بررسی تنوع باکتریایی غالب در فلور باکتری‌های هوازی و بی‌هوازی گل‌فشان‌های جنوب ‌شرقی دریای‌ خزر

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 دانشیار میکروبیولوژی، دانشگاه آزاد اسلامی واحد تهران شمال، تهران، ایران

2 استادیارمیکروبیولوژی و بیوتکنولوژی، پژوهشگاه صنعت نفت، تهران، ایران

3 استادیار میکروبیولوژی و بیوتکنولوژی، پژوهشگاه صنعت نفت، تهران، ایران

4 مربی زمین‌شناسی، دانشگاه آزاد اسلامی واحد تهران شمال، تهران، ایران

5 دانشیار زمین‌شناسی، دانشگاه آزاد اسلامی واحد تهران شمال، تهران، ایران

6 کارشناس‌ارشد میکروبیولوژی، دانشگاه آزاد اسلامی واحد تهران شمال، تهران، ایران

7 دانشجوی دکتری میکروبیولوژی، دانشگاه آزاد اسلامی واحد تهران شمال، تهران، ایران

8 کارشناس‌ارشد میکروبیولوژی و بیوتکنولوژی، پژوهشگاه صنعت نفت، تهران، ایر

چکیده

مقدمه: گِل‌فشان‌ها حاوی مواد خاکی عمق زمین مخلوط با آب هستند که به‌شکل خمیر شل و یا غلیظ به سطح زمین می‌رسند. گل‌فشان‌های حاشیۀ جنوب شرقی دریای خزر و شمال شرقی استان گلستان از مهم‌ترین گل‌فشان‌های ایران هستند و در این پژوهش بررسی شدند.
مواد و روش‌ها: به‌منظور بررسی حضور باکتری‌ها در گل‌فشان، نمونه‌ها در محیط‌های هوازی و بی‌هوازی کشت داده شده‌اند. برای کشت انواع هوازی از محیط‌های رایج برای باکتری‌ها استفاده شد و نمونه‌های بی‌هوازی در محیط تیوگلیکولات براث در جار بی‌هوازی کشت داده شدند. علاوه بر بررسی صفت نمک‌دوستی، آنزیم‌های هیدرولازی و خصوصیات فیزیولوژیک سویه‌ها ارزیابی شد.
نتایج: طبق بررسی‌های انجام‌شده از بین 22سویۀ منتخب، 17سویۀ هوازی و 5 سویۀ بی‌هوازی اختیاری بودند. از بین 17 سویۀ هوازی، 11 سویۀ با موفقیت توالی‌یابی شدند. 5 نمونۀ بی‌هوازی اختیاری توالی‌یابی شدند و درخت فیلوژنتیکی آن‌ها رسم شد. اکثر نمونه‌ها باسیل‌های گرم‌مثبتی بودند که توانایی گسترده‌ای در تولید آنزیم‌های هیدرولازی داشتند. با توجه به رشد تمامی جدایه‌ها در محیط حاوی ۰تا15درصد نمک می‌توان آن‌ها را مقاوم به نمک محسوب کرد. ‌
بحث و نتیجه‌گیری: براساس نتایج این پژوهش می‌توان یک ارزیابی از تنوع میکروبی گل‌فشان‌های بررسی‌شده به ‌دست داد. محیط گل‌فشان مانند محیط‌های با شرایط سخت است که امکان کشت تمامی میکروارگانیسم‌های آن مقدور نیست؛ به‌خصوص درمورد نمونه‌های بی‌هوازی اجباری که به شرایط بسیار خاصی نیاز دارند. با توجه به وجود آنزیم‌های هیدرولازی در سویه‌های جداشده از این گل‌فشان‌ها آن‌ها دارای ظرفیت استفاده در زیست‌فناوری هستند. 

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Biodiversity of aerobic and anaerobic bacteria, dominant species, present in mud volcanoes of the southeastern bank of Caspian Sea

نویسندگان [English]

  • Abbas Akhavansepahi 1
  • Ghasemali Mohebali 2
  • Behnam Rasekh 3
  • Jalal Fasle bahar 4
  • Mohammad ali Arian 5
  • Mahnaz Diansaei 6
  • Sare Farahani 7
  • Mohammad fazel Foroughian yazdi 8
1 Associate Professor of Microbiology, Islamic Azad University, North Tehran Branch, Tehran, Iran
2 Assistant Professor, Microbiology and Biotechnology Research group, Reseach Institute of Petroleum Industry, Tehran, Iran
3 Assistant Professor, Microbiology and Biotechnology Research Group, Research Institute of Petroleum Industry, Tehran, Iran
4 Instructor of Geology, Islamic Azad University, North Tehran Branch, Tehran, Iran
5 Assistant Professor of Geology, Islamic Azad University, North Tehran Branch, Tehran, Iran
6 M.Sc of Microbiology, Islamic Azad University, North Tehran Branch, Tehran, Iran
7 PhD student of Microbiology, Islamic Azad University, North Tehran Branch, Tehran, Iran
8 M.Sc. Microbiology and Biotechnology Research Group, Research Institute of Petroleum Industry, Tehran, Iran
چکیده [English]

