زیست‌پالایی سلنیت توسط لاکتوکوکوس رافینولاکتیس seD2b مقاوم به سلنیت در مقیاس آزمایشگاهی

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 استادیار میکروبیولوژی، دانشگاه کردستان، سنندج، ایران

2 دانشجوی کارشناسی ارشد زیست شناسی سلولی- مولکولی، دانشگاه کردستان، سنندج، ایران

چکیده

مقدمه: اکسی‌آنیون‌های سلنیوم محلول به‌ویژه سلنیت در منابع آب و خاک وضعیت نگران‌کننده‌ای برای سلامت افراد و محیط زیست ایجاد کرده است. در این بررسی غربالگری باکتری‌های مولد اسیدلاکتیک مقاوم به سلنیت و توانایی آن‌ها به‌عنوان زیست کاتالیزگر ایمن در زیست‌پالایی سلنیت ارزیابی شد.
مواد و روش‌ها: تعیین حداقل غلظت ممانعت‌کنندگی از رشد (MIC) و حداقل غلظت کشندگی (MBC) جدایه‌های باکتری نسبت به سلنیت با روش رقت در آگار تعیین شد. ارزیابی اثر مهارکنندگی سلنیت بر جدایه‌های باکتری با روش انتشار در چاهک انجام شد. از روش کدورت‌سنجی برای بررسی سنتتیک رشد استفاده شد. جدایۀ باکتری کارآمد براساس تست‌های بیوشیمیایی و فیلوژنتیکی شناسایی شد. برای سنجش حذف سلنیت از رنگ‌سنجی و معرف 3 و 3- دی آمینو بنزیدین استفاده شد.
نتایج: نتایج نشان داد لاکتوکوکوس رافینولاکتیس جدایۀ seD2b بالاترین مقادیر MIC (110 میلی‌مولار) و MBC (140 میلی‌مولار) و کمترین میزان مهارکنندگی با میانگین مهاری 6/26 میلی‌متر را در محیط‌های کشت حاوی سلنیت به خود اختصاص داد.بعد از 72 ساعت واکنش زیست‌تبدیلی تحت شرایط سلول‌های در حال استراحت باکتری جداسازی شد و راندمان حذف سلنیت از محیط‌های واکنش 2/90درصد تخمین زده شد. ‌
بحث و نتیجه‌گیری: با توجه به توانمندی باکتری لاکتوکوکوس رافینولاکتیس در حذف و احیای سلنیت، غربالگری باکتری‌های مولد اسید لاکتیک به‌عنوان زیست کاتالیزگر طبیعی ایمن در جهت زیست‌پالایی سلنیت و همچنین دارای اهمیت اقتصادی در جهت سنتز سلنیوم عنصری پیشنهاد می‌شود. 

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Bioremediation of selenite by selenite-resistant Lactococcus raffinolactis seD2b under laboratory scale

نویسندگان [English]

  • Morahem Ashengroph 1
  • Davoud Saedi 2
1 Assistant Professor of Microbiology, University of Kurdistan, Sanandaj, Iran
2 M.Sc. Student of Molecular Cell Biology, University of Kurdistan,
چکیده [English]

Introduction:The accumulation of selenium oxyanions in the form of selenite (SeO3-2) in soil and water resources created increasingly worrying on human health and environment. The current project directed toward screening of selenite-resistant lactic acid bacteria for their potential use as safe biocatalysts in the selenite bio-remediation.
Materials and methods: Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) values of selenite against isolated strains were evaluated using agar dilution method. Inhibitory effects of selenite against isolated strains were calculated employing well diffusion agar method. Turbidity testing was used to investigate bacterial growth. Identification of the potent bacterium strain was carried out based on bio-chemical tests and phylogenetic analysis. A colorimetric method using 3, 3-Diaminobenzidine hydrochloride has been developed for the microbial selenite removal.
Results: Results indicated that Lactococcus raffinolactis strain seD2b exhibited the highest MIC (110 mM) and MBC (140 mM) values and also the lowest inhibitory effect with the average diameter of the inhibition zone (26.6 mm) in the presence of selenite. After 72 h incubation of the reaction medium containing 10mM of initial selenite concentration with resting cells of Lactococcus raffinolactis seD2b, the concentration of toxic selenite in the reaction medium decreased by 90.2% .
Discussion and conclusion: Given the ability of Lactococcus raffinolactis strainseD2b in the remove and reduce selenite, screening of lactic acid bacteria as green bio-catalysts for their application in the bio-remediation of selenite and their economic importance on synthesis of selenium has been proposed.

کلیدواژه‌ها [English]

  • Selenite
  • Bio-remediation
  • Screening
  • Lactococcus raffinolactis
  • Cell growth

مقدمه.

