جداسازی و شناسایی مولکولی باکتری لاکتوباسیلوس برویس از سرکه بومی

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 کارشناس ارشد زیست فناوری، دانشگاه اصفهان، ایران

2 دانشیار زیست‌شناسی مولکولی، دانشگاه اصفهان، ایران

3 دانشجوی دکترای میکروبیولوژی، دانشگاه اصفهان، ایران

4 دانشیار میکروبیولوژی، دانشگاه اصفهان، ایران

چکیده

مقدمه: سرکه یک چاشنی پرمصرف در سراسر جهان است که از مواد اولیه و روش‌های متفاوت برای تولید آن استفاده می‌شود. در ایران نیز انواع سرکه‌های طبیعی با استفاده از میوه‌های مختلف مانند انگور و سیب، بیشتر به‌صورت خانگی تهیه می‌شود. سرکه طبیعی دارای خواص بسیار زیادی است و طب سنتی ایرانی اسلامی نیز مصرف آن را توصیه کرده است. سرکه حاوی باکتری‌های اسید استیک، اسید لاکتیک و مخمر است. باکتری‌های اسید استیک و مخمرها در تولید سرکه نقش دارند و باکتری‌های اسید لاکتیک باعث بهبود طعم آن می‌شوند. هدف این پژوهش جداسازی و تعیین هویت باکتری‌های اسید لاکتیک از سرکه سنتی به‌ویژه لاکتوباسیلوس برویس به‌منظور ارزیابی میزان تولید گاما آمینوبوتریک اسید (گابا) است‏. ‏‏

مواد و روش ‏‏ها: نمونه‌های سرکه سنتی شامل یک نمونه سرکه سیب و دو نمونه سرکه انگور، در محیط کشت مخصوص باکتری‌های اسید لاکتیک (MRS) که به آن آنتی‌بیوتیک نیستاتین اضافه شد و کشت داده شد. با انجام تعدادی از آزمایش‌های تشخیصی از جمله آزمایش کاتالاز، و تخمیر برخی از کربوهیدرات‌ها، رشد در دما، pH و غلظت‌های متفاوت نمک، حضور لاکتوباسیل‌ها بررسی شد و درنهایت با تکثیر ژن s r DNA 16 و تعیین توالی، پنج گونه لاکتوباسیلوس شناسایی شدند. ‏‏

نتایج: از سه نمونه سرکه سنتی، دوازده جدایه لاکتوباسیلوس جداسازی شد. همه باکتری‌های جداشده کاتالاز منفی و گرم مثبت بودند و در pHهای 5/4 و 5/6 و در غلظت‌های 2، 4 و 5/6درصد نمک رشد کردند. اغلب باکتری‌ها در دمای 15 درجه سانتی‏گراد رشد کردند. جدایه شماره 12 در دمای 45 درجه سانتی‏گراد نیز رشد کرد. آزمایش‌های بیوشیمیایی، حضور لاکتوباسیلوس پلانتارم و لاکتوباسیلوس برویس نمونه‌های مطالعه‌شده را نشان دادند. نتیجه تعیین توالی وجود سه جدایه لاکتوباسیلوس برویس را تأیید کرد. ‏

بحث و نتیجه‏ گیری: لاکتوباسیلوس پلانتارم و لاکتوباسیلوس برویس در سرکه‌های بومی بررسی‌شده تشخیص داده شد. هرچند جداسازی لاکتوباسیلوس پلانتارم از سرکه قبلاً گزارش شده است، جداسازی لاکتوباسیلوس برویس از سرکه برای اولین بار گزارش می‌شود‏. ‏‏

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Isolation and molecular identification of Lactobacillus brevis from traditional vinegar

نویسندگان [English]

  • Zeynab Ebrahimi 1
  • Abolghasem Esmaeili 2
  • Tooba Sadat Ahmadi 1
  • Hamid Emami 3
  • Mohammad Rabbani 4
1 MSc. of Microbial biotechnology, University of Isfahan, Iran
2 Associate professor of Molecular biology, University of Isfahan, Iran
3 PhD student of Microbiology, University of Isfahan, Iran
4 Associate Professor of Microbiology, University of Isfahan, Iran
چکیده [English]

Introduction: Vinegar is a popular condiment in the world that different materials and methods have been used to produce it. In Iran natural vinegar is also prepared mostly in a traditional way by using different fruits such as grapes and apples. Natural vinegar has beneficent properties and because of this, it is recommended to be used by traditional and Islamic medicine. Vinegar contains acetic acid bacteria, lactic acid bacteria and yeast. Acetic acid bacteria and yeasts are involved in the production of vinegar and lactic acid bacteria improve the flavor of vinegar. The aim of this study was isolation and identification of lactic acid bacteria especially Lactobacillus brevis from traditional vinegar.