Introduction:Any point at which over time, the earth continuously exudes a mud-like substance, may sometimes be referred to as a "mud volcano". The mud produced by mud volcanoes is often a slurry of fine solids suspended in liquids which may include water, which is frequently acidic or salty and hydrocarbon fluids. Mud volcanoes in the southeastern bank of the Caspian Sea and the North Eastern of Golestan province of the country mud volcanoes are among the most important mud volcanoes in Iran and therefore, they were microbiologically examined. In this study, biodiversity of aerobic and anaerobic bacteria, dominant species, was investigated.
Materials and methods: In order to investigate the microbial diversity of mud volcanoes, the samples were cultured in aerobic and anaerobic conditions. The common culture media were used for cultivating aerobic bacteria where, the thioglycollate broth was used to culture anaerobic bacteria. In addition to study the halophilic trait, hydrolase enzymes and physiological characteristics of the isolates were evaluated.
Results: The studies selected from 22 strains, 17 strains of aerobic and anaerobic 5 strains were optional. Polymerase chain reaction and blast samples between 17 and 11 strains of aerobic side were successfully sequenced. 5 of 5 samples per sequencing and phylogenetic tree facultative were drawn. Most samples were gram positive bacillus that can produce a wide range of hydrolase enzymes, respectively. Due to the growth of all the strains in the environment can be resistant to %0-15 salt.
Discussion and conclusion: The results of this study can obtain an assessment of microbial mud volcano. Mud volcano, including environments with extreme conditions which is not feasible to culture all microorganisms, especially in the case of anaerobic were forced to accept a very specific need. Due to the presence of hydrolase enzymes in the strains isolated from the mud volcanoes they are used in biotechnology.

کلیدواژه‌ها [English]

  • Biodiversity
  • Bacteria
  • Mud volcanoes
  • Caspian Sea
  • Phylogenetic tree

مقدمه.

به‌دلیل ارتباط بین گل‌فشان‌ها با ذخایر نفت وگاز، طی چند دهۀ اخیر شرکت‌های تحقیقاتی نفت جهت دست‌یابی به مخازن هیدروکربنی در اعماق اقیانوس‌ها و دریاها در پی یافتن محل فعالیت این پدیده‌های زمین‌شناسی بوده‌اند. کاوش  متخصصان شرکت‌های نفتی کشورهای حاشیۀ دریای خزر و دریای سیاه در بستر دریا، بیانگر این ادعاست. همگام با کاوشگران صنعت نفت، متخصصان سایر علوم از جمله میکروبیولوژی با بهره‌گیری ازاطلاعات به‌دست‌آمده دامنۀ ‌فعالیت‌های پژوهشی خود را گسترش دادند و در این زمینه به نتایج قابلِ‌توجهی دست یافته‌اند.

تنوع میکروبی در گل‌فشان‌هایی که تاکنون شناخته شده‌اند، بیشتر از نوع بی‌هوازی)3-1) و کمتر از نوع هوازی (1) است. متابولیسم میکروبیدر نمونه‌های به‌دست‌آمده از گِل‌فشان‌ها از نوع متانوتروف (2) یا احیاکنندۀ سولفات (3) است. حدود 86درصد گازهای خروجی گِل‌فشان‌ها متان و به‌مقدار کمتر دی‌اکسیدکربن و نیتروژن است. میکروب‌های موجود در این مکان‌ها از سوبستراهای کربنی که سیال هیدروکربنی هستند، به‌شکل تخمیری استفاده می‌کنند (4). بررسی رسوب گل‌فشان‌های فعال سه فیلوتیپ پروتئوباکتری‌ها، اکتینوباکتری‌ها و فوزوباکتری‌ها را نشان داده است. پس از مقایسۀ داده‌ها در  بانک ژن NCBI این نتایج حاصل شد: باکتری‌های غیرقابلِ‌کشت، باکتری‌های ناشناخته،Clostridium thiosulfatireducens، Frigovirgula patagoniensis و Pseudomonas aeruginosaشناسایی شدند.کلوستریدیوم‌ها با تشکیل سولفات رابطه داشتند؛ در مقالات متعدد اعلام شده است که سویه‌های جداشده از گل‌فشان در تولید سوخت‌های میکروبی کاربرد دارند(5).با هدف جداسازی باکتری‌های احیاکنندۀ سولفات، نمونه‌های برگرفته از گل‌فشان رشته‌کوه اَپناین شمالی[1] واقع در ایتالیا در محیط غنی کشت داده شدند. میکروب‌های جداسازی‌شده براساس 16S rRNAشامل Desulfovibrio psychrotoleransوClostridium thiosulfatireducensاست که ممکن است پروتئین‌هایی با منشأ میکروبی را تخمیر کنند (5-7). گونۀ متعلق به جنس کلوستریدیوم که از این گل‌فشان جدا شده، رکسارسون یا آرسنیک‌اسید را طی فرایند تغییر و تبدیل زیستی[2] به شکل آرسنیک معدنی آزاد می‌کند (8). به‌طور کلی هدف از انجام پژوهش حاضر بررسی تنوع میکروبی به‌خصوص انواع باکتری‌های هوازی و بی‌هوازی اختیاری موجود در سه گل‌فشان مستقر در جنوب شرقی دریای خزر است. نتایج حاصل از آن می‌تواند منبع مناسبی برای سایر پژوهش‌های مشابه در آینده باشد چرا که تاکنون در این زمینه در ایران مطالعۀ مشابهی انجام نشده است.

 

مواد و روش‌ها.

تعیین نقاط نمونه‌برداری: نمونه‌برداری از سه گل‌فشان نفتلیچه، اینچه‌برون و قارنیاریق انجام شد. در شکل شماره 1 موقعیت جغرافیایی گل‌فشان‌ها نشان داده شده است.

