Tehran, Iran
3 Assistant Professor of Molecular Genetics, Iranian Research Organization for Science & Technology (IROST), Tehran, Iran
4 Assistant Professor of Geology, Iranian Research Organization for Science & Technology (IROST), Tehran, Iran
5 Assistant Professor of Genetics, Shahrekord University, Iran
6 M.Sc of Environmental management, Isfahan Refinery Company, Isfahan, Iran
چکیده [English]

Introduction:Elimination or reduction of petroleum hydrocarbons from natural resources such as water and soil is a serious problem of countries, particularly oil-rich countries of the world. Using white rotting fungi compost for bioremediation of soils contaminated by petroleum hydrocarbons is effective. The aim of this study is molecular identification and potential of anisolate of white rot fungi in bioremediation of petroleum contaminated soils.
Materials and methods: Spent compost of white rotting fungi was inoculated with petroleum contaminated soil into 3%, 5% and 10% (w/w). Treatments were incubated at 25-23 °C for 3 months. Reduction of petroleum hydrocarbons in treated soil was determined by gas chromatography. Ecotoxicity of soil was evaluated by seed germination test.
Results: Based on the genome sequence of 18s rRNA, it is revealed that this isolate is Ganoderma lucidum and this isolate is deposited as accession KX525204 in the Gene Bank database. Reduction of petroleum hydrocarbons in soil treated with compost (3, 5 and 10%) ranged from 42% to 71%. The germination index (%) in ecotoxicity tests ranged from 20.8% to 70.8%. Gas chromatography results also showed a decrease in soil Hydrocarbons compounds.
Discussion and conclusion: The compost of Ganoderma lucidum, a white rot fungus, has a potential ability to remove petroleum hydrocarbons in contaminated soil. Removal of hydrocarbons was increased with increase in compost mixed with contaminated soil. Petroleum contaminated soil amended with spent compost of G.lucidum 10% during three months is appropriate to remove this pollutant.

کلیدواژه‌ها [English]

  • White rotting fungi
  • Bioremediation
  • Biodegradation
  • Ganoderma Lucidum

مقدمه.

سالیان بسیاری است که زیستگاه‌های پیرامون پالایشگا‌ه‌ها درگیر آلودگی محیط‌زیست با هیدروکربن‌های نفتی هستند. روش‌های فیزیکی و شیمیایی گوناگونی برای کاهش هیدروکربن‌های نفتی خاک پیشنهاد شده‌ ولی بررسی‌ها نشان داده‌‌اند که روش‌های زیست‌بهسازی در کاهش این آلاینده‌ها دارای سازگاری بیشتر با محیط و ارزان‌قیمت هستند (1و 2).

در سال‌های گذشته به فروزینگی زیستی با قارچ‌های سپید پوساننده بسیار توجه شده است. این قارچ‌ها با ساخت و رهاسازی آنزیم‌های برون‌یاخته‌ای مانند لیگنین‌اکسیداز، منگنزاکسیداز و لاکاز ترکیبات آلی را می‌شکنند. میل ترکیبی‌ این آنزیم‌ها برای پیوستن به پیش‌ماده چندان ویژه نیست و ازاین‌رو می‌توانند مولکول‌های سنگین و چندحلقه‌ای را آبکافت کنند که همانند لیگنین باشند. گروه گسترده‌ای از ترکیبات آلی پایدار با آنزیم‌های قارچ‌های سپید پوساننده فروزینه می‌شوند (3).  قارچ‌های سپید پوساننده در مقایسه با باکتری‌های تجزیه‌کننده هیدروکربن‌های نفتی در محیط‌هایی با فعالیت آبکی کمتر رشد می‌کنند. پسماند کمپوست قارچ‌ها دارای حجم زیادی از میسلیوم‌های قارچ و آنزیم‌های تراوش‌یافته آنهاست؛ همچنین میزان فراوانی کاه دارد که با نگهداری رطوبت لازم برای رشد میسلیوم‌های قارچ، تخلخل لازم برای رشد هوازی قارچ و دیگر ریزجانداران تجزیه‌کننده را فراهم می‌کند (4-6).

قارچ فانروکت کرایزوسپوریوم[1] از شناخته‌شده‌ترین قارچ‌های سپید پوساننده است که برای شکستن مولکول‌های سنگین هیدروکربن‌های نفتی، زنوبیوتیک‌ها و ترکیبات آلی کلردار کاراست (7). همچنین، بررسی‌ها نشان داده‌اند که پلوروتوس استراتوس[2]، لنتی‌نولا ایدودس[3]، پلوروتوس توبرژینیوم[4] و پلوروتوس پولموناریوس[5]نیز توان تجزیه زیستی هیدروکربنهای نفتی را دارند (8-13).

هدف این پژوهش، ارزیابی توانایی فروزینگی زیستی پسماند کمپوست نمونه‌ای از قارچ سپید پوساننده در زیست‌بهسازی خاک‌های آلوده به نفت پالایشگاه اصفهان بود و این قارچ با بهره‌گیری از روش‌های مولکولی شناسایی شد.

