بررسی توان تولید آنزیم ACC-دآمیناز در باکتری‌های جداسازی شده از خاک‌های خشک، شور و شور- سدیمی و انتخاب باکتری کارآمد در تولید آنزیم

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 استادیار خاکشناسی سازمان تحقیقات، آموزش و ترویج کشاورزی، ایران

2 استـــاد بیولـوژی و بیوتـکنولـوژی خاک، دانشـــگاه تهـران، ایـــران

3 دانشــــیـــار شیمـــی خاکـــ، دانشـــــــگـــاه تـــهـــران، ایـــــــران

چکیده

مقدمه: تنش‌های خشکی، شوری و شور- سدیمی، از راه‌های گوناگونی مانند ساخت زیستی اتیلن تنشی مایۀ کاهش رشد گیاهان می‌شوند. به‌دلیل توانابودن برخی از باکتری‌های خاک در کاهش تنش و مصرف پیشنیاز تولید اتیلن (ACC)، این پژوهش برای دستیابی به باکتری برتر سازندۀ آنزیم ACC-دآمیناز در تنش‌های خشکی، شوری و شور- سدیمی خاک‌ها انجام شد.
مواد و روش‏‏ها: در این پژوهش، با جداسازی 400 باکتری از خاک‌های با قابلیت هدایت الکتریکی و نسبت جذب سدیمی گوناگون، توان تجزیۀ ACC و ساخت آلفاکتوبوتیرات به‌عنوان معیار ساخت آنزیم ACC- دآمیناز در باکتری‌های سازندۀ این آنزیم و اثر تنش‌های خشکی و شوری بر روند رشد باکتری‌ها و توان مصرف ACC بررسی شد. ‏‏
نتایج: پردازش و آزمون داده‌ها نشان داد که نه تنها توانایی ساخت آنزیم ACC- دآمیناز در میان جدایه‌ها با هم ناهمانند بود، بلکه اندازۀ مصرف ACC در آنها بسیار وابسته به تنش‌های خشکی و شوری بود. در بیشتر جدایه‌های باکتری، با افزایش تنش، روند کاهشی معنی‌داری در مصرف ACC دیده شد؛ اما گونۀ باکتری باسیلوس‌سیمپلکس که از خاک‌های شور- سدیمی جداسازی شد، افزون بر توانایی ساخت 901 نانو مول آلفاکتوبوتیرات بر میلی‌گرم پروتئین در ساعت در شرایط بدون تنش، دارای بیشترین پایداری مصرف ACC در تنش‌های خشکی و شوری بود. این باکتری، در برابر دیگر جدایه‌ها، بردباری نسبی بیشتری به تنش‌های خشکی و شوری دارد و تا شوری 40 دسی‌زیمنس بر متر و پتانسیل اسمزی 25-­ بار، همچنان ACC را مصرف کرد.
بحث و نتیجه‏گیری: بابررسی باکتری‌های جداسازی‌شده آشکار شد که باکتری باسیلوس‌سیمپلکس، کارایی بیشتری در ساخت آنزیم ACC-دآمیناز در تنش‌های خشکی و شوری داشت و بردبار به تنش‌های یادشده بود؛ بنابراین،­ کاربرد این باکتری برای کاهش تنش‌ها در خاک‌های شور و شور-سدیمی و مناطق خشک و نیمه‌خشک در شرایط مزرعه پیشنهاد شد.‏‏

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

The ability of ACC deaminase production in isolated bacteria from drought, saline and saline-sodic soils and selection of the most efficient bacteria

نویسندگان [English]

  • Reza Soleimani 1
  • Hossein Ali Alikhani 2
  • Hasan Towfighi 3
1 Assistant Professor of Soil science, Agricultural Research, Education and Extension Organization (AREEO)
2 Professor of Soil biology and technology, Tehran University, Iran
3 Associated Professor of Soil chemistry, Tehran University, Iran
چکیده [English]

Introduction:Drought, salinity and salinity-sodicity conditions reduce plant growth, due to stress ethylene biosynthesis. Because of capability of some soil bacteria for stress alleviation, and ACC consumption, this investigation was carried out to select the best ACC deaminase producer bacteria in conditions of drought, salinity and salinity-sodicity affected soils.
Materials and methods: In this investigation, 400 bacteria were isolated from soils with different levels of electrical conductivity (EC) and sodium adsorption ratio (SAR) and analyzed the variability of their ability in ACC consumption and α- ketobutyrate as indices of ACC deaminase production. Also, the effects of different drought and salinity stress on bacteria growth trend and ACC consumption ability were analyzed.
Results: Data analysis indicated that, not only the ability of ACC production was different among isolates, but also amounts of ACC consumption were affected by drought and salinity tensions. In the most isolates, there was a significant decrease in trend of ACC deaminase production as affected by tensions. But, one of bacterial species as Bacillus simplex that was isolated from saline-sodic soils, in addition to ability of production of 901 nmole α- ketobutyrate per milligram protein per hours in normal conditions, has the highest production stability in drought and salinity tensions. Also, this bacterium was continued to ACC deaminase production up to EC of 40 dS.m-1 and OP (Osmosis pressure) of -25 bar.
Discussion and conclusion: According to comparison among isolates, B. simplex has the highest efficiency of ACC deaminase production, in drought and salinity conditions, and was tolerant to these tensions. Therefore, B. simplex was proposed for field experiments in drought, salinity and salinity-sodicity affected soils.

کلیدواژه‌ها [English]

  • Bacillus simplex
  • ACC deaminase
  • Drought
  • Salinity
  • Salinity-sodicity

مقدمه.