دفع بی‌رویۀ فلزات و اکسی‌آنیون‌های سمی در خاک و آب، به‌دلیل انقلاب صنعتی، وضعیتی نگران‌کننده برای زندگی بشر، گیاهان و جانوران ایجاد کرده است؛ به همین دلیل لازم است برای حفاظت از منابع آبی و خاک و تجدید آن‌ها اقدامات خاصی صورت بگیرد (1). عنصر سلنیوم از کلمۀ یونانی seleno به معنای ماه گرفته شده که از نظر فراوانی در میان عناصر طبیعی پوستۀ زمین در ردۀ شصت و ششمین عنصر قرار دارد (2 و 3). سلنیوم به‌عنوان ترکیب اصلی ساختاری سلنوپروتئین‌ها، یک مادۀ مغذی ضروری برای رشد انسان و حیوانات به‌خصوص جوجه‌های گوشتی، ماهی‌ها و پرندگان محسوب می‌شود. توصیه شده است که متوسط مصرف روزانۀ سلنیوم 60 میکروگرم برای مردان و 53 میکروگرم برای زنان باشد. دوز مجاز رژیمی توصیه‌شده 55 میکروگرم بر لیتر (طبق سازمان غذایی و تغذیه‌ای انجمن پزشکی آمریکا) است. مصرف سلنیوم در غلظت‌های مجاز می‌تواند به بهبود ظرفیت آنتی‌اکسیدانی، تقویت سیستم ایمنی، تقویت عملکرد مغز، حفاظت در برابر بیماری‌های قلبی- عروقی و نکروز کبدی، افزایش قدرت باروری، بهبود عملکرد سیستم گوارشی، بهبود متابولیسم، مسدودکردن رگ‌زایی تومورها و سم‌زدایی آفت‌کش‌های شیمایی کمک کند (4 و 5). باوجود این، مواجهه با غلظت‌های بالای ترکیبات سلنیومی می‌تواند به بروز انواع مسمومیت‌های حاد و مزمن منجر شود. براساس گزارش‌ها غلظت سلنیوم سرم در محدودۀ بین ۱۴۰۰تا۳۰۰۰۰ میکروگرم در لیتر می‌تواند مسمومیت حاد ایجاد کند که ممکن است با خوردن اتفاقی ترکیبات غیرآلی سلنیوم مثل سلنواسید و سدیم سلنیت ایجاد شود و محدودۀ 500تا۱۴۰0 میکروگرم در لیتر مسمومیت مزمن ایجاد می‌کند و کمتر از 500 میکروگرم در لیتر مسمومیت ندارد (6). سلنیوم در طبیعت به دو فرم آلی (سلنو پروتئین‌ها) و معدنی وجود دارد. سلنیوم معدنی به فرم‌های سلنیت (SeO3-2)، سلنات (Seo4-2)، سلنید (Se-2) و فرم فلزی (Se0) یافت می‌شود. در این بین، فرم محلول سلنیت با توجه به حلالیت بالا و تمایل به تجمع زیستی، سمی‌ترین فرم اکسی‌آنیون‌سلنیوم محسوب می‌شود و تقلیل یا حذف آن به فرم‌های کمتر سمی به‌ویژه سلنیوم عنصری که غیرمحلول است و در دسترس سیستم‌های زیستی قرار نمی‌گیرد، از اهمیت زیست‌محیطی بالایی برخوردار است (7). با توجه به اینکه سلنیت می‌تواند با تنفس سلولی، آنتی‌اکسیدان‌های دفاعی در آسیب سلولی، غیرفعال‌کردن پروتئین از طریق جایگزینی گوگرد و جلوگیری از تعمیر DNA تداخل داشته باشد (8 و9)؛ بنابراین، مواجهۀ درازمدت با غلظت‌های بالای سلنیت می‌تواند به بروز ناراحتی‌های پوستی، تغییرشکل ناخن‌ها، ریزش مو، نکروز سلول‌های کبدی، اختلالات تنفسی و درنهایت نکروز سلولی منجر شود(10). منشأ ورود فرم‌های سمی سلنیوم (سلنیت و سلنات) به محیط زیست می‌تواند ناشی از منابع طبیعی شامل هوازدگی سنگ‌های رسوبی و آذرین سلنو فروسی و نیز فعالیت میکروارگانیسم‌های خاک در چرخه‌های ژئو-شیمیایی سلنیوم و یا درنتیجه کاربرد گستردۀ سلنیوم و ترکیبات آن در صنایع مرتبط از جمله صنایع شیشه‌سازی، چاپ و عکاسی، نیمه هادی، تولید رنگدانه، ذوب فلزات و تولید آفت‌کش‌های کشاورزی باشد که در این میان، سهم صنایع بر سلامت و تندرستی انسان و حیوان بیشتر است؛ با توجه به تولید پسماندها و زباله‌های حاوی غلظت‌های بسیار بالای سلنیت سمی و خطر آلودگی منابع آبی و خاک (11 و 12). گزارش‌های بسیاری از میزان وجود سلنیوم در پساب‌های مرتبط با فعالیت‌های صنعتی و کشاورزی وجود دارد که از آن جمله می‌توان به پساب حاصل از کشاورزی به‌میزان ۱۴۰تا۱۴۰۰ میکروگرم بر لیتر، پساب و ضایعات حاصل از معادن اورانیوم معادل 1600 میکروگرم بر لیتر، پساب حاصل از معدن‌کاری معادن طلا به میزان 2/0 تا 33 میلی‌گرم بر لیتر و پساب حاصل از صنایع پتروشیمی به‌میزان 5/7 تا 9/55 میکروگرم بر لیتر  اشاره کرد (13). با وجود تکنیک‌های متفاوت از جمله رسوب شیمیایی، اکسیداسیون و یا احیاء، فیلترینگ، تبادل یونی، اسمز معکوس، تکنولوژی غشایی، تبخیر و تیمار الکتروشیمیایی برای حذف فرم‌های سمی سلنیوم، بسیاری از این تکنیک ها از نظر مصرف مواد شیمیایی سمی، حجم بالای پسماند، مصرف انرژی بالا، آلودگی زیست‌محیطی و ناکارآمدی در کاهش یا حذف سلنیت در غلظت‌های پایین غیراقتصادی هستند. در محیط‌های طبیعی، سلول‌های زنده مانند باکتری‌ها، قارچ‌ها، مخمرها و گیاهان شناخته‌شده هستند که قادر به حذف و احیای سلنیت به فرم کمتر سمی سلنیوم هستند. در این میان، باکتری‌ها به‌دلیل زمان تقسیم کوتاه، سهولت کشت، سهولت پردازش فرایندهای پایین‌دستی و دستکاری برتری دارند (14). در سال‌های اخیر حذف باکتریایی سلنیت به اشکال با حلالیت و سمیت کمتر عمدتاً به فرم عنصری سلنیوم، در سویه‌های باکتری متعلق به جنس‌های Bacillus، Pseudomonas، Rhizobium، Clostridium، Methylococcus، Stenotrophomonas، Halomonas، Tetrathiobacter، Comamonas، Aeromonas، ThaueraوAgrobacterium گزارش شده است که پیشنهاد می‌کند این قابلیت به‌عنوان یک استراتژی اصلاحی جهت کاهش یا حذف اکسی‌آنیون‌های سمی سلنیوم از آب‌های سطحی و پساب‌های صنعتی به کار گرفته شود (15 و 16). باکتری‌های مولد اسیدلاکتیک با توجه به پوشش‌دادن استانداردهای [1]GRAS به‌عنوان استارتر در صنعت مواد غذایی و نوشیدنی شناخته می‌شوند (17). این ارگانیسم دارای نقش اساسی در غذاهای تخمیری از جمله خواص ضدمیکروبی، فعالیت ضدتومور، کاهش کلسترول سرم، کاهش عدم تحمل لاکتوز، تحریک سیستم ایمنی بدن و تثبیت فلور روده هستند (18). علاوه بر نقش‌های پروبیوتیکی باکتری‌های اسیدلاکتیک، گزارش‌هایی از پتانسیل باکتری‌های ذکرشده در حذف میکروبی فلزهای سنگین و اکسی‌آنیون‌های سمی سلنیوم از آب‌های آشامیدنی و مواد غذایی در سطح دنیا ارائه شده است (18 - 20). در این پژوهش، جمع‌آوری فرآورده‌های لبنی سنتی به‌عنوان بستری مناسب جهت غربالگری باکتری‌های اسیدلاکتیک بومی مقاوم به سلینت و بررسی امکان به‌کارگیری آن‌ها به‌عنوان زیست‌کاتالیزگر مؤثر و ایمن، برای زیست‌پالایی اکسی‌آنیون سمی سلنیت از محیط‌های آلوده در شرایط آزمایشگاه ارزیابی شد.   