 

‏‏مواد و روش‏ها.

کشت قارچ و فرآوری کمپوست قارچ خوراکی: در این پژوهش، نمونه‌ای از میسلیوم‌های قارچ سپید پوساننده ناشناخته‌ای آزمایش شد که از پسماند گیاهی در نواحی جنگلی شمال ایران جداسازی شده بود. میسلیوم‌های این قارچ طی چند مرحله کشت ‌روی محیط کشت PDA و تهیه محلول‌های تک‌اسپور خالص شدند. برای آماده‌سازی اسپان قارچ، میسلیوم‌ها تا سپیدشدن همه آنها روی دانه‌های گندم سترون رشد داده شدند. اسپان به کمپوستی برپایه کاه گندم مایه‌زنی و چهار هفته در دمای 22 درجه‌ سانتی‌گراد نگهداری شد. کمپوست سپیدشده همانند زادمایه در آزمایش فروزینگی زیستی خاک‌های آلوده به هیدروکربن‌های نفتی بهره‌گیری شد.

در این پژوهش، از خاک آلوده به هیدروکربن‌های نفتی پالایشگاه اصفهان نمونه‌گیری شد. خاک آلوده از الک 2 میلی‌متری گذرانده و ویژگی‌های فیزیکوشیمیایی آن شامل رطوبت، اسیدیته و هدایت الکتریکی اندازه‌گیری شد. عناصر کربن، هیدروژن، نیتروژن و گوگرد موجود در نمونه خاک با دستگاه آنالیز عنصری CHNS سنجیده شد.

آماده‌سازی میکروکاسم‌ها: حدود100 گرم خاک آلوده به هیدروکربن‌های نفتی در گلدان‌های کوچک ریخته شد. کمپوستی که با رشد میسلیوم قارچ به‌خوبی سپید شده بود به نسبت 3، 5 و 10 درصد به خاک هر گلدان افزوده و کامل با خاک آمیخته شد. کود اوره، فسفات و پتاس به نسبت 20 : 10 : 10 به خاک برخی از گلدان‌ها افزوده شد. گلدان شاهد دارای خاک آلوده‌ با 10 درصد کمپوست سترون بود (جدول 1).

گلدان‌ها 3 ماه در گلخانه با دمای22 تا 25 درجه سانتی‌گراد نگهداری و برای حفظ رطوبت و اکسیژن خاک، یک روز در میان برپایه گنجایش آبی خاک آبیاری و کامل زیرورو شدند تا اکسیژن برای ریزجانداران فراهم شود. برای بررسی روند تجزیه هیدروکربن‌های نفتی، در فواصل زمانی 1، 2 و 3 ماه از خاک هر گلدان نمونه‌برداری شد. هیدروکربن‌های نفتی خاک با دی‌کلرومتان استخراج و جذب نوری آنها با اسپکتروفتومتر خوانده شد. هیدروکربن‌های نفتی خاک اولیه و خاک تیمارشده با کمپوست قارچ پس از 3 ماه به روش گازکروماتوگرافی ارزیابی شدند.

 

جدول 1- میکروکاسم‌های بهره‎گیری‌شده در آزمایش

سری آزمایش

بخش‌های سازنده

A

خاک آلوده دارای 3 درصد کمپوست سپیدشده

B

خاک آلوده + 3 درصد کمپوست سپیدشده + کود اوره، فسفات و پتاس

C

خاک آلوده + 5 درصد کمپوست سپیدشده

D

خاک آلوده + 5 درصد کمپوست سپیدشده + کود اوره، فسفات و پتاس

E

خاک آلوده + 10 درصد کمپوست سپیدشده

F

خاک آلوده + 10 درصد کمپوست سپیدشده+ کود اوره، فسفات و پتاس

شاهد

خاک آلوده + 10 درصد کمپوست سترون + کود اوره، فسفات و پتاس

استخراج هیدروکربن‌های نفتی از خاک: برای استخراج هیدروکربن‌های نفتی، 1 گرم خاک آلوده وزن و به آن 5 میلی‌لیتر دی‌کلرومتان افزوده شد. این آمیخته به‌شدت با شیکر هم‌‌زده‌ و سپس 10 دقیقه سانتریفوژ شد تا دانه‌های خاک ته‌نشین شوند؛ سپس محلول رویی در لوله آزمایش دیگری ریخته شد. مرحله شستشوی خاک با دی‌کلرومتان چند بار تکرار شد تا محلول رویی بیرنگ شود. عصاره دارای هیدروکربن‌های نفتی محلول در دی‌کلرومتان با سولفات‌سدیم آبگیری شد. پس از تبخیر حلال در دمای اتاق، ته‌نشست  قهوه‌ای‌رنگ در 5 میلی‌لیتر دی‌کلرومتان حل و میزان جذب نوری آن در طول موج 450 نانومتر با اسپکتروفتومتر خوانده شد. هر آزمایش 3 بار تکرار و میانگین جذب برآورد شد. جذب نوری نمونه‌ها با جذب نوری زمان صفر مقایسه شد (14).