 

 

شکل1- موقعیت جغرافیایی سه گل‌فشان بررسی‌شده در حاشیه دریای خزر

نمونه‌برداری با دو هدف بررسی حضور انواع هوازی و بی‌هوازی انجام شد. به ‌این منظور نمونه‌برداری از سطح، مواد میانه، مناطق عمقی گل‌ولای، آب‌های غیرسطحی، رسوبات عمیق گل‌فشان و بستر دریا انجام شد. نمونه‌ها درون فلاسک‌های با دمای حدود 4 درجه سانتی‌گراد در مدت 24 ساعت از منطقۀ نمونه‌برداری در گمیشان استان گلستان به آزمایشگاه محمودیۀ تهران منتقل شدند. برای انتقال نمونه‌های بی‌هوازی از ظروف خاص رشد بی‌هوازی حاوی گازپک[3] استفاده شد.

کشت نمونه‌ها و جداسازی باکتری‌ها: به‌منظور به‌دست‌آوردن میکروب‌های متنوع هوازی و بی‌هوازی اختیاری موجود در گل‌فشان، لازم است از انواع مناسب محیط‌های کشت میکروبی با درنظرگرفتن pH محیط گل‌فشان و میزان نمک آن استفاده شود. به‌منظور کشت نمونه‌های هوازی، جداسازی به‌روش پورپلیت انجام شد. پس از خالص‌سازی تک‌کلنی‌ها با کشت متوالی، رنگ‌آمیزی گِرم انجام شد. پس از مشاهده و تشخیص باسیل‌های گرم‌مثبت و اسپوردار، باسیل‌های گرم‌منفی و کوکسی‌های گرم‌مثبت، آزمایش‌های تشخیصی شامل اندول، لستیناز، احیای نیترات، کاتالاز، اوره‌آز، هیدرولیز ژلاتین، اکسیداز، MR-VP، دکربوکسیلاز، KOH، تخمیر مواد قندی، هیدرولیز نشاسته، هیدرولیز کازئین، محیط کشتOF، محیط آبگوشت 7درصد نمک، محیط TSI و محیط سیمون سیترات آگار برای شناسایی آن‌ها تا حد جنس یا گونه انجام شد. آزمایش‌های بیوشیمیایی و استفاده از محیط‌های اختصاصی برای افتراق انواع باکتری‌های گل‌فشان با تنظیم میزان نمک و pH انجام شد(5).

برای جداسازی باکتری‌های بی‌هوازی از محیط کشت‌های حاوی پودر جگر و تیوگلیکولاتبراث تهیه‌شده طبق دستورالعمل استاندارد کشت باکتری‌های بی‌هوازی استفاده شد. برای تهیۀ پلیت،30 گرم بر لیتر از محیط کشت و 15 گرم بر لیتر آگار با یکدیگر مخلوط شد، pH  مخلوط بر روی 1/7 تنظیم شد و در دمای 121 درجه سانتی‌گراد به‌مدت 15 دقیقه اتوکلاو شد. محیط‌های براث روزانه به‌طور مرتب تا 7 روز مشاهده و بررسی شدند(6).

پس از بررسی اولیه محیط‌های کشت، با توجه به شمارش بالای میکروبی نمونه، رقیق‌سازی انجام شد و از غلظت 8-10 تا 10-10، رقت متوالی تهیه شد. به‌منظور رشد باکتری‌های بی‌هوازی‌اختیاری پلیت‌ها در جار بی‌هوازی قرار داده شدند و در دو دمای 30 و 37 درجه سانتی‌گراد گرماگذاری شدند. با تجدید کشت و اطمینان از خلوص سویه‌ها، بررسی ملکولی کلنی‌های خالص انجام شد.

شناسایی مولکولی باکتری‌های هوازی: سویه‌های خالص‌شده از نظر ویژگی‌های میکروسکوپی، ماکروسکوپی، فیزیولوژیکی وتست‌های مختلف بیوشیمیایی دسته‌بندی شدند. پس از حذف سویه‌های تکراری و آن‌هایی که تکثیر چندانی نداشتند، تعداد 17 سویه برای بررسی فیلوژنتیکی انتخاب شد. برای استخراج DNA  سویه‌های منتخب، از کیت MBST[4] متعلق به شرکت روبین‌طب‌گستر مخصوص باکتری‌های گرم‌منفی و گرم‌مثبت استفاده شد.

ابتدا هریک از باکتری‌های جداشده در محیط کشت  LB در دمای 37 درجه سانتی‌گراد، به‌مدت 18 ساعت نگهداری شد. سپس نمونۀ موردِنظر به لوله‌های اپندورف 2 میلی‌لیتری انتقال داده شد و برای 2 دقیقه سانتریفیوژ (rpm13000 در دمای37 درجه سانتی‌گراد) شد. سپس مایع رویی دور ریخته شد و این کار تا زمان به‌دست‌آوردن مقدار مناسب از رسوب باکتری ادامه یافت. مراحل بعدی طبق پروتکل کیت استخراج ژنوم MBST انجام گرفت.

به‌منظور تکثیر ژن 16S rRNAدر 17 سویۀ منتخب هوازی از پرایمرهای عمومی تهیه‌شده از شرکت روبین‌طب‌گستر، به ترتیب زیر برای انجام واکنش زنجیره‌ای پلیمراز استفاده شد(7).