 

مواد و روش‌ها.

56 نمونه ماست که به‌صورت خانگی تهیه شده بودند، از روستاهای حومۀ شهرستان کامیاران، پاوه، اسلام آباد غرب، دیواندره، مریوان، بیجار و سنندج، با رعایت شرایط استریل جمع‌آوری شد و  نمونه‌ها تا زمان کشت در محیط‌های مناسب در دمای 4 درجه سانتی‌گراد در یخچال نگهداری شدند. در ادامه، به‌منظور غنی‌سازی باکتری‌های مولد اسیدلاکتیک با پتانسیل تحمل‌پذیری همراه با احیای اکسی‌آنیون سمی سلنیت به سلنیوم، 10 گرم از هر نمونه لبنی در 90 میلی‌لیتر محلول ایزوتونیک رینگر (نمک کلریدسدیم با غلظت 25/2 گرم در لیتر، نمک کلرید پتاسیم با غلظت 105/0 گرم در لیتر، نمک کلریدکلسیم با غلظت 12/0 گرم در لیتر و نمک بیکربنات‌سدیم با غلظت 05/0 گرم در لیتر) تهیه شد. پس از تهیۀ سری رقت (2-10 تا 5-10)، یک میلی‌لیتر از رقت‌های تهیه‌شده به محیط کشت M17 آگار حاوی 10 میلی‌مولار محلول سلنیت‌سدیم کشت داده شد (محلول‌های استوک در آب مقطر تهیه و توسط فیلترهای سرسرنگی 45/0 میکرونی استریل شد). پلیت‌ها در انکوباتور با دمای 30 درجه سانتی‌گراد به‌مدت 48 ساعت گرمخانه شدند. پس از تهیۀ تک‌کلنی‌های خالص، جدایه‌های باکتری در محلول 15درصد گلیسرول و 6/0درصد پپتون در فریزر 20- درجه سانتی‌گراد جهت استفاده‌های بعدی نگهداری شد.

.تعیین حداقل غلظت ممانعت‌کنندگی از رشد[2]  و .حداقل غلظت کشندگی[3] جدایه‌های باکتری نسبت به سلنیت: مقادیر MIC و MBC برای جدایه‌های مقاوم به سلنیت با استفاده از روش استاندارد رقت در آگار[4]  انجام شد (21). برای این منظور، از جدایه‌های باکتری کشت‌داده‌شده به‌مدت 24 ساعت در محیط کشت M17 براث، سوسپانسیونی با کدورت معادل استاندارد نیم مک فارلند ( CFU/ml108 × 5/1) تهیه شد و سپس 10 میکرولیتر از سوسپانسیون موردِنظر روی محیط‌های کشت M17 آگار حاوی غلظت‌های مختلف یون سلنیت (10 تا 150 میلی‌مولار) تلقیح شد. پلیت‌های آگاردار پس از گرمخانه‌گذاری در 30 درجه سانتی‌گراد در ساعت‌های 24، 48، 72، 96 و 120 ساعت بررسی شد.

.ارزیابی اثر مهارکنندگی سلنیت بر جدایه‌های باکتری با روش انتشار در چاهک[5]:  در این روش از سوسپانسیون باکتری تهیه‌شده ( CFU/ml108× 5/1) بر روی محیط کشت M17 آگار به‌وسیلۀ سواپ استریل کشت چمنی داده شد. پس از تعبیۀ چاهک‌های استریل (به قطر پنج میلی‌متر) به کمک پی پت پاستور، 25 میکرولیتر از غلظت 50 میلی‌مولار سلنیت استریل، پس از استریل‌کردن به‌وسیلۀ فیلترهای سرسرنگی 22/0 میکرونی، در چاهک‌ها ریخته شد. محیط‌های کشت به‌مدت 48 ساعت در دمای 30 درجه سانتی‌گراد گرمخانه‌گذاری شد. سپس قطر هالۀ عدم رشد ایجادشده توسط یون سمی سلنیت علیه جدایه‌های باکتری، توسط خطکش اندازه‌گیری شد. به‌منظور کاهش خطا، هر آزمون سه بار تکرار شد.

.ترسیم منحنی رشد جدایه‌های باکتری مقاوم به سلنیت: به‌منظور تعیین منحنی رشد باکتری‌های مولد اسیدلاکتیک در مجاورت با یون سمی سلنیت، از روش کدورت‌سنجی در طول موج 600 نانومتر استفاده شد. برای این منظور، به ارلن‌های 250 میلی‌لیتر حاوی 50 میلی‌لیتر محیط کشت M17 براث یون سلنیت در غلظت نهایی 25 میلی‌مولار اضافه شد. سپس غلظتی معادل استاندارد نیم مک فارلند از رشد باکتری‌ها تهیه شد و یک درصد از سوسپانسیون تهیه‌شده به محیط‌های مربوطه جهت بررسی سنتتیک رشد اضافه شد. محیط‌های تلقیح‌شده در دمای 30 درجه سانتی‌گراد با دور شیکر rpm 180 در شرایط تاریکی گرمخانه‌گذاری شد. میزان دانسیته سلولی در غلظت ذکرشده به‌مدت 48 ساعت با فواصل زمانی 4 ساعت و با استفاده از دستگاه اسپکتروفتومتر قرائت شد. هر آزمایش سه بار تکرار شد و پراکندگی مربوط به داده‌ها با روش‌های آماری بررسی شد. در ادامه به‌منظور تعیین زمان دوبرابرشدن جمعیت سلول باکتری[6] در منطقۀ خطی منحنی رشد (فاز لگاریتمی رشد)، شیب منحنی محاسبه شد. سپس از روی شیب معادله خط و با استفاده از فرمول زیر، زمان دوبرابرشدن سلول باکتری در حضور یون سمی سلنیت محاسبه شد (22).