کم‌آبی، شوری و شور-سدیمی‌بودن ذاتی خاک‌ها و همچنین شورشدن ثانویه[1] در بسیاری از مناطق خشک و نیمه‌خشک جهان و بخش‌های گسترده‌ای از ایران به‌عنوان یک دشواری و عامل کاهش‌دهندۀ رشد، کارکرد و کیفیت گیاهان کشاورزی به شمار می‌رود. ساخت زیستی حداقل[2] در خاک‌های شور و شور- سدیمی به‌دلیل فراوانی و تعادل ناشایست غلظت کاتیون‌ها و آنیون‌های محلول خاک (در خاک‌های شور و شور-سدیمی)، درصد سدیم تبادلی[3] بیشتر از 15 و نسبت جذب سطحی سدیم[4] بیشتر از 13 (در خاک های شور-سدیمی) رخ می‌دهد (1). به رأی گامالرو و گلیک[5]، برخی از تنش‌ها مانند کم‌آبی و شوری مایۀ دگرگونی فیزیولوژی گیاه می‌شوند. افزایش ساخت زیستی اتیلن و رسیدن غلظت آن به اندازۀ کاهش‌دهندۀ رشد گیاهی یکی از این دگرگونی‌ها است که به آن ساخت اتیلن تنشی گویند (2). سیدیکی[6] و همکاران نیز گزارش کردند که اتیلن ساخته‌شده در پاسخ به تنش شوری، مایۀ کاهش رشد ریشه و در پی آن کاهش جذب آب و عناصر غذایی و کاهش رشد گیاه می‌شود (3). با کاهش ساخت ACC[7] (1-آمینو سیکلو پروپان-1- کربوکسیلات پیش‌نیاز ساخت اتیلن)، گیاه با کمک باکتری‌های سازنده آنزیم ACC- دآمیناز، از ساخت بیش از اندازۀ طبیعی اتیلن در گیاه جلوگیری می‌کند. ساخت آنزیم ACC- دآمیناز در باکتری‌های مختلفی از جمله در جنس‌های سودوموناس و باسیلوس گزارش شده است (4). حضور این ژن و فعالیت آنزیم ACC- دآمیناز بیشتر در سودوموناسفلورسنس جداسازی‌شده از ریزوسفر گیاهان مختلف بررسی شده است. برخی از پژوهشگران، فعالیت‌نداشتن این آنزیم را در سایر گونه‌ها، مانند سودوموناس استاتزری و همچنین در جنس‌های ازتوباکترو انتروباکتر گزارش کرده‌اند (5). استفاده از سویه‌های باکتری بومی با توجه به سازش به شرایط محیطی (6) و برهم‌کنش بهتر با گیاهان هر منطقه می‌تواند اثر بیشتری داشته باشد. یک مدل برای شناخت کارایی ACC -دآمیناز در کاهش اندازۀ اتیلن در گیاهان را گلیک و همکاران پیشنهاد کرده‌اند (7). در این مدل آمده است که یک باکتری با توانایی ساخت ACC -دآمیناز پس از پیوستن به بذر یا ریشۀ گیاه، مونومرهای ACC را در دو گام جداکردن و شکستن[8] به آلفا کتوبوتیرات[9] و آمونیوم دگرگون می‌کند. با کاهش ACC در رویۀ بیرونی، برای پیدایش تعادل میان اندازۀ ACC در درون و بیرون یاخته‌های ریشۀ گیاه، اندازۀ بیشتری از ACC ساخته‌شدۀ خود را به بیرون (در خاک) ترشح می‌کند و با پیدایش یک شیب از درون بافت گیاه به سوی بیرون، مایۀ کاهش غلظت ACC و در پی آن غلظت اتیلن درون گیاه می‌شود. با این فرایند، باکتری‌های سازندۀ آنزیم ACC-دآمیناز باعث می‌شوند که اندازۀ اتیلن به مرز بحرانی برای رشد گیاه نرسد به‌گونه‌ای که بوته میری گیاهان به‌ویژه در آغاز رشد کاهش می‌یابد.

بنابراین با هدف جداسازی باکتری‌های توانمند در ساخت ACC -دآمیناز از خاک‌های خشک، شوری و شور-سدیمی و بررسی توان بردباری در برابر تنش‌های خشکی و شوری آنها این پژوهش انجام شد.

 

‏‏مواد و روش‏ها.

.نمونه‌برداری از خاک‌های معمولی، شور و شور- سدیمی به‌منظور جداسازی باکتری: در آغاز از 60 جایگاه از استان خوزستان از خاک‌های همانندی از دیدگاه شوری و شور-سدیمی‌بودن نمونه‌برداری خاک‌ها از مزارع گندم انجام شد. خاک ریزوسفری با استفاده از پروتکل مربوطه با روش تکان‌دادن ملایم ریشه‌ها به‌مدت 10 دقیقه در یک لیتر آب استریل دارای 9/0درصد کلرید سدیم آماده شد (8). برای جداسازی باکتری‌ها، حدود 250 گرم از نمونه خاک‌ها، در دمای 4 درجه سانتیگراد نگهداری شد. سپس pH، قابلیت هدایت الکتریکی[10] عصارۀ اشباع، غلظت کلسیم به‌روش کمپلکسومتری[11]، غلظت سدیم و پتاسیم به‌روش فلیم فتومتری[12] اندازه‌گیری شد و با توجه به این نتایج، نسبت جذب سطحی سدیم نیز برآورد گردید (9).

جداسازی[13] و خالص‌سازی[14] باکتری‌ها: در این گام در آغاز سوسپانسیون همگن خاک آماده شد. به این گونه که 10 گرم خاک به ارلن مایر 250میلی‌لیتری دارای 90 میلی‌لیتر آب مقطر سترون، ریخته و در شیکر با 120 دور در دقیقه در دمای 28 درجه سانتیگراد برای 30 دقیقه گذاشته شد. سپس سری‌های رقت (از 1-10 تا 9-10) آماده و 1/0 میلی‌لیتر از آن روی پلیت دارای محیط کشت آگار مغذی پخش شد. همۀ پلیت‌ها در دمای 28 درجه سانتیگراد برای 5 روز گرماگذاری شدند. برای خالص‌سازی جدایه‌ها، کلنی‌های پدیدآمده از بالاترین رقت‌های هر نمونۀ کشت‌شده گزینش شد و دوباره روی محیط کشت رشد داده شد و تا زمان بهره‌گیری از آنها روی محیط کشت شیبدار[15] در یخچال نگهداری شدند.


ارزیابی کیفی جدایه‌ها از دیدگاه توان ساخت ACC دآمیناز : برای انجام این آزمایش از سه سری ظروف پلیت دارای محیط کشت [16]DF بهره‌برداری شد:

1- ظروف پلیت دارای محیط کشت DF و ACC (به‌عنوان تنها منبع نیتروژن)

2- شاهد مثبت: ظروف پلیت دارای محیط کشتDF و کلرید آمونیوم (منبع نیتروژنی پایه)

3- شاهد منفی: ظروف پلیت دارای محیط کشت DF بدون هرگونه منبع نیتروژنی

سپس مایه‌زنی و انکوباسیون انجام شد و اندازۀ کلنی‌های پدیدآمده در ظروف پلیت با شاهد سنجیده و ارزیابی شدند (8).