Materials and methods: After collecting a few traditional vinegars, the vinegar samples cultured for isolation of lactic acid bacteria on MRS broth and agar media contained nystatin as an anti-yeast antibiotic. Then some microbiological tests including catalase, gram staining and fermentation of carbohydrates were performed. Then, they were cultured at different temperatures, pH and different concentrations of salts. Finally, three isolates bacteria with biochemical properties of Lactobacillus brevis were evaluated by16 srDNA gene amplification.

Results: Twelve lactobacilli were isolated from three vinegar samples. All isolated bacteria were catalase-negative and gram-positive. They could be able to grow at pH around 4.5 and 5.6, and at 2, 4 and 5.6% of salt concentrations. Most of the bacteria grew at 15oC, whereas one isolated grew at 45oC. Sequencing and Blast results showed that the three strains are Lactobacillus brevis.

Discussion and conclusion: Lactobacillus brevis and Lactobacillus plantrum were found in traditional vinegars. Although isolation of Lactobacillus plantrum from vinegar was reported previously, as far as we could determine, it is for the first time that we could isolate Lactobacillus brevis from vinegar.

کلیدواژه‌ها [English]

  • Vinegar
  • Lactic acid bacteria
  • Lactobacillus brevis

مقدمه.

تولید سرکه با روش تخمیر قدمت چندهزارساله دارد. تمدن‌های بزرگ سرکه را می‌شناختند و برای آن ارزش خاصی قائل بودند و در بسیاری از موارد مانند ضدعفونی‌کردن، تسکین درد، درمان و تمییز‌کردن ظروف، از آن استفاده می‌کردند. رومیان و یونانیان از سرکه رقیق‌شده به‌عنوان یک نوشیدنی نشاط‌آور استفاده می‌کردند. پایه اصلی سرکه، اسید استیک است. این اسید به سرکه طعمی ترش می‌دهد و باعث آنتی‌سپتیک‌بودن آن می‌شود (1).

 اولین مرحله تولید سرکه، تخمیر الکلی است که فرایندی هوازی است و طی آن قند یا نشاسته به الکل تبدیل می‌شود. تشکیل الکل از قند با مخمرهای تولیدکننده الکل به‌خصوص ساکارومایسس سرویزیه[1] صورت می‌گیرد. مرحله دوم، مرحله اسیدسازی است. این مرحله عبارت است از اکسیداسیون اتانول به اسید استیک که به‌وسیله باکتری‌های جنس‌های استوباکتر[2]و گلوکونوباکتر[3] صورت می‌گیرد (2).

 سرکه دارای خواص و کاربردهای زیادی است. بسیاری از نسخه‌های طب سنتی از سرکه، عسل و ترکیب آن دو (سرکنگبین یا سکنجبین) استفاده شده است. براساس یافته‌های طب سنتی، استفاده از سرکه در کنار وعده‌های غذایی باعث رقیق‌شدن خون می‌شود، به تجزیه چربی‌ها و دفع سموم کمک می‌کند، سبب کاهش چربی خون می‌شود و هضم و جذب کلسیم را آسان می‌کند. سرکه می‌تواند باکتری‌های مضر دستگاه گوارش را از بین ببرد، ترشح اسید معده را متعادل کند و تولید گاز معده را تعدیل کند. سرکه در رفع جرم دندان و التهاب لثه مؤثر است. سرکه ضدعفونی‌کننده قوی است و می‌تواند به عملکرد سم‌زدایی کبد کمک کند و صفرا را کاهش دهد. سرکه ماده پایداری است، حتی اگر بعد از مدتی کدر شود و رسوب کند، همچنان خاصیت دارد (3).