 

 

.تعیین هویت جدایۀ باکتری کارآمد seD2b: شناسایی مورفولوژیک و بیوشیمیایی جدایۀ خالص seD2b براساس صفات شکلی، رنگ‌آمیزی گرم، تست کاتالاز، تولید CO2 از سیترات، تولید NH3 از آرژنین، رشد در دماهای مختلف، رشد در درصدهای مختلف نمک سدیم‌کلراید و همچنین تخمیر قندهای مختلف از جمله گلوکز، سوکروز، مالتوز، آرابینوز، ریبوز و تری هالوز انجام گرفت (23 و 24). شناسایی ملکولی جدایۀ seD2b براساس توالی نوکلئوتیدی  ژن  16SrDNA انجام گرفت. برای استخراج DNA  ژنومی از کیت استخراج DNA مخصوص باکتری‌های گرم‌مثبت، طبق دستورالعمل شرکت سازنده (سیناژن) استفاده شد. کمیت و کیفیت DNA ی استخراجی از طریق روش‌های اسپکتروفتومتر (r=260/280) و همچنین الکتروفورز از طریق بارگذاری دو میکرولیتر از DNA  استخراجی در ژل آگارز یک درصد بررسی شد. جهت تکثیر قطعه 1500 جفت‌بازی ناحیه 16SrDNA از پرایمر بالادست fd1 (AGAGTTTGATCCTGGCTCAG) و پایین‌دست rp2 (ACGGCTACCTTGTTACGACTT) استفاده شد (25). مخلوط واکنش PCR (25 میکرولیتر) شامل 5/12میکرولیتر Master mix (حاوی بافر PCR، MgCl2، dNTPs و آنزیم Taq-polymerase)، یک میکرولیتر پرایمرهای بالادست و پایین‌دست (غلظت تقریبی 10 میکرومولار)، یک میکرولیتر DNA الگو (غلظت تقریبی 100 نانوگرم بر میکرولیتر) و 5/9 میکرولیتر آب مقطر استریل و دیونیزه استفاده شد.

برنامۀ تکثیری با واسرشت اولیه[7] در دمای 95 درجه سانتی‌گراد به‌مدت 1 دقیقه، سپس 30 چرخه به‌صورت واسرشت‌شدن در دمای 95 درجه سانتی‌گراد به‌مدت 1 دقیقه، اتصال پرایمر به DNA ژنومی[8] در دمای 50 درجه سانتی‌گراد به‌مدت 1 دقیقه و بسط [9]DNA  در دمای 72 درجه سانتی‌گراد به‌مدت 2 دقیقه انجام شد. بسط نهایی[10] در دمای 72 درجه سانتی‌گراد به‌مدت 10 دقیقه انجام گرفت. الکتروفورز محصولات PCR روی ژل آگارز یک درصد، در شرایط بافری TAE و با ولتاژ 70 به‌مدت یک ساعت انجام شد. پس از اطمینان از صحت انجام PCR، محصول تخلیص‌شده برای توالی‌یابی به شرکت ماکروژن کره جنوبی (توسط شرکت تکاپو زیست) ارسال شد. توالی‌های به‌دست‌آمده در پایگاه ژنی NCBI مقایسه شد. سپس با استفاده از برنامۀ Clustal W هم‌ردیفی چندتایی انجام شد. درنهایت درخت فیلوژنتیکی به کمک نرم‌افزار MEGA.6 رسم شد (26).

.سنجش میزان حذف سلنیت تحت شرایط .سلول‌های در حال استراحت جدایۀ باکتری seD2b: برای سنجش حذف سلنیت از روش رنگ‌سنجی و معرف 3 و 3- دی آمینو بنزیدین استفاده شد. یون سلنیت موجود در سوپرناتانت (مایع رویی) کشت باکتری با معرف 3 و3- دی آمینو بنزیدین 5/0درصد (وزنی/حجمی) در محلول اسیدی (HCl پنج مولار) واکنش داده و زرد رنگ می‌شود که پس از استخراج در حلال تولوئن جذب محلول در طول موج 420 نانومتر قابل ‌اندازه‌گیری است (27). پس از رسم منحنی کالیبراسیون، درصد حذف سلنیت تحت شرایط سلول‌های در حال استراحت سویۀ باکتری seD2b، طبق فرمول زیر به دست آمد که در آن، C0: غلظت اولیه سلنیت و C: غلظت سلنیت باقیمانده است.

 

 

 

برای تهیۀ سلول‌های در حال استراحت، ابتدا سویۀ باکتری seD2b در محیط M17 براث تا رسیدن به انتهای فاز رشد لگاریتمی رشد داده شد. سپس سلول‌های باکتری با استفاده از سانتریفیوژ برداشت و پس از شستشو تودۀ سلولی در بافر فسفات (بافر فسفات پتاسیم 100 میلی‌مولار با pH برابر 2/7)، از این سلول‌های برداشت‌شده به‌عنوان زیست کاتالیزگر برای مطالعات حذف زیستی سلنیت استفاده شد (28). آزمایش‌ها در ارلن‌های 250میلی‌لیتری حاوی 50 میلی‌لیتر بافر فسفات، 20 گرم در لیتر تودۀ سلولی (وزن تر تودۀ سلولی) و تحت شرایط دمایی 30 درجه سانتی‌گراد و دور شیکر rpm 180 انجام شد. به محیط زیست تبدیلی ذکرشده، سلنیت در غلظت‌های 5، 10، 15 و 20 میلی‌مولار افزوده شد. در فواصل زمانی مختلف، از طریق سانتریفیوژ با دور rpm 4500 به‌مدت 10 دقیقه، توده باکتری جمع‌آوری شد. سپس به مایع رویی جداشده، پس از اسیدی‌شدن توسط اسیدکلریدریک، محلول 3 و 3- دی آمینو بنزیدین در غلظت نهایی 5/0درصد (وزنی/حجمی) اضافه شد. محلول حاصل را به قیف جداکنندۀ حاوی 10 میلی‌لیتر تولوئن منتقل و میزان جذب سلنیت باقیمانده در محیط در طول موج 420 نانومتر قرائت شد. همۀ آزمایش‌ها سه بار تکرار شد.

نتایج.

.جداسازی و غربالگری باکتری‌های مولد اسیدلاکتیک مقاوم به سلنیت: از بین 24 باکتری مقاوم جداسازی‌شده، تنها چهار جدایه بالاترین مقاومت همراه با احیای یون سلنیت به سلنیوم عنصری (بالاتر از 50 میلی‌مولار)، که با ایجاد رنگ قرمز در محیط کشت حاوی سلنیت سدیم قابلِ‌مشاهده است، نشان دادند. در شکل 1 الگوی مقاومت براساس MIC (پایین‌ترین غلظتی از اکسی‌آنیون که از رشد باکتری در محیط کشت حاوی سلنیت جلوگیری می‌کند) و MBC (کمترین تراکم اکسی‌آنیون که به‌طور کامل باعث مرگ باکتری شده و هیچ رشدی مشاهده نمی‌شود) نشان داده شده است.