آنالیز گازکروماتوگرافی: پس از استخراج هیدروکربن‌های نفتی از خاک، نمونه‌ها برای بررسی دگرگونی هیدروکربن‌های نفتی خاک آزمایش‌شده به دستگاه گازکروماتوگرافی تزریق شدند. اندازه‌گیری هیدروکربن‌های استخراج‌شده از خاک با دستگاه GC مدل6890N همراه با آشکارساز FID انجام شد. ستون دستگاه HP-5MS به طول 30 متر، قطر داخلی 25/0 میلی‌متر و ضخامت فاز ساکن 25/0 میکرومتر بود. دمای محل تزریق دستگاه کروماتوگرافی گازی روی 280 درجه سانتی‌گراد، دمای منبع یونیزاسیون ردیاب جرمی روی 150 درجه سانتی‌گراد، دمای آنالایزر (کوادرویل) روی 230 درجه تنظیم شد. آنالیز کروماتوگرام‌ها با نرم‌افزار Chemstation انجام شد (15 و 16).

بررسی اکوتوکسیسیته خاک تیمارشده: این آزمایش برپایه جوانه‌زدن بذر گیاه لیپیدیوم ساتیوم[6]تیمارشده با عصاره خاک آلوده انجام شد. لیپیدیوم ساتیوم ویژگی‌های مورفولوژیک و فیزیولوژیک مناسبی برای انجام این آزمایش دارد؛ بذر این گیاه بسیار سریع رشد می‌کند و گیاه به ترکیبات سمی زیستگاه خود بسیار پاسخ‌دهنده است. از هر گلدان، 5 گرم خاک نرم تیمارشده وزن و به 25 میلی‌لیتر آب سترون افزوده شد. این سوسپانسیون، 2 ساعت روی شیکر 150 دور در دقیقه گذاشته و سپس برای تهیه عصاره خاک پالایش شد. در پلیتی با دو لایه کاغذ صافی سترون، 10 میلی‌لیتر عصاره خاک ریخته شد. 50 عدد بذر لیپیدیوم ساتیوم روی کاغذ صافی گذاشته شد و پلیت‌ها در دمای 25 تا 28 درجه سانتی‌گراد قرار گرفتند. در پلیت شاهد مثبت، از آب آشامیدنی به جای عصاره خاک بهره‌گیری شد.

پس از 7 روز، بذرهای جوانه‌زده در هر پلیت شمارش شدند و درصد جوانه‌زنی بر‌پایه شمار بذرهای جوانه‌زده در هر پلیت تقسیم بر شمار بذرهای جوانه‌زده در پلیت شاهد ضربدر 100 برآورد شد. آزمایش 3 بار تکرار و میانگین آن محاسبه شد (17 و 18).

بررسی فیلوژنتیکی نمونه قارچ سپید پوساننده: برای استخراج DNA، میسلیوم‌های قارچ با بهره‌گیری از نیتروژن مایع منجمدشده، ساییده و پودر شدند. سپس درون میکروتیوب، حجم‌های برابر از بافر ویران‌کننده و در گام بعد بافر CTAB به میسلیوم‌های پودرشده افزوده شد. پس از انکوباسیون، از آمیخته فنل وکلروفرم به میزان برابر بهره‌گیری شد. محلول رویی دارای DNA استخراج‌شده در میکروتیوب دیگری ریخته شد و پس از چند بار شستشو با الکل، ته‌نشست پایانی DNA در 30 میکرولیتر بافر TE و دمای منفی 20 درجه سانتی‌گراد نگهداری شد. کیفیت DNA فرآوری‌شده روی ژل آگارز و باندهای آن با بهره‌گیری ازدستگاه ژل‌داک بررسی شد.

شناسایی مولکولی قارچ سپید پوساننده: کلونینگ و توالی‌یابی ژن S rRNA18 با پرایمرهای اختصاصی طراحی‌شده شامل توالی آغازگر پیش‌رو (5′~CTGCGGAAGGATCATTATTG~3′) و توالی آغازگر پس‌رو (5′~TTAATGACACTCAAACAGGC~3′) انجام شد. واکنش زنجیره‌ای پلیمراز در دستگاه ترموسایکلر (مدل Gradient Master اپندورف، آلمان) انجام شد. برای انجام هر واکنش زنجیره‌ای پلیمراز، 18 میکرولیتر آب مقطر سترون، 5/2 میکرولیتر بافر 10X، 75/0 میکرولیتر MgCl2 50 میلی‌مولار، 5/0 میکرولیتر dNTPs 10 میلی‌مولار، 1 میکرولیتر از آغازگر پیش‌رو و پس‌رو (10پیکومول)، 1 میکرولیتر DNA الگو و 2/0 میکرولیتر آنزیم تک‌پلیمراز بهره‌گیری شد و در پایان حجم آمیخته واکنش به 25 میکرولیتر رسید. چرخه گرمایی تنظیم‌شده در دستگاه ترموسایکلر، در ابتدا برای6 دقیقه در دمایC96 و به‌دنبال آن در چرخه 35 تایی شامل واسرشتگی در دمای C94 برای 45 ثانیه، پیوستن آغازگرها در دمای C50 برای 40 ثانیه، تکثیر قطعه مدنظر در دمای C72 برای 50 ثانیه و در پایان در دمای C72 برای 5 دقیقه چرخه گرمایی پایان یافت. پس از آگاهی از درستی فرآوری DNA به روش PCR با الکتروفورز روی ژل آگارز 1 درصد، نمونه‌ها برای تعیین توالی به روش سانگر و با دستگاه ABI 96 capilary برای شرکت Sequetech آمریکا فرستاده شدند. داده‌های توالی‌یابی با بهره‌گیری از نرم‌افزار کروماس[7] پردازش شدند. با نرم‌افزار BLAST، شباهت هر توالی با توالی‌های ژنی بانک جهانی ژن در پایگاه NCBI مقایسه شد.