Fd: 5'  AGA GTT TGA TCC TGG CTC AG 3'

Rd: 5'  TAA GGA GGT GAT CCA GCC   3'

 


FM: 8F :  5' AGAGTTGGATCCTGGCTCAG   3'

RM: 1541R:  5' AAGGAGGTGATCCAGCCGCA3'

 

واکنش زنجیره‌ای پلیمراز در حجم نهایی 25 میکرولیتر انجام شد. به‌منظور تکثیر ژن  16S rRNAبا استفاده از واکنش زنجیره‌ای پلیمراز آب دوبار تقطیر استریل (3/18 میکرولیتر)، بافر با غلظت 1X(5/2 میکرولیتر)، dNTPs (1میکرولیتر)، پرایمرهای رفت و برگشت هرکدام به‌مقدار ۱ میکرولیتر، DNA ژنومی (1 میکرولیتر)، آنزیم DNATaq پلی‌مراز (2/0 میکرولیتر) استفاده شد.

مراحل انجام واکنش زنجیره‌ای پلیمراز برای واسرشت اولیۀ دمای 95 درجه سانتی‌گراد به‌مدت60 ثانیه و 30 چرخۀ تکرارشونده شامل واسرشت با دمای 95 درجه سانتی‌گراد به‌مدت 60 ثانیه، اتصال با دمای 50 درجه سانتی‌گراد و زمان 30 ثانیه و سنتز با دمای 72 درجه سانتی‌گراد و زمان 60 ثانیه و پس از پایان 30 چرخه برای سنتز نهایی دمای 72 درجه سانتی‌گراد به‌مدت 10 دقیقه تنظیم شد.

پس از خالص‌سازی محصول واکنش زنجیره‌ای پلیمراز، محصول نهایی توسط شرکت کیاژن توالی‌یابی شد. نتایج توالی‌یابی با استفاده از نرم‌افزارChromas Pro ویرایش و در فرمتFASTA  ذخیره شد و به‌کمک نرم‌افزارBLAST در پایگاه دادۀ  NCBI، با سایر داده‌های مندرج در GenBank مقایسه و درصد تشابه سویه‌های به‌دست‌آمده با انواع شناخته‌شدۀ آن‌ها تعیین شد و درپایان تحلیل فیلوژنتیک سویه‌ها با استفاده از نرم‌افزارMEGA  (ویرایش چهارم) و درخت فیلوژنتیک با الگوریتم neighbor-joining رسم شد.

شناسایی مولکولی باکتری‌های بی‌هوازی: تودۀ سلولی در محیط کشت حاوی پودر جگر و تیوگلیکولات براث به‌وسیلۀ سانتریفیوژ از محیط‌کشت مایع جدا شد و DNA ژنومی مشابه روش‌های استفاده‌شده برای باکتری‌های هوازی خارج شد. برای نمونه‌های بی‌هوازی 2 پرایمر طراحی شد. براین‌اساس سویه‌هایی که با پرایمر  Aواکنش تکثیری داشتند با مشخصۀ akh.1-3 و نمونه‌هایی که با پرایمرB تکثیر یافتند با مشخصۀ akh.4,5 نام‌گذاری شدند.

به‌منظور تکثیر ژن16S rRNA  با استفاده از واکنش زنجیره‌ای پلیمراز بافر با غلظت 1X در ترکیب نهایی MgCl2 با غلظت mM5/1، dNTPs 200 میکرومول، پرایمرهای رفت و برگشت (D1) هرکدام به‌مقدار 5 فمتومول، DNA ژنومی 5 میکرولیتر، آنزیم DNATaq پلیمراز به‌میزان 1 میکرولیتراستفاده شد(7).

A:

FD1: 5' AGA GTT TGA TCC TGG CTT AG 3'

RD1: 5' TAA GGA GGT GAT CCA GCC 3'

B:

9F:5̕-AAG AGT TTG ATC ATG GCT-3̕

1541R:5̕-AGG AGG TGA TCC AAC CGC-3̕

 

مراحل انجام واکنش زنجیره‌ای پلیمراز نمونه‌های بی‌هوازی، با واسرشت اولیه دمای 95 درجه سانتی‌گراد به‌مدت 60 ثانیه و 30 چرخه تکرارشونده شامل واسرشت با دمای 95 درجه‌ سانتی‌گراد به‌مدت 60 ثانیه، اتصال با دمای 50 درجه ‌سانتی‌گراد و زمان 30 ثانیه و سنتز با دمای 72 درجه ‌سانتی‌گراد و زمان 90 ثانیه و پس از پایان یک چرخه برای سنتز نهایی دمای 72 درجه ‌سانتی‌گراد به‌مدت 10 دقیقه تنظیم شد.

محصول واکنش زنجیره‌ای پلیمراز در پلاسمید pTZ57RT/A کلون شد و کلونی‌های سفید حاوی DNA خارجی روی پلیت حاوی IPTG و X-GAL  انتخاب و کتابخانۀ ژنی برای  ژن16S rRNA ساخته شد. سپس از کتابخانۀ موجود چند کلون انتخاب شد و پس از تأیید حضور قطعۀ خارجی توسط واکنش زنجیره‌ای پلیمراز با استفاده از پرایمرهای رفت و برگشتD1 در کلون‌ها از 5 کلون با استفاده از کیت استخراج پلاسمید، DNA پلاسمیدی خارج شد و با پرایمرهایM13 fwd و M13Rev  از دو طرف تعیین توالی شد.

توالی‌های حاصل با توالی‌های موجود در پایگاه دادۀ NCBI بخش توالی‌های 16S rRNAتوسط نرم‌افزار BLAST مقایسه شد و توالی‌های انتهای´3 و´ 5 آن بررسی و آنالیز شد و توالی کامل ژن 16S rRNA به‌دست آمد. توالی مربوط به هر کلون در پایگاه دادۀ EZtaxon از نظر شباهت با توالی‌های 16S rRNA موجود در بانک‌های اطلاعات زیستی بررسی شد. توالی 16S rRNA سویه‌های ثبت‌شده در پایگاه داده‌های زیستی که بیشترین قرابت را با توالی ژن مربوطه داشتند، برای رسم درخت فیلوژنی با استفاده از نرم‌افزار MEGA (ویرایش پنجم) استفاده شد.