سرکه طبیعی سیب به‌عنوان یکی از غذاهای طبیعی کامل شناخته شده است که حاوی پتاسیم، سدیم، فسفر، منیزیوم، گوگرد، آهن، مس، فلوئور، سیلیس، ویتامین‌های C، A، E، B1، B2، B6، بتاکاروتن و نوعی فلاونوئید، است. بتاکاروتن یکی از مؤثرترین آنتی‌اکسیدان‌ها است. پتاسیم که عنصر جوانی نیز نامیده می‌شود، باعث نرم‌شدن و انعطاف‌پذیری ماهیچه‌های بدن می‌شود و برای رشد و استحکام استخوان‌ها نیز اهمیت دارد (1). ادعا شده که سرکه سیب برای پاک‌سازی بدن از مواد سمی، درمان سردرد، ازبین‌بردن پینه، خال‌های پوستی و زگیل، درمان آفتاب‌سوختگی، درمان ناراحتی‌های گلو، تقویت قلب و دستگاه گوارش، کاهش ناراحتی‌های کلیه و مثانه، بهبود آرتروز، جلوگیری از خونریزی بینی، رفع یبوست و... مفید است (4).

به عبارتی می‌توان گفت سرکه یک غذای عملگرا و یا فراسودمند[4] است. غذاهای عملکردی، فراسودمند یا عملگرا غذاهایی هستند که علاوه بر خواص تغذیه‌ای پایه، دارای مزایای فیزیولوژیک هستند و در کاهش خطر ابتلا به بیماری‌های سخت و مزمن، و کمک به سلامت انسان مؤثرند (5).

 سرکه حاوی باکتری‌های اسید استیک و مخمر است که در تولید سرکه نقش دارند؛ علاوه‌بر‌این ریزسازواره‌ها، سرکه حاوی باکتری‌های اسید لاکتیک[5] (LAB) نیز هست که باعث بهبود طعم آن می‌شوند (6 و 7).