 

 

شکل 1- نتایج MIC و MBC رقت‌های مختلف سلنیت (بر حسب میلی‌مولار) در باکتری‌های مولد اسیدلاکتیک جداشده از محصولات لبنی سنتی

 

 

 

 

طبق شکل 1، جدایۀ seD2b (جداشده از یک نمونه ماست سنتی جمع‌آوری‌شده از روستاهای توابع شهرستان کامیاران) بالاترین مقادیر MIC (110 میلی‌مولار) و MBC (140 میلی‌مولار) را به خود اختصاص داد. در سایر باکتری‌های جداشده مقادیر MIC در محدودۀ 55 تا 90 میلی‌مولار و MBC در محدودۀ 60 تا 120 میلی‌مولار مشاهده شد. در ادامه جهت تأیید نتایج به‌دست‌آمده از روش رقت‌سازی در آگار، روش انتشار در چاهک استفاده شد (شکل 2).

 

 

 

 

شکل 2- نتایج اثر مهارکنندگی یون سلنیت علیه جدایه‌های باکتری جداشده با استفاده از روش چاهک (غلظت سلنیت استفاده‌شده 50 میلی‌مولار است)

 

طی این روش، بیشترین اثر مهاری را اکسی‌آنیون سمی سلنیت بر علیه جدایۀ seD5 با میانگین قطر مهاری 2/42 میلی‌متر از خود نشان داد. کمترین میزان مهارکنندگی متعلق به جدایۀ seD2b با میانگین مهاری 6/26 میلی‌متر بود. نتایج به‌دست‌آمده در این روش هم‌خوانی مناسبی با نتایج حاصل از روش رقت در آگار دارد.

.سنتتیک رشد سلولی جدایه‌های باکتری مقاوم به .اکسی‌آنیون سمی سلنیت: با هدف تعیین جدایۀ باکتری کارآمد جهت آزمایش‌های حذف زیستی سلنیت، چهار جدایۀ seD2b، seD2a، seD9 و seD5 در حضور 25 میلی‌مولار سلنیت رشد داده شدند (شکل 3). براساس نتایج به‌دست‌آمده، جدایۀ seD2b بالاترین دانسیته نوری در طول موج 600 نانومتر با ارزش 9/3 را بعد از 24 ساعت از شروع کشت نشان داد. جدایۀ seD9 کمترین دانسیته نوری معادل 9/2 را بعد از 36 ساعت از شروع گرمخانه‌گذاری داشت. سویۀ اخیر تا 16 ساعت از شروع گرمخانه‌گذاری در فاز تأخیری قرار داشت و تقریباً رشد قابلِ‌توجهی در این فاصلۀ زمانی صورت نگرفته است.

در ادامه به‌منظور تعیین زمان تقسیم جدایه‌های مقاوم در مجاورت یون سمی سلنیت در منطقه خطی منحنی‌های رشد (فاز لگاریتمی رشد)، شیب منحنی‌ها محاسبه شد. سپس از روی شیب به‌دست‌آمده، زمان تقسیم جدایه‌های ذکرشده تخمین زده شد (جدول 1).

 

جدول 1- نتایج مربوط به معادلات رگرسیونی خطی و زمان تقسیم به‌دست‌آمده از ترسیم منحنی‌های رشد جدایه‌های مقاوم در مجاورت 25 میلی‌مولار یون سلنیت

زمان تقسیم (دقیقه)

معادله خط منحنی رشد و ضریب رگرسیون

جدایۀ باکتری

55

Y=0.7508x-0.5067

R2= 0.9907

seD2b

67

Y=0.6146x-0.3702

R2=0.9909

seD2a

89

Y=0.4659x-0.2374

R2=0.9938

seD5

82

Y=0.5028x-0.1324

R2=0.9905

seD9

 

 

 

 

شکل 3- منحنی رشد جدایه‌های مقاوم در محیط‌های M17 براث حاوی 25 میلی‌مولار یون سلنیت و تحت شرایط دمایی 30 درجه سانتی‌گراد و دور شیکر rpm 180. آزمایش‌ها سه بار تکرار شد.

 

براساس نتایج به‌دست‌آمده کمترین زمان دوبرابرشدن معادل 55 دقیقه مربوط به جدایۀ seD2b و بیشترین زمان معادل 82 دقیقه مربوط به seD9 گزارش شد. درنهایت جدایۀ باکتری seD2b به‌عنوان سویۀ کارآمد جهت آزمایش‌های سلنیت‌زدایی شناسایی شد.

.نتایج آزمون‌های تشخیصی بیوشیمیایی و ملکولی: شناسایی اولیۀ جدایۀ مقاوم seD2b، با قابلیت احیای یون سلنیت به سلنیوم عنصری که با ایجاد کلنی قرمزرنگ در محیط کشت قابلِ‌شناسایی است (شکل 4)، براساس آزمون‌های فیزیولوژیک و تست‌های بیوشیمیایی انجام گرفت.

جدایۀ ذکرشده از نظر شکل ظاهری و واکنش گرم، کوکسی گرم‌مثبت بود. از نظر تست‌های فیزیولوژیک و بیوشیمیایی کلیدی از جمله تست کاتالاز، هیدرولیز آرژنین، تولید دی‌اکسیدکربن از سیترات و همچنین رشد در دمای 40 درجه سانتی‌گراد و نمک سدیم‌کلراید با غلظت 5/6درصد (وزنی/حجمی) منفی بود. نتایج تست‌های تخمیر کربوهیدرات سویۀ seD2b بیانگر توانایی سویۀ ذکرشده در مصرف گلوکز، مالتوز، آرابینوز، سوکروز، ریبوز، تری هالوز و گلیسرول بود.  براساس نتایج به‌دست‌آمده از آزمون‌های فنوتیپی و بیوشیمیایی و طبق کتاب‌های مرجع، سویۀ باکتری seD2b به‌طور موقت تحت نام لاکتوکوکوس رافینولاکتیس تعیین هویت شد. در ادامه جهت شناسایی دقیق سویۀ باکتری seD2b تکثیر کامل توالی نوکلئوتیدی ژن 16SrDNA صورت گرفت. نتایج الکتروفورز محصول PCR حاصل از تکثیر با استفاده از پرایمرهای اختصاصی fd1 و rp2 در شکل 5 نشان داده شده است.