 

نتایج.

نتایج بررسی ویژگی‌های فیزیکوشیمیایی خاک آلوده به ترکیبات نفتی نشان داد که بافت خاک رسی، اسیدیته سوسپانسیون خاک 1/0±6/7، رطوبت آن 3/1 درصد، هدایت الکتریکی سوسپانسیون خاک mS/cm1/0±7/5 و دارای 0/0±44/5 درصد کربن و 03/0±32/0 درصد گوگرد و بدون نیتروژن بود. همچنین گنجایش نگهداری آب (WHC) در خاک 2/65 درصد حاصل شد. میزان کل هیدروکربن‌های نفتی این خاک 2±24 گرم بر کیلوگرم محاسبه شد.

نتایج تیمار خاک آلوده با پسماند کمپوست قارچ سپید پوساننده، توانایی این ترکیب برای تجزیه هیدروکربن‌های نفتی را نشان می‌دهد. در همه میکروکاسم‌ها، کاهش درصد هیدروکربن‎های نفتی در اثر فروزینگی زیستی دیده می‎شود (شکل 1). از آزمون آنالیز واریانس با اندازه‎های تکراری برای مقایسه میانگین درصد زدودن هیدروکربن‌های نفتی بینهفت گروه طی 3 ماه اندازه‌گیری استفاده شد. برپایه نتایج این آزمون، اثر متقابل گروه آزمایشی و زمان اندازه‌گیری در سطح خطای 5 درصد معنادار نبود (05/0<p و 77/1=(12,28)F). ولی آثار اصلی گروه آزمایشی (05/0> pو 14/98=(6,14)F) و زمان اندازه‌گیری (05/0>p و 73/76=(2,28)F) معنادار مشاهده شدند.نتایج آزمون تعقیبی، درصد زدودن هیدروکربن‌های نفتی را درشش گروه آزمایشی نسبت به نمونه شاهد معنادار نشان داد (05/0>p). همچنین، با افزایش زمان تیمارخاک از 1 تا 3 ماه، میزان زدودن هیدروکربن‌های نفتی خاک نیز افزایش یافت. اگرچه این اختلاف افزایش در ماه‌های دوم و سوم نسبت به ماه اول درخور توجه و معنادار است (05/0>p)، کاهش هیدروکربن‌های نفتی در ماه دوم و سوم معنادار مشاهده نشد (05/0<p).

 

 

 

شکل 1- درصد کاهش هیدروکربن‌های نفتی خاک آلوده در میکروکاسم‌های گوناگون تیمارشده با کمپوست گانودرما لوسیدوم

 

 

 

شکل2 درصد کاهش هیدروکربن‌های نفتی طی 3 ماه را نشان می‌دهد و برپایه آن، درصد کاهش هیدروکربن‌های نفتی با گذشت زمان افزایش یافته است. بیشترین درصد کاهش هیدروکربن‌های نفتی پس از 3 ماه مطالعه، در تیمار خاک آلوده با 10 درصد کمپوست غنی‌‌شده با کود گانودرما لوسیدوم (میکروکاسم F) مشاهده شد (71 درصد). پس از آن، خاک‌های آلوده تیمارشده با 5 درصد کمپوست همراه با کود و خاک آلوده تیمارشده با 10 درصد کمپوست به‌ترتیب با 2/67 و 6/65 درصد میزان هیدروکربن‌های نفتی را کاهش دادند.

 

 

 

شکل 2- درصد کاهش هیدروکربن‌های نفتی خاک آلوده تیمارشده با کمپوست گانودرما لوسیدوم طی 3 ماه

 

 

درصد جوانه‌زنی لیپیدیوم ساتیوم برای بررسی توکسیسیته خاک تیمارشده تعیین شد (شکل 3). در میکروکاسم‌های گوناگون بررسی‌شده، میزان جوانه‌زنی بذر بین 8/20 تا 8/70 درصد متغیر بود. بیشترین درصد جوانه‌زنی در عصاره خاک تیمارشده با 10 درصد پسماند کمپوست قارچ همراه با کود ازت، فسفات و پتاس دیده شد. نتایج آزمون آنالیز واریانس یک‌طرفه نشان داد که میانگین درصد جوانه‌زنی بین گروه‌های بررسی‌شده اختلاف معنا‌دار دارد (05/0>p و 17/165=(6,14)F).