 باکتری‌های اسید لاکتیک، گروه مهمی از باکتری‌ها هستند که به‌طور وسیعی در محیط پراکنده شده‌اند و در انواع غذاهای تخمیری، سبزیجات، مخاط و روده انسان و حیوانات یافت می‌شوند. این باکتری‌های کوکوباسیل یا میله‌ای‌شکل، بی‌هوازی تا هوازی اختیاری، گرم مثبت، با درصد پایین سیتوزین و گوانین، تحمل‌کننده اسید، معمولاً بدون اسپور، کاتالاز و اکسیداز منفی، هستند که براساس ویژگی‌های متابولیکی و فیزیولوژیکی دسته‌بندی می‌شوند. این باکتری‌ها معمولاً در گیاهان درحالِ‌تجزیه و محصولات وابسته به شیر یافت می‌شوند و محصول نهایی تخمیر آن‌ها اسید لاکتیک است. درباره تعیین حدود این گروه بحث می‌شود. اگرچه لاکتوباسیلوس، لوکونوستوک، پدیوکوکوس و استرپتوکوکوس از گذشته دور هسته اصلی این گروه را تشکیل می‌دادند، براساس طبقه‌بندی یافته‌های جدید امروزه 20 جنس مختلف به این گروه نسبت داده می‌شود. طبقه‌بندی باکتری‌های اسید لاکتیک در جنس‌های مختلف براساس خصوصیات مورفولوژیکی، نحوه تخمیر گلوکز، رشد در غلظت‌های مختلف نمک و تحمل شرایط اسیدی و قلیایی است. از نشان‌های شیمیایی مانند ترکیب اسیدهای چرب و ساختار دیواره سلولی نیز در طبقه‌بندی استفاده می‌شود. این دسته از باکتری‌ها به‌ندرت با عفونت‌های دستگاه گوارش یا سایر دستگاه‌های بدن در ارتباط هستند و سویه‌هایی که از نظر اکولوژیکی استفاده می‌شوند، در دسته باکتری‌های بی‌خطر قرار دارند (8-14). افزودن سویه‌های خاصی از باکتری‌های اسید لاکتیک به مواد غذایی، می‌تواند باعث پیشگیری از ابتلا به برخی بیماری‌ها شود و به‌عنوان یک عامل تحریک‌کننده دستگاه ایمنی عمل کند (15 و 16). مکانیسم‌هایی برای توجیه اثرات پیش‌گیری‌کننده و درمانی آن‌ها در بیماری‌های انسان پیشنهاد شده است که از آن جمله می‌توان به تولید ترکیبات مهارکننده باکتری‌ها، تعدیلpH روده، تقویت دستگاه ایمنی، انسداد جایگاه‌های اتصال باکتری‌ها و رقابت برای جذب مواد غذایی اشاره کرد (17 و 18). تولید اسیدهای آلی مانند اسید استیک، اسید پروپیونیک، فنیل لاکتیک اسید، اسید فرمیک یا اسیدهای چرب آزاد، آمونیاک، دی استیل، پراکسید هیدروژن، اسیدهای آمینه و...کاهش پتانسیل احیا، سنتز آنتی‌بیوتیک‌ها و باکتریوسین‌ها است که همگی به‌عنوان آنتی‌بیوز[6] تعریف می‌شوند در اثر ضدمیکربی آن‌ها مؤثر شمرده شده‌اند (19). علاوه‌بر ‌این‌ها می‌توان اتانل، دی آمین استوئین، استالدئید، بنزوات، لانتی‌بیوتیک‌ها، آنتی‌بیوتیک‌ها، رئوترین، رئوتریساکلین را نام برد (5 و 20). باکتری‌های اسیدلاکتیک به‌عنوان بخش مهمی از صنعت غذاسازی به‌خصوص در تولید غذاهای تخمیری به حساب می‌آیند؛ زیرا سویه‌های مختلف ویژگی‌های تخمیری متعددی مانند توانایی تولید اسید، طعم و مزه مختلف را دارند (6). بدون شک مهم‌ترین کاربرد باکتری‌های اسید لاکتیک، کاربرد آن‌ها به‌عنوان آغازگر در تولید محصولات لبنی تخمیری است. گونه‌های متفاوتی از باکتری‌های اسید لاکتیک به‌عنوان پروبیوتیک شناسایی شده‌اند که دو گروه عمده از ریزسازواره‌های پروبیوتیکی، لاکتوباسیلوس‌ها[7] و بیفیدوباکتریوم‌ها[8] هستند (20) ولی بیشترین گونه‌ها به لاکتوباسیل‌ها مربوط می‌شوند.

 لاکتوباسیلوس‌ها از طرفی آثار مفیدی بر سلامت انسان دارند و از طرف دیگر میزان قابلِ‌توجهی از گاماآمینوبوتریک اسید (گابا) را تولید می‌کنند که خود دارای تأثیرات فیزیولوژیک بسیار مهم است و در درمان اختلالاتی نظیر هیجان و فشار خون مؤثر است ؛ لذا در این تحقیق حضور لاکتوباسیلوس‌ها در سرکه بررسی شد.

‏‏مواد و روش ‏ها.

تهیة سرکه: یک نمونه سرکه سیب و دو نمونه سرکه انگور خانگی، پس از کسب اطلاعات لازم از روند تولید آن‌ها تهیه شد.

 محیط‌های کشت MRS و M17: محیط‌های کشت مایع و جامدMRS (سیگما آلدریچ[9]) برای کشت گونه‌های لاکتوباسیلوس به کار رفت. محیط کشت MRS به دو صورت مایع و جامد مطابق دستورالعمل شرکت سازنده تهیه و استفاده شد. از محیط کشت M17 (سیگما آلدریچ) نیز به‌منظور کشت سویه‌های لاکتوکوکوس[10] استفاده شد. محیط کشت M17 نیز به دو صورت مایع و جامد استفاده شد.