همچنین توانایی جدایه‌ها در ساخت آنزیم ACC-دآمیناز در محیط مایع با بهره‌برداری از روش بهبودیافته پنروز و گلیک[17] آزمایش شد (10). برای این کار، یک لوپ از هر جدایه به 25 میلی‌لیتر محیط کشت TSB در ارلن‌های 100میلی‌لیتری مایه‌زنی شد. پس از 24 ساعت از رشد باکتری در دمای 28 درجه سانتیگراد، به‌اندازۀ 50 میکرولیتر از سوسپانسیون هر جدایه به 25 میلی‌لیتر محیط کشت در سه محیط زیر و در 4 تکرار مایه‌زنی و برای 24 ساعت روی شیکر با دمای 28 درجه سانتیگراد و دور rpm80 تکان داده شد:

1-        محیط کشت DF

2-        محیط کشت DF همراه با 100 میکرولیتر ACC3/0 مولار

3-        محیط کشت DF همراه با 100 میکرولیتر سولفات آمونیوم

دانسیتۀ نوری این محیط‌ها در طول موج 540 نانومتر با دستگاه اسپکتروفتومتر همانند شناسه‌ای از رشد باکتری در آن محیط اندازه‌گیری شد.

اندازه‌گیری کمی آلفاکتوبوتیرات: برای این کار از روش پنروز و گلیک بهره‌گیری شد (10). در این روش از 16 جدایۀ برتر از باکتری‌های غربال‌شده در گام‌های پیشین، سوسپانسیون باکتری با بهره‌گیری از محیط کشت [18]TSB آماده شد. سپس 50 میکرولیتر از آن به 30 میلی‌لیتر محیط کشت در ارلن ریخته شد و به‌مدت 12 ساعت روی شیکر با چرخش 180 دور در دقیقه و دمای 28 درجه سانتیگراد گذاشته شد. آنگاه سوسپانسیون درون ارلن، در دمای 4 درجه سانتیگراد به‌مدت 10 دقیقیه سانتریفوژ (g 8000) شد. یاخته‌های مانده در ته لوله پس از شستشو با مایع حداقل DF، در 5/7 میلی‌لیتر از همان محیط سوسپانسیون شد و همۀ آن درون ارلن 50میلی‌لیتری سترون ریخته شد. سپس به‌اندازۀ 45 میکرولیتر از محلول نیم‌مولار ACC به سوسپانسیون باکتری یادشده افزوده شد و به‌مدت 24 ساعت روی شیکر ( با چرخش 150 دور در دقیقه و دمای 30 درجه سانتیگراد) گذاشته شد تا فعالیت آنزیم برانگیخته شود. پس از سانتریفیوژ (g8000 به‌مدت 10 دقیقه و در دمای 4 درجه سانتیگراد)، یاخته‌های مانده در ته لوله با 5 میلی‌لیتر از Tris-HCl یک‌دهم مولار با pH برابر 5/7 شسته شدند. یاخته‌های مانده در ته لوله در یک میلی‌لیتر از محلول شستشوی یادشده حل شد و همۀ آن به لولۀ میکروسانتریفیوژ ریخته شد و در دمای 4 درجه سانتیگراد سانتریفیوژ (g10000 برای 5 دقیقه) گردید. محلول رویی دور ریخته شد و پس از اینکه یاخته‌های مانده در ته لوله در 600 میکرولیتر از Tris-HCl یک‌دهم مولار در pH برابر 5/7 آب آویز شدند به‌اندازۀ 30 میکرولیتر تولوئن به آن افزوده شد و برای 30 ثانیه ورتکس[19] شد. آنگاه به‌اندازۀ 200 میکرولیتر از سوسپانسیون یادشده جداگانه به یک لولۀ شاهد و سه لولۀ میکروسانتریفیوژ 5/1میلی‌لیتری جدید ریخته شد. به‌اندازۀ 20 میکرولیتر از محلول ACC نیم‌مولار به هریک از لوله‌های میکروسانتریفیوژ دارای 200 میکرولیتر از یاخته‌های باکتری افزوده شدند. لوله‌ها در آغاز ورتکس و سپس به‌مدت 15 دقیقه در دمای 30 درجه سانتیگراد نگهداری شدند. آنگاه یک میلی‌لیتر اسیدکلریدریک 56/0 مولار به هر لوله افزوده شد و محلول نهایی درون هر لوله با بهره‌گیری از ورتکس آمیخته و در دمای اتاق، سانتریفیوژ (g10000 به‌مدت 5 دقیقه (نگهداری گردید. یک میلی‌لیتر از محلول رویی درون هر لوله میکروسانتریفیوژ برداشته و با 800 میکرولیتر از اسیدکلریدریک 56/0 مولار، درون یک لولۀ آزمایش کوچک ورتکس شد. 300 میکرولیتر از محلول 4، 2- دی نیتروفنیل ئیدرازین (محلول 2/0درصد 4، 2- دی نیتروفنیل ئیدرازین در اسیدکلریدریک دو مولار) به هر لوله افزوده شد، با انجام ورتکس، هر لوله به‌مدت 30 دقیقه در دمای 30 درجه سانتیگراد خوابانده شد. پس از آن به محلول یادشده 2 میلی‌لیتر سود 2 مولار افزوده و آمیخته گردید تا یکنواخت شود. در پایان، دانسیتۀ نوری (OD) در طول‌موج 540 نانومتر به‌کمک دستگاه اسپکتروفتومتر اندازه‌گیری شد (برای آماده‌سازی محلول‌های استاندارد از مادۀ خالص آلفا- کتوبوتیرات بهره‌گیری شد). نتایج برحسب نانومول آلفاکتوبوتیرات بر میلی‌گرم پروتئین در ساعت گزارش شد. برای اندازه‌گیری مقدار پروتئین نمونه‌ها از روش برادفورد استفاده شد (11). براساس این روش، 100 میکرولیتر از سوسپانسیون باکتری تولوئنی‌شده با 100 میکرولیتر سود 1/0 نرمال مخلوط شد. 50 میکرولیتر از هر نمونه با بافر Tris-HCl (5/8 pH=) و معرف کوماسی بلو تیمار شد و پس از 30 دقیقه مقدار پروتئین با مقایسۀ جذب نوری با منحنی استاندارد (حاصل از پروتئین خالص آلبومین) در طول‌موج 595 نانومتر تعیین شد.