نتایج آزمون تعقیبی نشان دادند بین درصد جوانه‌زنی خاک تیمارشده با پسماند کمپوست که ترکیبات ازت، فسفات و پتاس دارد با نمونه مشابهی که این ترکیبات را ندارد، در حجم 5 و 10 درصد کمپوست اختلاف معناداری وجود ندارد (05/0>p).

 

 

شکل 3- درصد جوانه‌زنی بذرلیپیدیوم ساتیوم در عصاره خاک‌های آلوده تیمارشده با پسماند کمپوست قارچ سپید پوساننده در میکروکاسم‌های گوناگون پس از 3 ماه

 

 

نتایج تعیین توالی‌ها با نرم‌افزار کروماس[8] بررسی شدند. تجزیه و تحلیل نتایج توالی قطعه تکثیرشده از S rRNA18 سویه قارچ سپید پوساننده آزمایش‌شده با بهره‌گیری از ابزار اینترنتی بلاست[9] در بانک بین‌المللی ژن، اختصاص ناحیه مدنظر به گونه گانودرما لوسیدوم با هومولوژی 100 درصد را تأیید کرد. توالی حاصل با شماره دسترسی KX525204 در بانک جهانی ژن به ثبت رسید (شکل 4).

پس از پایان دوره 3 ماهه تیمار، خاک آلوده به هیدروکربن‌های نفتی با پسماند کمپوست قارچ سپید پوساننده و نمونه خاک شاهد (تیمار‌نشده) استخراج شدند. عصاره‌ها به دستگاه گازکروماتوگرافی تزریق و کروماتوگرام‌های آنها مقایسه شدند (شکل 5).

1

 

2

 

M

 

NC

شکل 4- الکتروفورز محصول PCR روی ژل آگارز 1 درصد: M (مارکر100‌جفت بازی)، 1 و 2 (محصولات PCR)، NC (شاهد منفی شامل واکنشی با تمام مواد بجز DNA استخراج‌شده قارچ)

 

 

 

C8-C12

 

C20-C25

 

C40-C45

شکل 5- کروماتوگرام هیدروکربن‌های نفتی پس از 3 ماه: a (خاک تیمارنشده)، b (خاک تیمارشده با کمپوست گانودرما لوسیدم،
میکروکاسم F)

 

 

مقایسه کروماتوگرام‌های تیمار آزمایشی و نمونه خاک تیمارنشده با بهره‌گیری از دستگاه گازکروماتوگرافی نشان داد در محدوده زمان بازداری 15 تا 20 دقیقه در سطح زیر منحنی، تیمار خاک آلوده با پسماندکمپوست گانودرما لوسیدوم دگرگونی چشمگیری داشته است؛ به نظر می‌رسد در مدت 3 ماه، شرایط برای تغییر مولکول‌های هیدروکربن‌های نفتی فراهم شده است.کروماتوگرام‌ها نشان می‌دهند که مولکول‌های نفتی سنگین و متوسط بر اثر تیمار با پسماند کمپوست قارچ از خاک زدوده شده‌اند. در این مدت کاهش مولکول‌های سبک نفتی نیز مشاهده شد ولی مولکول‌های سبک‌تر کامل زدوده نشدند. همچنین، در نمونه خاک تیمارشده با پسماند کمپوست گانودرما لوسیدوم، دگرگونی چشمگیری در زمان بازداری 34 دقیقه دیده می‌شود که تأثیر ترکیبات و فعالیت میسلیوم‌های این قارچ بر مولکول‌های سنگین نفتی را نشان می‌دهد. اما گانودرما لوسیدوم در 3 ماه قادر به زدودن کامل مولکول‌های سنگین نفتی نبود.

 

بحث و نتیجه‏‏گیری.

حذف آلودگی‌های نفتی از خاک با قارچ‌های سپید پوساننده نتایج خوبی دارد. مطالعه حاضر نشان داد که میزان هیدروکربن‌های نفتی در همه میکروکاسم‌های آماده‌شده از نمونه‌ خاک آلوده به ترکیبات نفتی و کمپوست گانودرما لوسیدوم کاهش یافته است. با افزایش حجم پسماند مایه‌زنی‌شده از 3 به 5 و 10 درصد به خاک آلوده، میزان هیدروکربن‌های نفتی کاهش بیشتری نشان می‌دهد. به نظر می‌رسد با افزایش حجم پسماند مایه‌زنی‌شده به‌واسطه مقادیر زیاد کاه آن، شرایط مناسب حفظ رطوبت و تخلخل لازم برای ایجاد شرایط هوازی فراهم شده که برای رشد میسلیوم‌های قارچ لازم است و به تجزیه زیستی بیشتر هیدروکربن‌های نفتی خاک منجر می‌شود. در مطالعه چیو[10] و همکاران نیز پس از دو بار بهره‌گیری از 3 درصد پسماند کمپوست پلوروتوس پولموناریوس میزان کاهش هیدروکربن‌های نفتی خاک 56 تا 64 درصد گزارش شد (19).