 جداسازی لاکتوباسیلوس ‌ها از سرکه: ابتدا پودر نیستاتین تحت شرایط استریل در 12 میلی‌لیتر آب مقطر تزریقی حل شد. سپس محیط کشت MRS مایع تهیه شد و نیستاتین به‌مقدار 50 تا 150 واحد در میلی‌لیتر به محیط کشت اضافه شد (به‌منظور جلوگیری از رشد مخمر و قارچ)، سپس 1 سی‌سی از سرکه (سانتریفوژشده با دور rpm 4000 به‌مدت 10 دقیقه) به محیط اضافه شد و به‌مدت 24 تا 48 ساعت در انکوباتور 37 سانتی‌گراد قرار داده شد. پس از رشد باکتری‌ها در محیط کشت مایع یک لوپ از هرکدام به محیط کشت MRS جامد دارای نیستاتین[11] انتقال داده شد و به‌همراه گاز پک به‌مدت 24 تا 48 ساعت در انکوباتور 37 سانتی‌گراد قرار داده شد. پس از رشد باکتری‌ها یک کلنی از هر پلیت مجدداً در محیط MRS جامد کشت داده شد و در شرایط مشابه گرماگذاری شد. این مرحله جهت حاصل‌شدن کلنی خالص تکرار شد.

جداسازی لاکتوکوکوس‌ها از سرکه: پس از تهیة محیط کشت M17 مایع، نیستاتین به‌مقدار 50 تا 150 واحد در میلی‌لیتر در مقیاس حجم به محیط کشت اضافه شد، سپس 1 میلی‌لیتر از سرکه مدِنظر به محیط اضافه شد و به‌مدت 24 تا 48 ساعت در انکوباتور 30 سانتی‌گراد قرار داده شد. این مراحل سه بار تکرار شد.

 آزمایش کاتالاز: آزمایش کاتالاز به‌منظور بررسی توانایی باکتری‌ها در تولید آنزیم کاتالاز انجام می‌شود. برای انجام آزمایش با لوپ سترون از نمونه میکروبی کشت‌داده‌شده (کلنی خالص) روی لام تمیز قرار می‌گیرد و سپس چند قطره پراکسید هیدروژن 3درصد (سیگما آلدریچ) روی آن اضافه می‌شود. اگر باکتری آنزیم کاتالاز داشته باشد،H2O2 را تجزیه می‌کند و حباب‌های گاز اکسیژن تولیدشده در سطح لام قابل مشاهده می‌شود. درصورت مشاهده‌نشدن حباب، باکتری کاتالاز منفی است.

آزمایش تخمیر کربوهیدرات‌ها: طبق جدول شماره ۱ محیط کشت پایه قندی تهیه شد، سپس محیط کشت در لوله‌های مجزا ریخته شد و 5/1درصد از قندهای مختلف به آن‌ها افزوده شد و در 115 سانتی‌گراد به‌مدت 10 دقیقه استریل شدند.

 

جدول 1- مواد و مقدار مورد نیاز برای محیط کشت قندی

نوع ماده

مقدار (گرم/لیتر)

عصارة مخمر

4

K2HPO4

2

پپتون از کازئین

10

دی آمونیوم سیترات

2

استات سدیم

5

سولفات منیزیم

2/0

سولفات منگنز

04/0

توین 80

1

بروموکروزول ارغوانی

04/0

آب مقطر

1000 میلی‌لیتر

 

 پس از تهیه محیط کشت مخصوص کربوهیدرات‌ها، یک کلنی از باکتری‌ها به محیط کشت تلقیح شدند و در انکوباتور 37 سانتی‌گراد به‌مدت 24 تا 48 ساعت قرار داده شدند. اگر قند را باکتری مصرف کند، رنگ محیط کشت به‌دلیل تولید اسید، زرد می‌شود. پس از انجام آزمایش، نتایج تخمیر کربوهیدرات‌ها با جدول استاندارد برگی مقایسه شد. قندهایی که در این آزمایش به کار برده شدند شامل آرابینوز، مالتوز، سلوبیوز، گزیلوز، مانیتول، لاکتوز، فروکتوز، ملزیتوز، سالیسین، رامنوز، گالاکتوز، آدنیتول، مانوز، ساکارز، دول‌سیتول، ترهالوز، رافینوز، گلوکز با لوله دورهام و ملبیوز بودند.

سایر آزمایش‌های بیوشیمیایی: لاکتوباسیلوس‌های جداشده از سرکه‌ها بر روی محیط MRS کشت داده شدند و به‌مدت 72 ساعت تا یک هفته در دماهای 15 و 45 سانتی‌گراد قرار داده شدند. توانایی رشد لاکتوباسیلوس‌های جداشده در محیط کشت MRS مایع دارای غلظت‌های 2، 4 و 5/6درصد )وزنی حجمی) NaCL و همچنین توانایی رشد در محیط کشت مایع با pHهای متفاوت (5/4 و 5/6) بررسی شد.