.آزمون بردباری در برابر تنش خشکی جدایه‌های باکتری: به‌منظور ارزیابی توان بردباری جدایه‌ها، اندازۀ گوناگونی از تنش خشکی، از توان رشد آنها در محیط کشت تریپتیک سوی براث دارای غلظت‌های گوناگون پلی‌اتیلن گلیکول 6000[20] بهره‌گیری شد. پایۀ معادله میشل و کافن[21]، غلظت‌های صفر، 2/202، 7/295، 7/367، 4/428 و 9/481 گرم پلی‌اتیلن‌گلیکول 6000 برای هر کیلوگرم محیط کشت تریپتیک سوی براث برابر پتانسیل‌های آبی 0، 5-، 10-، 15-، 20- و 25- بار بود (12). اندازۀ رشد جدایه‌ها با اندازه‌گیری چگالی نوری[22] محیط رشد آنها در طول‌موج 600 نانومتر، با دستگاه اسپکتروفتومتر اندازه‌گیری شد و درصد کاهش رشد هر جدایه در اندازه‌های پلی‌اتیلن‌گلیکول به‌کاررفته در برابر رشد همان جدایه در محیط تریپتیک سوی براث برآورد گردید. 3 تکرار از محیط تریپتیک سوی براث مایه‌زنی‌نشده دارای اندازه‌های گوناگون پلی‌اتیلن‌گلیکول نیز همانند شاهد برای اندازه‌گیری میزان چگالی نوری این محیط در شرایط یادشده آماده شد (13).

.آزمون بردباری در برابر تنش شوری جدایه‌های باکتری: برای این کار، توان رشد جدایه‌های باکتری در محیط کشت تریپتیک سوی براث دارای اندازه‌های گوناگون نمک‌های کلرید سدیم، کلرید کلسیم و کلرید منیزیم ارزیابی شد. اندازه‌های نمک افزوده‌شده به‌گونه‌ای به کار رفت که شوری‌های صفر، 5، 10، 20، 30 و 40 دسی‌زیمنس بر متر به دست آید. سپس دگرگونی رشد جدایه‌ها با اندازه‌گیری چگالی نوری محیط رشد آنها در طول‌موج 600 نانومتر، با دستگاه اسپکتروفتومتر اندازه‌گیری و مقایسه شد.

شناسایی جدایه برتر: برای شناسایی باکتری برتر به‌روش ژنتیکی (16S rRNA)، استخراج DNA با روش استاندارد انجام شد (14). در آغاز کافت یاخته و دگرگون‌کردن پروتئین‌ها با با به‌کارگیری بافر کافنده (لیزوزیم، EDTA، SDS، پروتئیناز K)، انجام شد و سپس با بهره‌گیری از فنل و کلروفرم همۀ بخش‌ها غیر از اسیدهای نوکلئیک ته‌نشین داده شد (15). در پایان، با بهره‌گیری از استات سدیم و اتانول مطلق سرد، DNA محلول ته‌نشین شد. در این پژوهش، برای تکثیر ژن 16S rRNA جدایۀ برگزیده از پرایمرهای FP (5/AGAGTTTGATCCTGGCTCAG3/) و
 RP (5/AAGGAGGTGATCCAGCCGCA3/3/) بهره‌گیری شد. واکنش زنجیره‌ای پلیمراز[23] با بهره‌گیری از دستگاه ترموسایکلر با شرایط تکثیر[24] استاندارد انجام شد. واکنش زنجیره‌ای پلیمراز با حجم نهایی 25 میکرولیتر شامل 5 میکرولیتر DNA الگو، 5/0 میکرولیتر از هر پرایمر، 5/0 میکرولیتر (200µM) dNTP Mix، 8/0 میکرولیتر (50mM) MgCl2، 5/2 میکرولیتر بافر PCR، 2/0 میکرولیتر آنزیم Taq Polymerase انجام شد. در ادامه واکنش زنجیره‌ای پلیمراز در دستگاه ترموسایکلر با شرایط دمایی 3 دقیقه واسرشت[25] در دمای 95 درجه سانتیگراد و در ادامه 35 چرخه شامل واسرشت‌شدن در دمای 95 درجه سانتیگراد به‌مدت یک دقیقه، اتصال[26] در دمای 55 درجه سانتیگراد به‌مدت 1 دقیقه، طویل‌شده[27] در دمای 72 درجه سانتیگراد به‌مدت 2 دقیقه و درنهایت طویل‌شدن نهایی در دمای 72 درجه سانتیگراد به‌مدت 10 دقیقه انجام شد (16). فرآوردۀ به‌دست‌آمده از واکنش زنجیره‌ای پلیمراز در ژل آگارز 1درصد، بارگذاری و پس از دیدن باند ویژۀ آن (1400bp)، به کمک راهنما[28]، برای تعیین توالی به شرکت ماکروژن کره جنوبی فرستاده شد (17).

تجزیه‌های آماری: آزمایش‌ها در قالب طرح کاملاً تصادفی[29] (CRD) در 4 تکرار با منبع تغییر باکتری (16 جدایۀ باکتری برای تولید آلفاکتوبوتیرات) و درمورد تیمارهای خشکی و شوری با 6 اندازۀ گوناگون تنش انجام شد. تجزیه و تحلیل داده‌ها با بهره‌گیری از نرم‌افزار (v 9.1) SAS انجام شد و نتایج تجزیۀ واریانس به دست آمد؛ سپس با بهره‌گیری از آزمون چنددامنه‌ای دانکن[30]، میانگین داده‌ها در پایۀ آماری 5درصد با یکدیگر سنجیده شدند.

 

نتایج.

نتایج تجزیۀ شیمیایی خاک‌های نمونه‌برداری‌شده نشان داد که بازۀ شوری خاک‌ها میان 1/0 تا 3/26 دسی‌زیمنس بر متر و نسبت جذب سدیمی میان 1/0 تا 12/30 (میلی‌اکی‌والان بر لیتر)5/0 است. همچنین میانگین سدیم، کلسیم و منیزیم محلول خاک به‌ترتیب 56، 22 و 17 میلی‌اکی‌والان بر لیتر و میانگین pH خاک‌ها، 61/7 بود. تعداد 400 باکتری از خاک ریزوسفری و ناریزوسفری جداسازی گردید. با نگاه به اندازۀ رشد باکتری و قطر کلنی پدیدآمده دربرابر شاهد مثبت، سویه‌های توانمند در ساخت آنزیم ACCدآمیناز گزینش شدند. نتایج بررسی کیفی توان ساخت آنزیم در باکتری‌های جداشده نشان داد که 101 جدایه، رشد شایسته‌ای در محیط کشت دارای ACC داشته و همانند جدایه‌های سازندۀ آنزیم ACC- دآمیناز آزمایش شدند.