آنالیز عنصری نمونه‌های گل‌فشان: برای آنالیز عنصری نمونه‌های جمع‌آوری‌شده از سه گل‌فشان با روش شیمی تر و به‌کمک دستگاه  ICP-OES (پلاسمای جفت‌شدۀ القایی نشرنوری) اقدام شد.
نتایج.

باکتری‌های هوازی: در این پژوهش از میان محیط‌های استفاده‌شده برای نمونه‌های هوازی، محیط نوترینت آگار و BHI آگار کارایی بالاتری در جداسازی میکروب‌ها با استفاده از روش رقیق‌سازی متوالی داشتند. در محیط‌های ذکرشده تعداد کلنی‌های بیشتری رشد کردند که می‌تواند بیانگر تطابق بیشتر این محیط‌ها با شرایط فیزیکوشیمیایی گل‌فشان‌ها است. اکثر کلنی‌های به‌دست‌آمده به‌رنگ سفید کرم و یا حتی بی‌رنگ بودند. همچنین در میان سویه‌های کروی‌شکل، کلنی‌هایی به‌رنگ زرد و نارنجی مشاهده شد. از نکات قابلِ‌توجه رشد سریع اکثر کلنی‌ها به‌مدت 48-24 ساعت بود. در محیط‌های مک‌کانکی آگار وENDO Agar هیچ‌گونه کلنی ظاهر نشد. در محیط سابورودکستروزآگار به‌جای رشد قارچ وکپک، کلنی‌های باکتریایی به‌رنگ‌های قرمز، صورتی، سبز، قهوه‌ای، سیاه و بنفش مشاهده شد که اکثریت دارای اشکال باسیلی و چندشکلی بودند. در مجموع، 127 سویۀ باکتری از نمونه‌های هوازی جدا شد. بیشترین تعداد باکتری‌های هوازی از منطقۀ گل‌فشان قارنیاریق جدا شد که معادل 89 سویه بود و حدود 72درصد کل جدایه‌ها را شامل می‌شود. در شکل 2 نمودار مقایسه‌ای تعداد باکتری‌های هوازی جداشده از گل‌فشان‌ها رسم شده است.

 

شکل 2- مقایسۀ تعداد سویۀ باکتری هوازی جداشده از 3 گل‌فشان و ذکر نسبت آن‌ها (%)

از میان جدایه‌های به‌دست‌آمده از محیط‌های کشت، تفکیک جدایه‌ها براساس رنگ‌آمیزی گرم و مشاهدۀ لام میکروسکوپی نشان داد که گل‌فشان قارنیاریق دارای فراوانی باکتریایی بیشتری در میان سایر مناطق گل‌فشانی است.

تمامی جدایه‌ها از نظر شکل و ویژگی‌های کلنی، واکنش گِرم و شکل و آرایش میکروسکوپی سلول، شکل و موقعیت اسپور، حرکت، واکنش کاتالاز و اکسیداز بررسی شدند. در پایان بررسی لام و مشاهدۀ واکنش KOH 3% برای جدایه‌ها نشان داد که درصد فراوانی جدایه‌ها به این ترتیب است: باسیل‌های گرم‌مثبت 45درصد، باسیل‌های گرم‌منفی 36درصد و کوکوس‌های گرم‌مثبت 19درصد. همچنین مشاهدۀ لام نشان داد که باسیل‌های گرم‌مثبت اسپوردار با تعداد 46 عدد (37درصد) بیشترین فراوانی را در میان جدایه‌ها دارند. از نظر واکنش کاتالاز اکثر باسیل‌های گرم‌مثبت و کوکوس‌های جداشده، کاتالازمثبت و اکسیدازمثبت(بیشتر در باسیلوس‌ها) بودند.

براساس ویژگی‌های فنوتیپی، جدایه‌های بی‌هوازی به چندین گروه تقسیم شدند. با توجه به آزمایش‌های بیوشیمیایی از بین سویه‌های گرم‌منفی اکثراً جنس‌های سودوموناس، سالمونلا و سیتروباکتر و نیز اشرشیا کلی مشاهده شد و از بین کوکوس‌ها از استافیلوکوک‌ها بیشتر نمونه‌ها مربوط به استافیلوکوک اورئوس و از استرپتوکوک‌ها بیشتر نمونه‌ها مربوط به انتروکوک بود. ویژگی‌های ریخت‌شناختی، فیزیولوژیک و بیوشیمیایی سویه‌های منتخب در جدول‌های 1 و 2 نشان داده شده است.