 

 

شکل 5- تصویر ژل الکتروفورز محصول PCR سویۀ باکتری seD2b. (I): DNA نشانگر، (II) و (III): سویۀ باکتری seD2b و (IV): کنترل منفی.

 

 

 

شکل 4- بررسی رنگ کلنی جدایۀ seD2b در محیط کشت M17 آگاربدون اکسی‌آنیون  سلنیت و محیط کشت M17 آگار حاوی سلنیت.

 

پس از مشخص‌شدن توالی ژن 16SrDNA سویۀ باکتری ذکرشده، ارتباط فیلوژنتیکی سویۀ seD2b با سویه‌های باکتری موجود در پایگاه اطلاعات ژنی NCBI بررسی شد. براساس اطلاعات به‌دست‌آمده نزدیک‌ترین گونۀ باکتری به سویۀ ذکرشده با شباهت 99درصدی لاکتوکوکوس رافینولاکتیس بود. بنابراین، توالی ژن 16SrDNA باکتری لاکتوکوکوس رافینولاکتیس seD2b در بانک اطلاعات ژنی NCBI با شماره KR150681 ثبت شد. در ادامه نتایج ترسیم درخت فیلوژنتیکی تأیید کرد که سویۀ seD2b را می‌توان از نظر تاکسونومی به‌عنوان سویه‌ای از لاکتوکوکوس رافینولاکتیس طبقه‌بندی کرد (شکل 6).

.بررسی پتانسیل حذف میکروبی سلنیت توسط .سلول‌های در حال استراحت Lactococcus raffinolactis seD2b: برای سنجش کمی روند حذف میکروبی سلنیت، سلول‌های در حال استراحت سویۀ باکتری لاکتوکوکوس رافینولاکتیس seD2b به‌عنوان زیست کاتالیزگر در محیط بافری فسفات حاوی غلظت‌های مختلف سلنیت به کار گرفته شد (شکل 7).

 

 


 

شل 6- درخت فیلوژنیک براساس توالی نوکلئوتیدی ژن  16SrRNA سویۀ باکتری seD2b و توالی‌های به‌دست آمده از بانک ژنی (درخت ذکرشده براساس الگوریتم neighbor-joining و به‌کمک نرم‌افزار MEGA. 6 با شرایط cut off=50 و Bootstrap=1000 ترسیم شد. برای ریشه‌دارکردن درخت از Enterococcus faecium به‌عنوان Outgroup استفاده شد.اعداد داخل پرانتز نشان‌دهندۀ شماره دسترسی سویه‌های باکتری ثبت‌شده در پایگاه بانک اطلاعات ژنی است).

 

 

 

شکل 7- نمودار حذف میکروبی سلنیت توسط باکتری لاکتوکوکوس رافینولاکتیس سویۀ seD2b تحت شرایط سلول های در حال استراحت. نتایج ارائه‌شده میانگین سه بار آزمایش است.

 

همان‌گونه که در شکل 7 مشاهده می‌شود افزایش غلظت یون سلنیت از 5 میلی‌مولار به 10 میلی‌مولار موجب افزایش راندمان حذف زیستی سلنیت شد. افزایش غلظت از 10 میلی‌مولار به بالا کاهش درصد حذف سلنیت را به دنبال داشت. بنابراین می‌توان نتیجه گرفت که میزان حذف به غلظت اولیۀ یون سلنیت در محیط زیست تبدیلی ارتباط دارد. پس از 72 ساعت گرمخانه‌گذاری، سلول‌های در حالت استراحت سویۀ باکتری ذکرشده توانست به‌میزان 2/90درصد از سلنیت موجود در محیط زیست تبدیلی را حذف کند و غلظت آن را از 10 میلی‌مولار به کمتر از یک میلی‌مولار برساند.

 

بحث و نتیجه‌گیری.