در اکثر مطالعات نسبت مناسب ازت به فسفر برای رشد ریزجانداران و فروزینگی زیستی آلاینده‌های خاک نزدیک 10 به 1 توصیه شده است ولی در مقایسه بین سری‌های آزمایش به‌شکل دوبه‌دو مشخص شد اگرچه میزان کاهش هیدروکربن‌های نفتی در نمونه‌های خاک دارای پسماند وکود ازت، فسفات و پتاس کمی بیشتر از نمونه‌هایی است که این ترکیبات را ندارند، آزمون‌های آماری اختلاف را معنادار نشان ندادند (001/0>p).

این یافته با بررسی پینتو[11] همخوانی دارد؛ وی گزارش کرد که تصحیح نسبت نیتروژن و فسفات در خاک ممکن است بر فروزینگی زیستی تأثیری نداشته باشد یا حتی عامل مهارکننده‌ای در فرایند تجزیه باشد، به‌ویژه زمانی که نمک آمونیوم برای منبع نیتروژن بهره‌گیری شود تولید آمونیاک در خاک افزایش یافته و پیامدهای سمی بر ریزجانداران خواهد داشت (20). اگبو[12] و همکاران نیز گزارش کردند که افزودن ترکیبات غنی‌کننده ازت، فسفات و پتاس به خاک برای افزایش فرایند زیست‌بهسازی، تأثیر پسماندهای آلی افزوده‌شده به خاک را کاهش می‌دهد (21).

حجم اصلی کمپوست قارچ‌های سپید پوساننده بهره‌گیری‌شده در صنایع غذایی را کاه تشکیل می‌دهد و مقادیر زیادی از آن در پسماند کمپوست، دست‌نخورده باقی می‌ماند؛ به همین علت، افزودن پسماند کمپوست قارچ‌های خوراکی به خاک‌های آلوده به ترکیبات نفتی که بیشتر حالت رسی دارند، بسیار مناسب است زیرا باعث اصلاح بافت خاک می‌شود و شرایط رشد را فراهم می‌کند. پس از گذشت 3 ماه، پسماند کمپوست قارچ‌ها حالت خاک پیدا کرده و بوی خاک آلوده به هیدروکربن‌های نفتی تغییر می‌کند. نقش پسماند کمپوست قارچ‌ها در تغییر و اصلاح بافت خاک بسیار مهم است (22). ادنیپکوم[13] نیز در مطالعه‌ای درباره قارچ لیگنینولیتیک پلوروتوس پولموناریوس گزارش کرد که این قارچ می‌تواند در 2 ماه غلظت 10 درصد هیدروکربن‌های نفتی را به میزان 8/40 درصد کاهش دهد، اگرچه با افزایش غلظت هیدروکربن‌های نفتی به 40 درصد، میزان فروزینگی زیستی به 28/9 درصد کاهش یافت (4). اکپاراما [14] با استفاده از پسماند کمپوست پلوروتوس استراتوس، درصد کاهش هیدروکربن‌های نفتی در خاک‌های آلوده نیجریه را 25/80 تا 38/92 درصد گزارش کرد. مطالعات بسیاری درباره توانایی پلوروتوس توبریژیوم، پلوروتوس استراتوس، آگاریکوس بیسپوروس و برخی دیگر از قارچ‌های سپید پوساننده در فروزینگی زیستی هیدروکربن‌های نفتی انجام شده و اکثر مطالعات با پژوهش حاضر هم‌سو هستند و تأکید می‌کنند که قارچ‌های سپید پوساننده توان زیادی برای زدودن هیدروکربن‌های نفتی دارند (11، 23 و 24).