 

جدول 1- خصوصیات ظاهری 17 سویۀ باکتری‌های هوازی جداشده

اسپور

اکسیداز

کاتالاز

KOH

(3%)

رنگ آمیزی گرم

رنگ کلنی

شکل سلول

سویه

ردیف

+

+

+

-

+

شیری

باسیل کوتاه

B1a

1

+

+

-

-

+

کرمی

باسیل گوانول‌دار

B3c

2

+

+

+

-

+

کرمی

باسیل

B5a

3

+

+

+

-

+

کرمی

باسیل

B6a

4

+

+

+

-

+

کرمی

باسیل

B8a

5

+

+

+

-

+

کرمی

باسیل

B9a

6

+

+

+

-

+

کرمی

باسیل

B10a

7

+

-

+

-

+

بی رنگ

باسیل

B12a

8

+

+

-

-

+

کرمی

باسیل گرانول‌دار

B14c

9

+

+

+

-

+

کرمی

باسیل دراز رشته‌ای

B16a

10

+

+

+

-

+

کرمی

باسیل کوتاه

B18a

11

+

+

+

-

+

کرمی

باسیل کوتاه

B19a

12

+

+

+

-

+

سفید

باسیل

B21a

13

-

+

+

-

+

سفید

باسیل

B22a

14

+

-

+

-

+

کرمی

باسیل رشته ای

B23a

15

+

+

-

-

+

کرمی

باسیل

B25b

16

-

+

+

-

+

سفید

کوکوباسیل

B31b

17

a: نمونۀ گل‌فشان قارنیاریق؛b: نمونۀ گل‌فشان نفتلیجه؛c : نمونۀ گل‌فشان اینچهبرون

جدول 2-آزمایش‌های تشخیصی مربوط به 17 سویۀ باکتری هوازی جداشده

ژلاتین

مالتوز

زایلوز

گلوکز

S

I

M

نیترات

NaCl 7%

سیترات

MR

VP

Urea

آنزیم لستیناز

آنزیم کازئیناز

آنزیم آمیلاز

سویه

ردیف

+

+

+

+

-

+

+

-

+

-

-

+

-

+

+

+

B1a

1

-

+

-

+

-

-

+

+

+

-

+

-

+

-

+

-

B3c

2

-

+

-

+

-

-

-

-

+

-

+

-

-

-

+

+

B5a

3

-

+

+

+

-

-

+

+

+

+

-

+

-

-

-

+

B6a

4

-

+

-

+

-

-

-

-

+

+

+

-

+

-

+

-

B8a

5

+

+

-

+

-

 

+

+

+

+

-

+

-

-

+

+

B9a

6

+

+

+

+

-

-

-

+

+

+

-

+

-

-

+

+

B10a

7

-

+

-

+

-

-

+

-

+

+

+

-

+

-

+

+

B12a

8

-

+

-

+

-

-

-

-

+

-

+

-

+

-

+

-

B14c

9

-

+

-

+

-

-

-

+

+

+

+

-

-

-

-

-

B16a

10

-

+

-

+

-

-

+

-

+

+

+

-

-

-

+

+

B18a

11

-

+

-

+

-

-

+

-

+

+

+

-

-

-

-

-

B19a

12

-

+

-

+

-

-

-

-

+

+

-

-

+

-

+

+

B21a

13

-

+

+

+

-

-

-

+

+

+

+

-

-

-

+

-

B22a

14

-

+

-

+

-

-

-

+

+

+

+

-

-

-

+

-

B23a

15

-

+

-

+

-

-

-

-

+

+

+

-

-

-

+

-

B25b

16

-

+

-

+

-

-

+

-

+

-

+

-

+

-

-

+

B31b

17

a: نمونۀ گل‌فشان قارنیاریق؛ b: نمونۀ گل‌فشان نفتلیجه؛c : نمونۀ گل‌فشان‌ اینچهبرون

 

 

شکل 3- رنگ‌آمیزی گرم برخی از نمونه‌های باکتری‌های گل‌فشان‌ها. اشکال باسیلی غالب هستند.

 

 

 

 


باکتری‌های بی‌هوازی اختیاری: نمونه‌های بی‌هوازی اختیاری در محیط‌های حاوی پودر جگر و تیوگلیکولات براث به‌طور جداگانه بررسی شدند. کدورت محیط تیوگلیکولات بیشتر از محیط حاوی پودر جگر بود و این می‌تواند نشان‌دهندۀ تعداد باکتری بیشتری در این محیط باشد. به‌همین‌دلیل نمونه‌های کشت‌شده در محیط تیوگلیکولات براث برای رنگ‌آمیزی گرم و همچنین آنالیز مولکولی انتخاب شدند. رنگ‌آمیزی گرم نمونه‌های بی‌هوازی اختیاری اشکال باسیلی را بیشتر از سایر شکل‌ها نشان داد. به‌علت محدودیت در کشت باکتری‌های بی‌هوازی و همچنین آزمایش‌های بیوشیمیایی در رابطه با این باکتری‌ها پس از طی زمان استاندارد کشت آن‌ها، درخت فیلوژنتیکی برای تشخیص سویه‌های بی‌هوازی اختیاری موردِنظر رسم شد.

مشاهدات میکروسکوپی: برای بررسی شکل‌های باکتریایی پس از رنگ‌آمیزی گرم نمونه‌ها ازطریق میکروسکوپ نوری مشاهده شدند که در شکل3 نشان داده شده است.

شناسایی سویه‌های منتخب: نمونه‌های هوازی: از بین 17 سویه منتخب هوازی فقط 11 نمونه با موفقیت توالی‌یابی شد. جدول 3 میزان شباهت هر سویه با نزدیک‌ترین باکتری شناخته‌شده را نشان می‌دهد.

نمونه‌های بی‌هوازی: پس از انجام آزمایش‌های مولکولی، توالی‌یابی و بلاست نمونه‌های کشت‌شده در محیط‌های بی‌هوازی، 5 سویۀ بی‌هوازی اختیاری شناسایی شد. جدول 4 میزان شباهت هر سویه با نزدیک‌ترین باکتری شناخته‌شده را نشان می‌دهد.