فراوانی جدایه‌های باکتری سازندۀ آنزیم ACC-دآمیناز: نسبت قطر کلنی‌ها با کاربرد ACC به قطر کلنی با کاربرد کلرید آمونیوم میان صفر و 1 بود. فراوانی باکتری‌ها در کاربرد ACC، در بازه‌های با 15/0 اختلاف در شکل 1– الف نشان داده شده است. همان‌گونه که دیده می‌شود، تنها 2درصد از باکتری‌ها در بالاترین بازۀ توان کاربرد ACC (بیش از 85/0) هستند که در آزمایش‌ها، این باکتری‌های برتر از دیدگاه توانایی ساخت آنها در تنش‌های خشکی و شوری و همچنین توان بردباری خود جدایه‌ها به تنش بررسی شدند؛ همچنین به‌منظور ازدست‌ندادن جدایه یا جدایه‌های توانای دیگر، شماری از باکتری‌ها که همانندی چشمگیری با گروه نخست از دیدگاه توان ساخت آنزیم ACC-دآمیناز نداشتند نیز آزمایش شدند (جدول 2). با بررسی فراوانی‌ها، آشکار شد که 75درصد از باکتری‌ها، بدون توان مصرف یا با توان مصرف ناچیز (کمتر از 1/0) بودند؛ همچنین، آشکار شد که از میان باکتری‌های جداسازی‌شده که سازندۀ آنزیم ACC-دآمیناز بودند (25درصد)، سهم خاک‌های شور، شور- سدیمی و معمولی به‌ترتیب 9، 9 و 7درصد بود (شکل 1-ب).

تغییرات توان ساخت آلفاکتوبوتیرات در جدایه‌های باکتری  : نتایج تجزیۀ واریانس داده‌ها نشان داد که تفاوت میان توان ساخت آلفاکتوبوتیراتدر جدایه‌های باکتری در سطح ۵درصد معنی‌دار بود (جدول 1). میان این 11 باکتری، جدایه‌های RN86، BN243 و RSS33 به‌ترتیب با توان ساخت 906، 904 و 901 نانو مول آلفاکتوبوترات/میلی‌گرم پروتئین/ساعت بیشترین اندازه آلفاکتوبوتیرات را ساختند و در یک گروه آماری قرار گرفتند (جدول 2). هرچند تفاوت‌هایی در توان ساخت آلفاکتوبوتیرات میان جدایه‌های برتر دیده شد، 5 جدایه که از دیدگاه مقایسۀ قطر کلنی‌ها، دارای توان مصرف ACC کمتری بودند (توان 80/0) هماهنگی بیشتری با توان ساخت آلفاکتوبوتیرات داشته و میان 39/0 تا 48/0 میکرومول در میلی‌گرم پروتئین در ساعت ساختند.

 

جدول 1- تجزیه واریانس داده‌های توان ساخت آلفا کتوبوتیرات در باکتری‌ها

منبع تغییر

درجۀ آزادی

میانگین مربعات

احتمال

تکرار

3

84/1 ns

349/0

جدایۀ باکتری

15

* 4/612

017/0

خطا

45

1/12

-

CV%=64/5

 

 

 

* نشان‌دهندۀ معنی‌داربودن در سطح 5درصد است.

 

 

ب

 

شکل 1- مقایسۀ فراوانی توان مصرفACC (الف) و نسبت باکتری‌های سازنده و غیرسازنده (ب) فراوانی نسبی جدایه‌های باکتری سازندۀ ACC-دآمیناز در خاک‌های نمونه‌برداری‌شده

جدول 2- توان ساخت آلفاکتوبوتیرات در جدایه‌های باکتری برتر

ردیف

جدایه‌های باکتری

توان ساخت آلفاکتوبوتیرات

(نانومول در میلی‌گرم پروتئین در ساعت)

شیب منحنی بردباری در برابر تنش

خشکی

شوری

1

BSS179

550±41c

201/0-±018/0c

141/0-±013/0c

2

BSS236

511±38c

193/0-±016/0c

148/0-±014/0c

3

BSS167

684±43c

205/0-±019/0a

138/0-±014/0a

4

BS132

507±43c

194/0-±018/0c

146/0-±012/0b

5

BS58

732±61b

188/0-±016/0c

151/0-±014/0d

6

RN84

724±74b

221/0-±021/0c

143/0-±012/0b

7

RN86

906±87a

209/0-±019/0c

135/0-±011/0c

8

RSS33

901±95a

120/0-±011/0d

102/0-±011/0b

9

BSS174

416±51b

151/0-±014/0c

134/0-±012/0c

10

BSS172

431±44c

193/0-±017/0c

138/0-±014/0c

11

BN243

904±92a

202/0-±018/0a

163/0-±014/0a

12

BSS235

386±42d

144/0-±013/0c

131/0-±011/0b

13

BSS194

313±38d

158/0-±015/0c

132/0-±012/0d

14

BS89

354±43d

201/0-±018/0c

143/0-±014/0b

15

BS77

313±37d

174/0-±016/0c

132/0-±014/0c

16

RS3

394±49d

203/0-±017/0d

128/0-±012/0b

میانگین‌هایی که با حرف یا حروف مشترک مشخص شده‌اند براساس آزمون دانکن در سطح ۵درصد اختلاف معنی‌داری با هم ندارند.

R=ریزوسفر, B=توده خاک, S=شور, SS=شور-سدیمی, N=بدون تأثیر شوری و سدیمی

 


مقایسۀ توان بردباری به تنش خشکی و شوری: درمورد سنجش تنش خشکی، با حل‌کردن مقادیر مختلف مادۀ پلی‌اتیلن‌گلیکول 6000 در محیط کشت باکتری، قابلیت بهره‌گیری مولکول‌های آب کاهش یافت و پتانسیل‌های اسمزی ناهمانندی ایجاد شد. همان‌طور که در شکل 2 درمورد جدایۀ RSS33 دیده می‌شود، با افزایش غلظت پلی‌اتیلن‌گلیکول 6000 در محیط کشت، چگالی نوری (OD600) به‌عنوان معیاری از رشد باکتری، روند کاهشی نشان داد. شیب منحنی حاصل، بیانگر شدت پاسخ جدایۀ باکتری به تنش ایجادشده است. به‌طوری که شیب کاهشی کمتر (شیب ملایم‌تر)، نشان‌دهنده بردباری نسبی بیشتر است که درمورد جدایۀ RSS33، این شیب برابر با 121/0- بود (شکل 2-الف). وضعیت کاهشی چگالی نوری و مقایسۀ سه جدایۀ برتر سازندۀ آنزیم ACC- دآمیناز در شکل 2 نشان داده شده است. همان‌طور که در جدول 2 نشان داده شده است، جدایۀ RSS33 نسبت به جدایه‌های دیگر، دارای توان بردباری در برابر خشکی بیشتری بود و جدایه‌های RN86 و BS243 با شیب‌های 165/0 و 171/0-، توان بردباری در برابر خشکی پایین‌تری داشتند.