زیست‌پالایی میکروبی یا به عبارت دیگر استفاده از قابلیت‌های فیزیولوژیک و ژنتیکی میکروارگانیسم‌ها در کنترل و جذب آلاینده‌های زیست‌محیطی یک فناوری سبز نوآورانه و امیدبخش در دسترس، جهت پالایش میکروبی فلزات سنگین از آب و زمین‌های آلوده است. میکروارگانیسم‌ها نقش قابلِ‌توجهی در زیست‌پالایی محیط‌های آلوده به اکسی‌آنیون‌های معدنی سلنیوم دارند. بسیاری از میکروارگانیسم‌ها از جمله باکتری‌ها، قارچ‌های رشته‌ای و مخمرهای تک‌سلولی دارای مکانیسم‌های مختلف مقاومت شامل احیا، آلکیله‌کردن، کمپلکس‌کردن، فراریت، تجمع و ته‌نشینی در برابر اکسی‌آنیون سمی سلنیت هستند (29). در این بین، باکتری‌هایی که توانایی تبدیل و اصلاح زیستی ترکیبات سلنیومی را دارند، نقش ویژه‌ای در چرخۀ ژئو- شیمیایی این شبه فلز دارند و بیشترین میزان کاهش یا حذف این آلاینده در خاک توسط باکتری‌ها انجام شده است (30). با توجه به اینکه گام نخست در پالایش زیستی محیط‌های آلوده به فلزات و اکسی‌آنیون‌های سمی معدنی، انتخاب میکروارگانیسم‌های مقاوم است، بنابراین در بخش اول این مطالعه، پس از جمع‌آوری نمونه‌های ماست سنتی از مناطق غرب کشور و انجام تکنیک غنی‌سازی، در مجموع 24 جدایۀ باکتری مولد اسیدلاکتیک مقاوم به سلنیت غربالگری شد. سپس با استفاده از ترکیبی از روش‌های غربالگری از جمله روش‌های رقت در آگار، روش انتشار در چاهک و بررسی منحنی‌های رشد جدایه‌های مقاوم در حضور سلنیت، جدایۀ باکتری seD2b با پتانسیل مقاومت همراه با احیای اکسی‌آنیون سلنیت (بالاتر از 110 میلی‌مولار) به‌عنوان سویۀ کارآمد جهت انجام آزمایش‌های سلنیت‌زدایی انتخاب و شناسایی فنوتیپی و ملکولی شد. براساس نتایج آزمون‌های شناسایی، سویۀ باکتری seD2b دارای بالاترین شباهت (بیش از 99درصدی) با لاکتوکوکوس رافینولاکتیس بود. توالی باکتری ذکرشده با شماره دسترسی KR150681 در بانک جهانی اطلاعات ژنی NCBI قابلِ‌دسترسی است. در ارتباط با الگوی تحمل‌پذیری ذاتی نسبت به اکسی‌آنیون سمی سلنیت، در بسیاری از سلول‌های باکتریایی غربالگری‌شده، میزان مقاومت بین 2 تا 50 میلی‌مولار گزارش شده است. برای مثال رشد گونه‌های باکتری Bacillus subtilis، Ralstonia metallidurans، Rhodospirillum rubrum و Rhodobacter spheroids توسط 2 تا 6 میلی‌مولار سلنیت مهار شد. همچنین رشد Rhizobium sp. از ۸تا۱۸ میلی‌مولار سلنیت مهار گردید. سطوح مقاومت بالاتری دربارۀ Aeromonas salmonicida ،Azospira oryzae و Stenotrophomonas maltophilia به‌میزان ۱۶تا۵۰ میلی‌مولار سلنیت گزارش شده است. با این حال، مقاومت‌های بسیار بالاتری نیز در سوش‌های متعلق به جنس Pseudomonas (150 میلی‌مولار) و گونه باکتری Comamonas testosteroni S44 (100 میلی‌مولار) گزارش شده است (15). در جدیدترین مطالعۀ صورت‌گرفته در ارتباط با حذف و احیای سلنیت سدیم، خلیلیان[xi] و همکاران در سال 2015 یک سویۀ باکتری تحت نام Bacillus sp. QW90 را با قابلیت تحمل‌پذیری بالا (550 میلی‌مولار) از پساب‌های آلوده به سلنیت را جداسازی کردند (16). با مقایسۀ یافته‌های به‌دست‌آمده در این پژوهش با گزارش‌های مشابه صورت‌گرفته در سویه‌های باکتری می‌توان نتیجه گرفت که جدایۀ seD2b از توانمندی تحمل‌پذیری و مقاومت نسبتاً مناسبی برخوردار است. در بخش دوم این کار پژوهشی، پتانسیل حذف میکروبی سلنیت توسط سلول‌های در حال استراحت جدایۀ بومی لاکتوکوکوس رافینولاکتیس به‌عنوان زیست‌کاتالیزگر در مقیاس آزمایشگاهی ارزیابی شد. براساس نتایج، پس از 72 ساعت گرمخانه‌گذاری، سلول‌های در حالت استراحت سویۀ باکتری ذکرشده توانست به‌میزان 2/90درصد از سلنیت موجود در محیط زیست تبدیلی را حذف کند و غلظت آن را از 10 میلی‌مولار به کمتر از یک میلی‌مولار برساند. در مطالعه‌ای که Di و همکاران در ارتباط با سویۀ Stenotrophomonas sp. SeITE02 انجام دادند مشخص شد که این سویه دارای مقاومت تا 50 میلی‌مولار به سلنیت است. این سویه غلظت 5/0 میلی‌مولار سلنیت را به‌طور کامل در کشت مایع در طی مدت 52 ساعت حذف و احیا می‌کند (31). در مطالعه‌ای که کورادو[xii] و همکاران در سال 2011 بر سویۀ Pseudomonas stutzeri NT-I انجام دادند مشخص شد که این سویه توانایی حذف و احیای سلنیت را دارد و می‌تواند در مدت‌زمان 18 ساعت 95درصد از سلنیت را از محیط حذف کند (32). همچنین در گزارشی که Ikram ارائه کرد چندین گونه از جنس باسیلوس مقاوم به سلنیت (حداکثر مقاومت 20 گرم در لیتر) جداسازی شد و توانایی حذف و احیای سلنیت در سویه‌های جداشده سنجش شد و در این بین بالاترین میزان حذف و احیا توسط سویۀ Bacillus pumilus به‌میزان 97درصد با غلظت اولیۀ 500 میکروگرم بر میلی‌لیتر سلنیت سدیم در مدت 144 ساعت گزارش شد (10). در مطالعه‌ای مشابه که pieniz بر جنس متفاوتی از باکتری اسیدلاکتیک انجام داد، میزان توانایی حذف سلنیت توسط سویۀLAB 18) ) Enterococcus faecium به‌میزان 8 میلی‌گرم در لیتر(80درصد) در مدت 24 ساعت گزارش شد. در این بررسی حذف بهینۀ سلنیت در دمای 25 درجه سانتی‌گراد و pH برابر 7 ثبت شد. براین‌اساس، در غلظت‌های اولیه 10 و 60 میلی‌گرم در لیتر سلنیت، به‌ترتیب19/9 میلی‌گرم در لیتر و 7/59 میلی‌گرم در لیتر یون سمی سلنیت توسط گونۀ باکتری Enterococcus faeciumدر مدت زمان 24 ساعت حذف شد. همچنین در این مطالعه مشاهده شد که با افزایش غلظت سلنیت از 10 تا 60 میکروگرم در لیتر میزان حذف افزایش پیدا می‌کند (18). در مطالعه‌ای که Wang و همکاران انجام دادند میزان حذف و احیای 2/0 میلی‌مولار سلنیت گزارش شد و سویۀ Escherichia coli توانست میزان 1/99درصد سلنیت را در مدت‌زمان 8 ساعت حذف کند (33).

پیشنهادها: در این پژوهش برای نخستین بار حذف زیستی سلنیت در گونۀ لاکتوکوکوس رافینولاکتیس گزارش شد. باکتری بومی ذکرشده دارای توانمندی احیای سلنیت به سلنیوم است؛ بنابراین پس از تعیین دقیق کمی میزان سلنیوم و تعیین دقیق جایگاه سلنیوم در سلول میکروبی به‌کمک روش‌های اتمیک و میکروسکوپی، غنی‌سازی غذاهای تخمیری با سلنیوم ایجادشده توسط باکتری ذکرشده، به‌عنوان یک مکمل غذایی ارزشمند و ایمن در تغذیۀ حیوانات و یا انسان بسیار امیدوارکننده است.



[1]- Generally regard as safe

[2]- Minimum Inhibitory Concentration

[3]- Minimum Bactericidal Concentration

[4]- Agar Dilution Method

[5]- Well Diffusion Method

[6]- Doubling time

[7]- Denaturation

[8]- Annealing

[9]- Extension

[10]- Final extension

[xi]- Khalilian

[xii]- Kuroda

(1)              Ahluwalia SS, Goyal D. Microbial and plant derived biomass for removal of heavy metals from wastewater. Bioresource Technology 2007; 98 (12): 2243-57.

(2)  Rosenfeld I, Beath OA. Selenium. Academic Press; New York: 1964: 279-332.