 

جدول3- میزان شباهت سویه‌های منتخب هوازی با نزدیک‌ترین گونۀ ثبت‌شده در پایگاه NCBI

شماره دستیابی نزدیک‌ترین سویه

درصد شباهت

نزدیک‌ترین سویه

نام سویه

ردیف

AM747812.1

99%

BrevibacteriumhalotoleransDSM8802

B1a

1

JX266373.1

99%

Bacillus sp. B2005

B3c

2

JX266343.1

100%

Bacillus sp. A2095

B8a

3

JN208067.1

100%

Bacillus oceanisediminisCCMM B618

B12a

4

AE009440.1

97%

Chlamydophilapneumoniae TW-183

B16a

5

AB695997.1

100%

Uncultured bacterium 0502TCLN265

B19a

6

D16273.1

100%

Bacillus megateriumIAM 13418

B21a

7

JX144721.1

100%

Bacillus simplexJP44SK31

B22a

8

JQ086381.1

100%

Enterobacter cloacaeY219

B23a

9

JX133203.1

98%

Bacillus cereusUI28

B25b

10

JF010371.1

99%

Uncultured bacterium clone ncd97b12c1

B31b

11

 

جدول4- میزان شباهت سویه‌های بی‌هوازی با نزدیک‌ترین گونۀ ثبت‌شده در پایگاه NCBI

درصد شباهت

نزدیک‌ترین سویه

نام سویه

ردیف

99.61%

Bacillus niacini

akh1

1

99.74%

Clostridium bifermentas

akh2

2

94.9%

Clostridium ultunense

akh3

3

95.7%

Proteiniborus ethanoligene

akh4

4

91.14%

Clostridium methylpentosum

akh5

5

 


رسم درخت فیلوژنتیکی: از بین سویه‌های به‌دست‌آمده از نمونه‌های هوازی، به‌صورت انتخابی درخت فیلوژنتیکی برای سویۀ B1a رسم شد که موقعیت این سویه در شکل شماره 4 نشان داده شده است.

از بین سویه‌های بی‌هوازی اختیاری هر 5 سویه توالی یابی شدند و برای آن‌ها درخت فیلوژنتیکی رسم شده است که در شکل شماره 5 رسم شده است.

آنالیز عنصری سه گل‌فشان: برای آگاهی از ماهیت شیمیایی نمونه‌های بررسی‌شده سه گل‌فشان، ترکیبات آن‌ها از نظر کاتیون‌ها وآنیون‌ها آنالیز عنصری انجام شد که نتایج این بررسی در جدول 4 آورده شده است.

 

 

 

شکل 4- درخت فیلوژنتیکی سویۀ B1a

 

 

شکل 5- درخت فیلوژنتیکی مربوط به 5 سویۀ بی‌هوازی اختیاری

 

جدول4- ترکیبات موجود در سه گل‌فشان

نام گل‌فشان

میزان ترکیبات معدنی

سولفات

فسفات

نیترات

برومید

کلرید

نفتلیجه

9/0

بسیار جزیی

06/0

17/0

6/33

قارنیاریق

3/1

بسیار جزیی

08/0

18/0

1/36

اینچه‌برون

2/11

بسیار جزیی

02/0

16/0

6/49

 

 


بحث و نتیجه‌گیری.

گل‌فشان‌ها حفره‌های مخروطی شکل به عمق 1 تا 2 متر هستند که حاوی مخلوطی از آب داغ و رسوبات هستند. به‌دلیل همراه‌داشتن گازهای آتش‌فشانی و آب جوشان به‌صورت فواره به هوا پرتاب می‌شوند(9). از دیدگاه میکروبیولوژی گل‌فشان‌ها به‌دلیل محتویات و شرایط خاص به‌عنوان مناطق سخت در نظر گرفته می‌شوند.

با توجه به اینکه تاکنون گل‌فشان‌ها از دیدگاه میکروبی در ایران بررسی نشده‌اند، این پژوهش می‌تواند نقطۀ آغازی در این زمینه باشد. در پژوهش حاضر مانند مطالعه‌ای که به‌منظور بررسی میکروارگانیسم‌های چشمه‌های اردبیل انجام شده است از روش‌های رایج ریخت‌شناسی، فیزیولوژیکی، بیوشیمیایی و روش فیلوژنتیکی 16S rRNAاستفاده شد(10). مقایسۀ نتایج این بررسی با پژوهش‌های مشابه سایر نقاط جهان تأمل‌برانگیز است و تاکنون در این زمینه پژوهشی در ایران صورت نگرفته است. با توجه به نتایج حاصل‌شده انواع باکتری‌های جداشده  اغلب از گروه پروتئوباکتری‌ها و فیرمیکوت‌ها است. نکتۀ قابل‌توجه در این مطالعه این است که اکثر نمونه‌ها غیرقابلِ‌کشت بودند و تنها با روش‌های مولکولی قابلِ‌تشخیص هستند(11). براساس نتایج مولکولی، حضور کلوستریدیوم‌ها در گل‌فشان‌های جنوب شرقی دریای خزر اثبات شد که با نتایج حاصل از بررسی گل‌فشان‌های اپنیاین در ایتالیا و کوه‌های هیمالیا مشابهت داشت(5، 8، 12 و ۱۳). علاوه بر این، گل‌فشان‌ها از نظر میکروارگانیسم‌های بی‌هوازی مثل متانوتروف‌ها و احیاکنندۀ گوگرد مهم هستند(5، ۸ و ۱۱). در پژوهش حاضر چون امکانات کشت بی‌هوازی‌های اجباری مقدور نبود، میکروارگانیسم‌های هوازی و بی‌هوازی اختیاری شناسایی شدند و سویه‌های جداشده در محیط صفر تا۱۵درصد نمک و دمای ۴تا۴۵ درجه سانتی‌گراد در مدت 48 ساعت رشد کردند. مشابه با نتایج به‌دست‌آمده از گل‌فشان دریاچۀ بایکال اکثر سویه‌ها غیرقابلِ‌کشت بودند(5 و 11). حاصل این پژوهش باکتری‌های متعددی بودند که علاوه بر تشخیص بیوشیمیایی، شناسایی مولکولی آن‌ها هم انجام شد. در ضمن، آنالیز عنصری میزان ترکیبات معدنی به‌دست‌آمده در سه گل‌فشان با استفاده ازروش ICP-OES (پلاسمای جفت‌شدۀ القایی نشرنوری) نشان داد علاوه بر آگاهی از محتویات معدنی محیط می‌توان با توجه به حضور این ترکیبات، محیط کشت میکروبی مناسب میکروارگانیسم‌های گل‌فشان را تهیه کرد. با توجه به فعالیت بالای آنزیمی سویه‌های جداشده از گل‌فشان‌ها یکی از مهم‌ترین نتایج آنالیز عنصری علاوه بر تهیۀ محیط کشت، به‌دست‌آوردن محیطی مناسب برای ایجاد فعالیت آنزیمی این باکتری‌ها است. براین‌اساس می‌توان محیطی ساخت که علاوه بر رشد باکتری فعالیت آنزیمی آن هم به حداکثر مقدار خود برسد و برای اهداف زیست‌فناوری استفاده شود. با وجود استقرار گل‌فشان‌های متعدد در ایران تاکنون هیچ پژوهش میکروبی روی این محیط‌های با شرایط سخت انجام نشده است و این مطالعه می‌تواند نقطۀ آغازی برای پژوهش‌های آتی باشد.