همچنین، ارزیابی توان بردباری در برابر شوری جدایه‌ها با بهره‌گیری از محلول‌های نمکی (ترکیبی از کلریدهای سدیم، کلسیم و منیزیم) نشان داد که در این شرایط نیز، با افزایش قابلیت هدایت الکتریکی، چگالی نوری در طول‌موج 600 نانومتر تغییر یافت؛ در این حالت نیز، روند کلی شیب منحنی حاصل، شدت پاسخ جدایه‌های باکتری را به تنش شوری نشان داد؛ به‌طوری که شیب کاهشی کمتر، نشان‌دهندۀ بردباری نسبی بیشتر است. همان‌طور که در جدول 2 دیده می‌شود جدایۀ RSS33 با شیب 102/0- بردبارترین جدایه و پس از آن جدایه‌های BSS235 و BS77 به‌ترتیب با شیب‌های 131/0- و 132/0- در رتبه‌های بعدی قرار داشتند. منحنی‌های حاصل از آزمون بردباری در برابر تنش شوری درمورد جدایه‌های BSS243 و RN86 دارای شیب کاهشی شدیدتری نسبت به جدایۀ RSS33 بود (جدول 2).

 

 

   
   

شکل 2- (الف) پیامد تنش خشکی بر روند رشد جدایۀ RSS33، (ب) پیامد مصرف ACC و آمونیوم (NH3) بر روند رشد جدایۀ RSS33 در تنش، (ج) پیامد مصرف ACC و آمونیوم بر روند رشد جدایۀ BN243 در تنش، (د) پیامد مصرف ACC و آمونیوم بر روند رشد جدایۀ RN86 در تنش و (ه) مقایسه سه جدایۀ برتر سازندۀ آنزیم ACC-دآمیناز متأثر از تنش خشکی

 

ادامه شکل 2

 


پیامد تنش خشکی بر توان مصرف ACC در جدایه‌های باکتری: همان‌طور که در شکل 2 نشان داده شده است، با افزایش تنش خشکی، از توان مصرف ACC در جدایه‌ها کاسته شد. درمورد جدایۀ RSS33 در برابر دو جدایۀ برتر دیگر، این روندْ کندتر بود و همچنین با مقایسۀ دو منبع نیتروژن (آمونیوم و ACC) مشخص شد که در تنش‌های بالاتر، منبع ACC از مزیت نسبی هم برخوردار بود و با مصرف آن در باکتری، کاهش کمتری در رشد جدایۀ RSS33 در برابر مصرف آمونیوم حاصل شد (شکل 2-الف). درواقع با مصرف آمونیوم، حساسیت باکتری به تنش خشکی بیشتر شد. در جدایه‌های RN86 و BSS243، با مصرف ACC در برابر مصرف آمونیوم، کاهش شدیدتری در رشد باکتری دیده شد و می‌توان اظهار داشت که با افزایش تنش خشکی، تمایل این باکتری‌ها به جذب ACC و درواقع توانایی ساخت آنزیم ACC-دآمیناز کمتر شد.

پیامد تنش شوری بر توان مصرف ACC در جدایه‌های باکتری: همان‌طور که در شکل 3 دیده می‌شود، با افزایش تنش شوری، از توان مصرف ACC در جدایه‌ها کاسته شده که به‌صورت کاهش رشد نمایان می‌شود. درمورد جدایۀ RSS33 در برابر دو جدایۀ برتر دیگر، روند کاهش کندتر بود. در جدایه‌های RN86 و BSS243، با مصرف ACC، کاهش شدیدتری در رشد باکتری دیده شد و می‌توان اظهار داشت که با افزایش تنش خشکی، تمایل این باکتری‌ها به جذب ACC و درواقع توانایی ساخت آنزیم ACC-دآمیناز کمتر شد.

نتیجه شناسایی جدایۀ باکتری برتر: پس از انجام مراحل شناسایی ژنتیکی، نتایج تعیین توالی‌ها، به‌وسیلۀ نرم‌فزار بلست[31] بررسی شد و با توجه به میزان قرابت‌ها مشخص شد که به‌احتمال 99درصد این جدایۀ باکتری (RSS33)، متعلق به گونۀ باسیلوسسیمپلکس[32]است و در بانک ژن BankIt (Accession Number: KT599261) ثبت شد. باند الکتروفورز و درخت فیلوزنی در شکل 4 نشان داده شده است.

 

 

شکل 3- تغییرات رشد باکتری‌ها به‌عنوان معیاری از توان مصرف ACC در اثر تنش شوری

 

 الف

ب

   

شکل 4- (الف): باند الکتروفورز مربوط به تکثیر ژن 16S rRNAباکتری باسیلوسسیمپلکس (M: نشانگر 100 جفت بازی، B1: B. simplex (تکرار اول)، B2: B. simplex (تکرار دوم))            (ب): درخت فیلوژنی براساس توالی ژن 16S rRNAباکتری باسیلوسسیمپلکس (رسم‌شده با کمک نرم‌افزار MEGA.6 و بر مبنای الگوریتم نزدیک‌ترین همسایه[33])

 


بحث و نتیجه‏‏گیری.