درباره توانایی جنس گانودرما برای زدودن هیدروکربن‌های نفتی گزارش‌های معدودی منتشر شده است. پاناپایاک[15] و همکاران در مطالعه‌ای نقش آنزیم لاکاز گانودرما لوسیدوم در تجزیه برخی هیدروکربن‌های آروماتیک را بررسی و گزارش کردند که این آنزیم توان تجزیه زیستی کامل آنتراسن و بنزوپیرن را دارد. با توجه به نتایج پژوهش حاضر، ترکیبات 12 تا 20 کربنه بسیار کاهش یافته‌اند. مانزانو[16] و همکاران نیز در پژوهشی درباره توانایی گانودرما زوناتوم برای تجزیه زیستی آنتراسن، فنانترن و پیرن گزارش کردند که این جدایه می‌تواند فقط آنتراسن را به میزان 5/29 درصد کاهش دهد و در فروزینگی زیستی فنانترن و پیرن موفق نیست؛ آنها نتیجه‌گیری کردند که قارچ سپید پوساننده گانودرما زوناتوم توانایی تجزیه هیدروکربن‌های نفتی حلقوی را ندارد. احتمالاً اختلاف نتایج پژوهش مانزانو و مطالعه حاضر این است که در این مطالعه از پسماند کمپوست قارچ برای زدودن هیدروکربن‌های نفتی خاک بهره‌گیری شد که مجموعه شرایط مناسب برای رشد و فعالیت قارچ و دیگر ریزجانداران بومی خاک را به‌شکل کمپوستینگ فراهم می‌کند ولی مانزانو کشت خالص گانودرما زوناتوم را به‌ کار برد. بهره‌گیری از پسماند کمپوست قارچ‌ها به شیوه کمپوستینگ با خاک‌های آلوده به هیدروکربن‌های نفتی سبب می‌شود میسلیوم‌های قارچ روی باقیمانده مواد لیگنوسلولزی رشد کرده و به تدریج در اثر مجاورت با هیدروکربن‌های نفتی، از این ترکیبات برای منابع جدید کربن بهره‌گیری کنند. برپایه نتایج شکل 1، با افزایش درصد پسماند کمپوست افزوده‌شده به خاک آلوده میزان زدودن هیدروکربن‎های نفتی نیز افزایش داشته است (25).

سرعت کاهش میزان هیدروکربن‌های نفتی در 2 ماه اول مطالعه بیشتر است ولی در ماه سوم، درصد فروزینگی زیستی هیدروکربن‌های نفتی کاهش یافت که با کاهش شیب خط مشخص است (شکل 2). به‌عبارتی، زیست‌بهسازی در دو ماه اول تیمار نمونه‌های خاک بیشتر بود و پس از آن کاهش یافت که با نتایج پژوهش‌های دیگرهماهنگ است (19). اگرچه در مطالعه حاضر تجزیه زیستی هیدروکربن‌های نفتی به تفکیک مدنظر نبود، نتایج گازکروماتوگرافی نشان داد میزان هیدروکربن‌های نفتی خاک تیمارشده با کمپوست گانودرما لوسیدوم در مقایسه با خاک اولیه بسیار کاهش یافته است. همچنین ممکن است وجود مقادیری از هیدروکربن‌های سبک نفتی در خاک به‌علت تجزیه مولکول‌های سنگین‌تر به مولکول‌های سبک‌تر باشد و احتمال دارد با افزایش زمان تیمار خاک، این مولکول‌های سبک نیز کامل زدوده شوند. نتایج جوانه‌زنی بذر لیپیدوم ساتیوم به‌خوبی با نتایج فروزینگی زیستی خاک آلوده در میکروکاسم‌های گوناگون منطبق است.

در این بررسی نمونه‌ای از قارچ سپید پوساننده شناسایی و توان تجزیه هیدروکربن‌های نفتی خاک آلوده با پسماند آن قارچ تأیید شد. نتایج نشان دادند که بهره‌گیری از 10 درصد پسماند کمپوست این قارچ برای زدودن هیدروکربن‌های نفتی خاک مناسب‌تر است.

تشکر و قدردانی

واحد پژوهش و محیط‌زیست شرکت پالایش نفت اصفهان این تحقیق را حمایت کرد. بدین‌وسیله ازکمک‌های آقایان مهندس دزفولی مدیریت محترم HSE و مهندس ناظم رئیس بخش پژوهش و توسعه پالایشگاه اصفهان تشکر می‌شود.




[1]- Phanerochaete chrysosporium

[2]- Pleurotus ostreatus

[3]- Lentinula edodes

[4]- Pleurotus tuberregium

[5]- Pleurotus polmonarius

[6]- Lipidiumsativum

[7]- Chromas

[8]- Chromas

[9]- Blast

[10]- Chiu

[11]- pinto

[12]- Ogbo

[13]- Adenipekum

[14]- Okparanma

[15]- Punnapayak

[16]- Manzano

(1) Thapa B., Kumar KCA., Ghimire A. A review on bioremediation of Petroleum hydrocarbon contaminants in soil. Kathmandu University Journal of Scence, Engineering and Technology. 2012; 8 (1): 164-70.

(2) Mohsenzadeh F., Ahmadi Masoud N. A Study on potential microbial removal of diesel oil from contaminated soil in Hamedan city. Biological Journal of Microorganism 2012; 1 (2): 77-86.

(3) Phan CW., Sabaratnam V. Potential uses of spent mushroom substrate and its associated lignocellulosic enzymes. Applied Microbiology and Biotechnology 2012; 96 (4): 863-73.

(4) Adenipekun C., Lawal R. Uses of mushrooms in bioremediation: A review. Biotechnology and Molecular Biology Reviews 2012; 7 (3): 62-8.

(5) Megharaj M., Ramakrishnan B., Venkateswarlu K., Sethunathan N., Naidu R. Bioremediation approaches for organic pollutants: A critical perspective. Environment International 2011; 37 (8): 1362-75.