(3)              Earnshaw A, Greenwood N. Chemistry of the elements. 2rd ed. Burlington Massachusetts: Butterworth-Heinemann; 1997.

(4)              Yadav SK, Singh I, Singh D, Han S-D. Selenium status in soils of northern districts of India. Journal of Environmental Management 2005; 75(2): 129–32.

(5)         Rayman MP. The importance of selenium to human health. Lancet  2000; 356(9225): 233–41.

(6)              Han B, Ren Y, Guan L, Wei W, Hua F, Yang Y, et al. Sodium selenite induces apoptosis in acute promyelocytic leukemia-derived NB4 cells through mitochondria-dependent pathway. Oncology Research 2009; 17(8): 373–81.

(7)              Whanger, P. D. Selenium and its relationship to cancer: an update. British Journal of Nutrition2004; 91(01): 11-28.

(8)              Dong Y, Zhang H, Hawthorn L, Ganther HE, Ip C. Delineation of the molecular basis for selenium-induced growth arrest in human prostate cancer cells by oligonucleotide array. Cancer Research 2003; 63(1): 52–9.

(9)              Eustice DC, Kull FJ, Shrift A. Selenium toxicity. aminoacylation and peptide bond formation with selenomethionine. Plant Physiol. American Society of Plant Biologists 1981; 67(5): 1054–8.

(10)          Ikram M, Faisal M. Comparative assessment of selenite (SeIV) detoxification to elemental selenium (Se0) by Bacillus sp. Biotechnology Letters 2010; 32(9): 1255–9. 

(11)          Siddique T, Zhang Y, Okeke BC, Frankenberger WT. Characterization of sediment bacteria involved in selenium reduction. Bioresource Technology 2006; 97(8): 1041–9.

(12)          Kashiwa M, Nishimoto S, Takahashi K, Ike M, Fujita M. Factors affecting soluble selenium removal by a selenate-reducing bacterium Bacillus sp. SF-1. Journal of Bioscience and Bioengineering 2000; 89(6): 528–33.

(13)          Santos S, Ungureanu G, Boaventura R, Botelho C. Selenium contaminated waters: An overview of analytical methods, treatment options and recent advances in sorption methods. Science of the Total Environment 2015; 521: 246-60.

(14)          Li B, Liu N, Li Y, Jing W, Fan J, Li D,et al. Reduction of selenite to red elemental selenium by Rhodopseudomonas palustris strain N. PLoS One 2014; 9(4).

(15)          Zheng S, Su J, Wang L, Yao R, Wang D, Deng Y,et al. Selenite reduction by the obligate aerobic bacterium Comamonas testosteroni S44 isolated from a metal-contaminated soil. BMC Microbiology 2014; 14(1): 204.

(16) Khalilian M, Zolfaghari MR, Soleimani M, Zand Monfared MR. Bacillus sp. strain QW90, a bacterial strain with a high potential application in bioremediation of selenite. Report of Health Care 2015; 1(1): 6-10.

(17)          Kaur S, Das M. Functional foods: an overview. Food Science and Biotechnology 2011; 20(4): 861–75.

(18)          Pieniz S, Okeke BC, Andreazza R, Brandelli A. Evaluation of selenite bioremoval from liquid culture by Enterococcus species. Microbiology Research 2011; 166(3); 176–85.

(19)          Pophaly SD, Singh P, Kumar H, Tomar SK, Singh R. Selenium enrichment of lactic acid bacteria and bifidobacteria: a functional food perspective. Trends in Food Science and Technology 2014; 39(2): 135–45.

(20)          Halttunen T, Removal of cadmium, lead and arsenic from water by lactic acid bacteria. International Journal of Food Microbiology 2007; 114: 30.

(21)          Tilton RC, Howard BJ. Antimicrobial susceptibility testing. Clin Pathog Microbiol CV, st Louis, Washington, Toronto, Mosby Co. 1987; 121–6.

(22)          Madigan MT, Martinko JM, Parker J. Brock biology of microorganisms. 9rd ed. New Jersey: Upper Saddle River: Prentice‑Hall; 2000. 

(23)          Axelsson L. Lactic acid Bacteria: Classification and Physiology. In: Salminen S., von Wright A., Marcel Dekker INC., editor. Lactic acid Bacteria, Microbiology and Functional Aspects. 2th ed. New York; 1998: 1-73.

(24)          Dworkin M, Falkow S, Rosenberg E, Schleifer K, Stackebrandt E, Editors. The Prokaryotes. 3rd ed. NewYork: Springer; 2006.

(25)          Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 16S ribosomal DNA amplification for phylogenetic study. Journal of Bacteriology 1991; 173(2): 697–703.

(26)          Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 2013; 30(12): 2725–9.

(27)          Hurlbut JA, Burkepile RG, Geisler CA, Kijak PJ, Rummel NG. Colorimetric determination of selenium in mineral premixes. Journal of AOAC International 1996; 80(4): 709–16.

(28)          Ashengroph M, Nahvi I, Zarkesh-Esfahani H, Momenbeik F. Novel strain of Bacillus licheniformis SHL1 with potential converting ferulic acid into vanillic acid. Annals of Microbiology 2012; 62(2): 553–8.

(29)          Cheung KH, Gu J-D. Mechanism of hexavalent chromium detoxification by microorganisms and bioremediation application potential: a review. International Biodeterioration and Biodegradation 2007; 59(1): 8–15.

(30)          Rathgeber C, Yurkova N, Stackebrandt E, Beatty JT, Yurkov V. Isolation of tellurite-and selenite-resistant bacteria from hydrothermal vents of the Juan de Fuca Ridge in the Pacific Ocean. Applied and Environmental Microbiology 2002; 68(9): 4613–22.

(31)          Di Gregorio S, Lampis S, Vallini G. Selenite precipitation by a rhizospheric strain of Stenotrophomonas sp. isolated from the root system of Astragalus bisulcatus: a biotechnological perspective. Environment International 2005; 31(2): 233–41.

(32)          Kuroda M, Notaguchi E, Sato A, Yoshioka M, Hasegawa A, Kagami T, et al. Characterization of Pseudomonas stutzeri NT-I capable of removing soluble selenium from the aqueous phase under aerobic conditions. Journal of Bioscience and Bioengineering 2011; 112(3): 259–64.

(33)          Wang X, Liu G, Zhou J, Wang J, Jin R, Lv H. Quinone-mediated reduction of selenite and tellurite by Escherichia coli. Bioresource Technology 2011; 102(3): 3268–71.