در این پژوهش، با توجه به اینکه نمونه‌برداری اولیه به‌تعداد زیاد و از خاک‌های ناهمانند از دیدگاه قابلیت هدایت الکتریکی نسبت جذب سطحی سدیم انجام شد، باکتری‌های جداسازی‌شده نیز به همان نسبت، متنوع بود و توانایی‌های ناهمانند در ساخت آنزیم ACC- دآمیناز در تنش‌های خشکی و شوری از خود نشان دادند. همچنین، مشخص شد که 25درصد از باکتری‌های جداسازی‌شده، با درجه‌های مختلفی، سازندۀ آنزیم ACC-دآمیناز بودند. 12درصد از باکتری‌های جداسازی‌شده از خاک در مطالعات چاودهاری و سیندهو[xxxiv] توانا در ساخت آنزیم ACC-دآمیناز بودند (18). اما دیدن فراوانی جدایه‌ها نشان داد که تعداد باکتری‌های در محدودۀ بالاترین توانایی، اندک (تنها 2درصد از کل باکتری‌ها) بود؛ درحالی‌که بیش از 75درصد از جدایه‌ها، سازندۀ آنزیم ACC-دآمیناز نبودند. فراوانی نسبی باکتری‌های سازنده، در خاک‌های شور و شور- سدیمی در برابر خاک‌های معمولی بیشتر بود. این نتایج نشان داد که برای یافتن جدایه‌های باکتری سازندۀ آنزیم ACC-دآمیناز، می‌توان به خاک‌های شور و شور- سدیمی مراجعه کرد. در این پژوهش، با بهره‌گیری از چندین گام آزمون و مقایسۀ جدایه‌ها، یک باکتری متعلق به گونۀ باسیلوس‌سیمپلکس از ریزوسفر گندم در یک خاک شور-سدیمی جداسازی شد که ویژگی‌های یک باکتری برتر را برای شرایط خشکی و شور و شور-سدیمی‌بودن داشت. پژوهشگران مختلف مانند سیدیکی و همکاران، ساخت آنزیم ACC-دآمیناز در جنس باسیلوس را گزارش کردند (3). نتایج نشان داد که این باکتری به‌ازای مصرف ACC، آهنگ رشدی همانند مصرف آمونیوم از خود نشان داد. نسبت قطر کلنی باکتری باسیلوس‌سیمپلکس با مصرف ACC در برابر قطر آن با مصرف آمونیوم برابر یک بود و همچنین این باکتری توانست901 نانومول آلفاکتو بوتیرات در میلی‌گرم پروتئین در ساعت به‌عنوان معیاری از فعالیت آنزیم ACC-دآمیناز ساخت کند. براساس نتایج پژوهشگران مختلف، گونه‌های باکتری از جنس باسیلوس توانایی تولید مقادیر میان صفر تا 5/1 میکرومول آلفاکتوبوتیرات در میلی‌گرم پروتئین در ساعت را داشتند (3 و 19). در تنش‌های خشکی، شوری و شور-سدیمی، ترشحات ریشه‌ای به‌تبعیت از رشد گیاه، کمتر است و منابع آلی کمتری در اختیار باکتری‌ها قرار می‌گیرد؛ از طرفی، جمعیت موجودات خاکزی همانند باکتری‌ها نیز کمتر است و بنابراین توانایی بهره‌گیری از ACC به‌عنوان یک مزیت در رابطه بین باکتری و گیاه محسوب می‌شود. نبودِ کاهش شدید در توان مصرف ACC در شرایط تنش‌های حاکم بر خاک‌های متأثر از خشکی، شوری و شور-سدیمی، تعیین‌کنندۀ مؤثربودن مایه‌زنی است و به‌تدریج با افزایش رشد و توسعۀ ریشه‌های گیاه، آثار متقابل باکتری و گیاه در جهت گسترش رشد هردو موجود زنده پیش خواهد رفت. باکتری باسیلوس‌سیمپلکس، در تنش‌های خشکی و شوری، بیشتر از دیگر جدایه‌های برتر، آنزیم ACC-دآمیناز ساخت. به‌طوری که در پتانسیل‌های اسمزی و مقادیر شوری مختلف، توان مصرف ACC بیشتری در برابر دیگر جدایه‌ها داشت. اهمیت این موضوع از آنجا مشخص می‌شود که پژوهشگران مختلف، اظهار داشتند که بخشی از توانایی یک گونۀ گیاهی برای سازش با شرایط تنش خشکی و شوری بستگی به ریزجانداران توانا به ساخت آنزیم ACC-دآمیناز دارد (19 و 20). ازآنجایی که بخشی از کاهش رشد گیاه در شرایط خشکی، شوری و شور-سدیمی، به افزایش اندازۀ اتیلن و رسیدن آن به غلظت اتیلن تنشی در بافت گیاهی مربوط می‌شود؛ بنابراین مصرف ACC (پیش‌نیاز ساخت اتیلن) در باکتری‌های بردبار به شوری و خشکی و به دنبال آن عدمِ‌ساخت اتیلن اضافی، می‌تواند جبران‌کنندۀ این خلاء در گیاهان باشد (21). همچنین این باکتری، دارای توان بردباری به تنش به خشکی و شوری (اسمو-هالوتولرنت[xxxv]) مناسبی در برابر سایر جدایه‌ها بود. پژوهشگران گزارش کردند که درمورد جنس باسیلوس تعداد گونه‌های بیشتری در برابر جنس‌های دیگر باکتری، توانایی بردباری به تنش‌های غیرزیستی[xxxvi] مانند خشکی و شوری در سطح بالا را دارند (22). این موضوع به تشکیل اندوسپور در این باکتری‌ها و تجمع ترکیبات محافظت‌کننده از خشکی[xxxvii] همانند ترهالوز و گلوتامین برمی‌گردد؛ به‌طوری که پیگوت و هیلبرت[xxxviii] نیز اظهار داشتند که اندوسپورهای باسیلوس قادرند که شرایط نامناسب محیطی را تحمل کنند (23). این ویژگی، مایۀ این است که بتوان از آنها به‌شکل فرمولاسیون پودری بهره برد؛ به‌طوری که جمعیت‌های موردنظر از آنها بتوانند پویایی خود را حفظ کنند. با توجه به نتایج به‌دست‌آمده، گونۀ باکتری باسیلوس‌سیمپلکس، برای انجام آزمون‌های مزرعه‌ای به‌عنوان باکتری کاهش‌دهنده تنش‌های خاک‌های شور، شور-سدیمی و مناطق خشک و نیمه‌خشک پیشنهاد می‌‌شود.