(6) Okerentugba P., Orji F., Ibiene A., Elemo G. Spent mushroom compost for bioremediation of petroleum hydrocarbon polluted soil: A review. Journal of  Environmental Science and Toxicology 2015; 4 (1): 1-7.

(7) Fulekar M., Pathak B., Fulekar J., Godambe T. Bioremediation of organic pollutants using phanerochaete chrysosporium. In: Goltapeh ME., Danesh RY., Varma A., editors. Fungi as Bioremediators. Berlin: Springer Berlin Heidelberg; 2013.

(8)  Ekundayo F. Comparative studies on biodegradative abilities of Pleurotus ostreatus and P. pulmonarius in soils contaminated with crude and used engine oils. Advances in Microbiology 2014; 4: 849-55.

(9) Isikhuemhen O., Anoliefo G., Oghale O. Bioremediation of crude oil polluted soil by the white rot fungus, Pleurotus tuberregium (Fr.) Sing. Environmental Science and Pollution Research 2003; 10 (2): 108-12.

(10)           Lau KL., Tsang YY., Chiu SW. Use of spent mushroom compost to bioremediate PAH-contaminated samples. Chemosphere 2003; 52 (9): 1539-46.

(11)           Pozdniakova N., Nikitina V., Turkovskaia O. Bioremediation of oil-polluted soil with an association including the fungus. Applied Biochemistry and Microbiology 2008; 44 (1): 60-65.

(12)           Zitte L., Awi-Waadu G., John A. Effect of oyster mushroom (Pleurotus ostreatus) mycelia on petroleum hydrocarbon contaminated substrate. Journal of Agriculture and Social Research 2012; 12 (2): 115-21.

(13)           Gasecka M., Drzewiecka K., Stachowiak J., Siwulski M., Golin´ski P., Sobieralski K., et al. Degradation of polycyclic aromatic hydrocarbons (PAHs) by spent mushroom substrates of Agaricus bisporus and Lentinula edodes. Acta Scientiarum Polonorum-Hortorum Cultus 2012; 11 (4): 39-46.

(14)           Victoria E. Industrial waste resource guidelines sampling and analysis of waters, wastewaters, soils and wastes. Industrial waste resource guidelines (EPA) 2009: 1-36.

(15)           Fredricks DN., Smith C., Meier A. Comparison of six DNA extraction methods for recovery of fungal DNA as assessed by quantitative PCR. Journal of Clinical Microbiology 2005; 43 (10): 5122-8.

(16)           Izumitsu K., Hatoh K., Sumita T., Kitade Y., Morita A., Gafur A., et al. Rapid and simple preparation of mushroom DNA directly from colonies and fruiting bodies for PCR. Mycoscience 2012; 53 (5): 396-401.

(17)           Cruz J., Lopes P., Montagnolli R., Tamada I., Guerra Silva N., Bidoia E. Toxicity assessment of contaminated soil using seeds as bioindicators. Journal of Applied Biotechnology 2013; 1 (1): 1-10.

(18)           Hentati O., Lachhab R., Ayadi M., Ksibi M. Toxicity assessment for petroleum-contaminated soil using terrestrial invertebrates and plant bioassays. Environmetal Monitoring and Assessment 2012; 185 (4): 2989-98.

(19)           Chiu SW., Gao T., Chan CS-S., Ho CK-M. Removal of spilled petroleum in industrial soils by spent compost of mushroom Pleurotus pulmonarius. Chemosphere 2009; 75 (6): 837-42.

(20)           Mariano AP., Kataoka AP., Angelis D., Bonotto DM. Laboratory study on the bioremediation of diesel oil contaminated soil from a petrol station. Brazilian  Journal of Microbiology 2007; 38: 346-53.

(21)           Ogbo E., Okhuoya J. Bioavailability of some heavy metals in crude oil contaminated soils remediated with Pleurotus tuber-regium Fr. singer. Asian Journal of Biological Sciences 2011; 4: 53-61.

(22)           Nakatsuka H., Oda M., Hayashi Y., Tamura K. Effects of fresh spent mushroom substrate of Pleurotus ostreatus on soil micromorphology in Brazil. Geoderma 2016; 269: 54-60.

(23)           Isikhuemhen O., Anoliefo G., Oghale O. Bioremediation of crude oil polluted soil by the white rot fungus, Pleurotus. Environmental Science and Pollution Research 2003; 10 (2): 108-12.

(24)           García-Delgado C., Yunta F., Eymar E. Bioremediation of multi-polluted soil by spent mushroom (Agaricus bisporus) substrate: Polycyclic aromatic hydrocarbons degradation and Pb availability. Journal of Hazardous Material 2015; 300: 281-8.

(25)           Thenmozhi R., Arumugam K., Nagasathya A., Thajuddin N., Paneerselvam A. Studies on mycoremediation of used engine oil contaminated soil samples. Advances in Applied Science Research 2013; 4 (2): 110-8.