[1]- Northern Apennines

[2]- Biotransformation

[3]- GasPak

[4]- Molecular Biological System Transfer (MBST)


 

(1)              Lösekann T, Knittel K, Nadalig T, Fuchs B, Niemann H, Boetius A, et al.. Diversity and abundance of aerobic and anaerobic methane oxidizers at the Haakon Mosby Mud Volcano, Barents Sea. Applied and Environmental Microbiology. 2007; 73(10): 3348-3362.

(2)              Blumenberg M, Seifert R, Reitner J, Pape T, Michaelis W. Membrane lipid patterns typify distinct anaerobic methanotrophic consortia. Proceedings of the National Academy of Sciences of the United States of America. 2004; 101(30): 11111–11116

(3)              NauhausK, Boetius A, KrugerM& WiddelF. In vitro demonstration of anaerobic oxidation of methane coupled to sulphate reduction in sediment from a marine gas hydrate area. Environmental Microbiol 2002; 4(5): 296–305.

(4)              Alperin MJ, Blair NE, Albert DB, Hoehler TM, and Martens CS. Factors that control the stable carbon isotopic composition of methane produced in an anoxic marine sediment. Global Biogeochemical Cycles 1992; 6(3): 271-291.

(5)              Grünke S, Lichtschlag A, Beer D, Kuypers M, Lösekann-Behrens T, Ramette A, et al..Novel observations of Thiobacterium, a sulfur-storing Gammaproteobacterium producing gelatinous mats. The ISME Journal. 2010; 4: 1031–1043.

(6)              Atlas RM. Handbook of microbiological media. 3rd ed. United States of America: CRC Press LLC; 2004.

(7)              Weisburg WG, Barns SM, Pelletier DA, Lane DJ. "16S ribosomal DNA amplification for phylogenetic study". Journal Bacteriol. 1991; 173(2): 697–703.

(8)              Heller C, Blumenberg M, Kokoschka S, Wrede C, Hoppert M, Taviani M, et al.. Geomicrobiology of fluid venting structures at the Salse di Nirano mud volcano area in the Northern Apennines.LectureNotes Earth Sciences. 2011; 131: 189-200.

(9)              Fasl-e-bahar J. Mud volcano. First ed. Tehran: Arianzamin; 2011.

(10)          Salamian N, Ebrahimipour G, Ghasemi M, Fakhari J. Isolation and characterization of a Facultative chemolithotrophic sulphur and iron oxidizing bacterium from Ardabil acidic springs. Biological Journal of Microorganism 2012; 1(1): 1-10

(11)          Zemskaya TI, Pogodaeva TV, Shubenkova OV, Сhernitsina SM, Dagurova OP, Buryukhaev SP, et al.. Geochemical and microbiological characteristics of sedimentsnear the Malenky mud volcano (Lake Baikal, Russia),with evidence of Archaea intermediate between the marineanaerobic methanotrophs ANME-2 and ANME-3.Geo-Mar Lett. 2010; 30: 411–425.

(12)          Ona-Nguema G,Morin G, Wang YH,Menguy N,Juillot F, Olivi L, et al.. Arsenite sequestration at the surface of nano-Fe(OH)(2), ferrous-carbonate hydroxide, and green-rust after bioreduction of arsenic-sorbed lepidocrocite by Shewanellaputrefaciens. Geochimica et Cosmochimica Acta. 2009; 73: 1359-1381.

(13)          Stolz JF, Perera E, Kilonzo B, Crable B, Fisher E, Ranganathan M, et al.. Biotransformation of 3-nitro-4-hydroxybenzene arsonic acid (Roxarsone) and release of inorganic arsenic by Clostridiumspecies. Environmental Science & Technology. 2007; 41(3): 818-823.