 



[1]- Secondary salinization

[2] -Minimal Bioproductivity

[3] - ESP (Exchangeable sodium percentage)

[4] - SAR (Sodium adsorption ratio)

[5] -Gamalero & Glick

[6] - Siddikee

[7]- 1-Aminocyclopropane-1-carboxylate

[8] - Cleaving &Sequestering

[9] - (α-KB) α-ketobutyrate

[10] - EC (Electrical conductivity)

[11] - Complexometry

[12] -Flame photometry

[13] - Isolation

[14] - Purification

[15] - Slant Agar Medium

[16] - Dworkin foster

[17] -Penrose & Glick

[18] - Tryptic soybean broth

[19] -Vertex

[20] - PEG (Poly Ethylene Glycole) 6000

[21] - Michel & Kaufmann

[22] -OD (Optical density)

[23] - PCR (Polymerase chain reaction)

[24] -Amplification

[25] - Denaturing

[26] - Annealing

[27] - Extension

[28] - Ladder

[29] - Completely Randomized Design

[30] - DMRT (Duncan,s multiple range test)

[31] - Blast

[32] - Bacillus simplex

[33] - Neighbor-joining

[xxxiv] - Chaudhary & Sindhu

[xxxv] -Osmo-halotolerant

[xxxvi] -Abiotic tensions

[xxxvii] - Xeroprotectant

[xxxviii] - Piggot & Hilbert

 

 

(1) Qadir M., Ster JD., Schubert S., Noble AD., Sahrawat KL. Phytoremediation of sodic and saline-sodic soils. Advance in Agronomy 2007; 96(2): 198-247.

(2)  Gamalero E., Glick BR. Ethylene and abiotic stress tolerance in plants. In: Ahmad P., Prasad MNV. editors. Environmental Adaptations and Stress Tolerance of Plants in the Era of Climate Change, Springer-Verlag, Berlin; 2012: 395-412.

(3)  Siddikee MDA., Sundaram S., Chandrasekaran M., Kim, K., Selvakumar G., Tongmin S. Halotolerant bacteria with ACC deaminase activity alleviate salt stress effect in canola seed germination. Journal of Korean Society Applied Biology and Chemistry 2015; 58(2): 237–241.

(4)  Li Z., Chang S., Ye S., Chen M., Lin L., Li Y., Li S., An Q. Differentiation of 1-aminocyclopropane-1-carboxylate (ACC) deaminase from its homologs is the key for identifying bacteria containing ACC deaminase. FEMS Microbiology Ecology 2015; 91(1): 86-102.

(5) Soleimani R. Cumulative and residual effects of zinc sulfate on grain yield, zinc, iron, and copper concentration in corn and wheat. Journal of plant nutrition 2012; 35(1):85-92.

(6) Meybodi SM., Khorasani H. Biosorption of chromium by Pseudomonas sp. isolated from oil contaminated soils of Khuzestan. Biological Journal of Microorganism 2015; 14(3): 101-110.

(7)  Glick BR., Modulation of plant ethylene levels by the bacterial enzyme ACC deaminase. FEMS Microbiology Letters 2005; 251(1): 1-7.

(8)  Barillot CDC., Sarde CO., Bert V., Tarnaud E., Cochet N. A standardized method for the sampling of rhizosphere and rhizoplan soil bacteria associated to a herbaceous root system. Annals of Microbiology 2013; 63(3): 471-476.

(9)  Page AL., Miller RH., Keeney DR. Methods of Soil Analysis. 2nd Ed. American Society of Agronomy, Madison, WI., USA; 1982.

(10)            Penrose DM., Glick BR. Methods for isolating and characterizing ACC deaminase-containing plant growth-promoting rhizobacteria. Physiology of Plants 2003; 118(1): 10-15.

(11)           Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976; 72(3): 248- 254.

(12)           Michel BE., Kaufmann MR. The osmotic potential of polyethylene glycol 6000. Plant Physiology 1973; 51(5): 914–916

(13)           Sandhya V., Ali SKZ., Minakshi G., Reddy G., Venkateswarlu B. Alleviation of drought stress effects in sunflower seedlings by the exopolysaccharides producing Pseudomonas putida strain GAP-P45. Biology and Fertility of Soils 2009; 46(1): 17–26.

 

(14)           Dauphin L., Moser A., Bowen MD. Evaluation of five commercial nucleic acid extraction kits for their ability to inactivate Bacillus anthracis spores and comparison of DNA yields from spores and spiked environmental samples. Journal of Microbiology Methods 2009;76(1): 30-37.

(15)           Maciel BM., Santos ACF., Dias JCT., Vidal RO., Dias RGC., Gross E., Cascardo JCM., Rezende RP. Simple DNA extraction protocol for a 16S rDNA study of bacterial diversity in tropical land farm soil used for bioremediation of oil waste. Genetic and Molecular Research 2009; 8(1): 375-388.

(16)            Hebron HR., Yang Y., Hang J. Purification of genomic DNA with minimal contamination of proteins. Journal of Biomolecular Technology 2009; 20(3): 278-281.

(17)           Parmeela S., Johri BN. Phylogenetic analysis of bacterial endophytes showing antagonism against Rhizoctonia solani. Current Science 2004; 87(5): 687-692.

(18)           Chaudhary D., Sindhu SS. Inducing salinity tolerance in chickpea (Cicer arietinum L.) by inoculation of 1-aminocyclopropane-1-carboxylic acid deaminase-containing Mesorhizobium strains. African Journal of Microbiology Research 2015; 9(2): 117-124.

(19)           Nadeem SM., Zahir ZA., Naveed M., Nawaz S. Mitigation of salinity-induced negative impact on the growth and yield of wheat by plant growth-promoting rhizobacteria in naturally saline conditions. Annals of Microbiology 2013; 63(3): 225-232.

(20)           Alikhani HA., Saleh Rasteen N., Bihamta M. The Evaluation of IAA and ACC deaminase production ability by Iranian soils rhizobial strains and the effects of superior strains application on plant growth characteristics. Iranian Journal of Agricultural Science 2007; 38(4): 693-703.

(21)           Shaharoona B., Muhammad A., Rashid W., Khalid A. Role of ethylene and plant growth-promoting rhizobacteria in stressed crop plants. In: Venkateswarlu B., Shanker AK., Shanker C., Maheswari M., editors. Crop stress and its management: Perspectives and Strategies. Springer Science; 2012: 429-446.

(22)           Wang QF., Li W., Liu YL., Cao H., Li Z., Guo GQ. Bacillus qingdaonensis sp. nov., a moderately haloalkaliphilic bacterium isolated from a crude sea-salt sample collected near Qingdao in eastern China. Internatial journal of Systematic Evolutionary Microbiology 2007; 57(2): 1143-1147.

(23)           Piggot PG., Hilbert DW. Sporulation of Bacillus subtilis, Current Opinion in Microbiology 2004; 7(6): 579–586.