شناسایی مولکولی باکتری‌ها: برای شناسایی باکتری‌ها به‌روش مولکولی از PCR[12] استفاده شد. استخراج DNA باکتری با روش انجمادـذوب[13] انجام شد؛ بدین صورت که یک کلنی از سطح محیط کشت جامد باکتری با استفاده از لوپ استریل برداشته شد و در 100 میکرولیتر آب مقطر استریل حل شد، سپس به‌مدت 20 دقیقه در فریزر با دمای منفی20 درجه سانتی‌گراد قرار داده شد. سپس از فریزر خارج شد و در دمای محیط قرار داده شد تا کاملاً ذوب شود. پس از آن مجدداً به‌مدت یک شب در فریزر منفی 20 درجه سانتی‌گراد قرار داده شد. از سوسپانسیون حاصل به‌صورت مستقیم به‌عنوان الگو برای واکنش PCR استفاده شد. با استفاده از سوسپانسیون به‌دست‌آمده و پرایمرهای DG47F، RW01R و 27F، 1492R، تکثیر ژن s rDNA16 انجام شد. توالی آغازگرهای DG47F و RW01R، به‌ترتیب 5´-AGGAGGTGATCCACCCGCA و
 5´-AACTGGAGGAAGGTGGGGAT و توالی آغازگرهای 27F و 1492R، به‌ترتیب
 5´- AGAGTTTGATCCTGGCTCAC و
 5´-CGGTTACCTTGT TACGAC TT است. شرایط دمایی انجام PCR بدین صورت بود: برای پرایمرهای 27F و 1492R: دمای ذوب اولیه 94 سانتی‌گراد (8 دقیقه)، دمای ذوب 94 سانتی‌گراد (30 ثانیه)، دمای اتصال 55 سانتی‌گراد (1 دقیقه) و دمای گسترش نهایی 72 سانتی‌گراد (10 دقیقه) و برای پرایمرهای DG47 و RW01: دمای ذوب اولیه 94 سانتی‌گراد (5 دقیقه)، دمای ذوب 95 سانتی‌گراد (1 دقیقه)، دمای گسترش 72 سانتی‌گراد (2 دقیقه) و دمای گسترش نهایی 72 سانتی‌گراد (10 دقیقه).

 سپس محصول PCR بر روی ژل آگارز برده شد. محصولی که باندی مشخص و بدون اسمیر داشت برای توالی‌یابی به شرکت زیست‌‌فناوران ارسال شد. برای تهیة ژل و انجام الکتروفورز، 2/0گرم از آگارز با ترازو وزن شد و 2 سی‌سی بافر x 1 TAE به آن اضافه شد (برای تهیة بافر X10، 48/4 گرم تریس بازی، 14/1 میلی لیتر اسید استیک گلاسیال و 37/0 گرم Na2EDTA مخلوط شد سپس حجم محلول با آب مقطر به 100 سی‌سی رسانده شد) سپس حجم کل به 20 سی‌سی رسانده شد و بر روی هیتر قرار داده شد تا آگارز به‌طور کامل حل شود و محلول کاملاً شفاف شود. بعد از اینکه محلول کمی خنک شد، 4 میکرولیتر رنگ ژل، به آن اضافه شد و محتوای ارلن به‌آرامی داخل سینی ریخته شد، به‌طوری‌که حباب تشکیل نشود. سپس سینی ژل حاوی آگارز منعقدشده بعد از درآوردن شانه، در تانک الکتروفورز به‌صورت افقی قرار داده شد. بافر X 1 TAE به‌آرامی در تانک ریخته شد تا حداقل چند میلی‌لیتر روی سطح ژل را بپوشاند. از کلیة نمونه‌هایPCR شده، 3 تا 5 میکرولیتر برداشته شد و با 1 میکرولیتر بافر بارگذاری مخلوط شد و به‌آرامی وارد چاهک‌های ژل شد. تانک الکتروفورز به منبع جریان برق وصل شد، به‌طوری‌که چاهک‌ها به طرف قطب منفی باشد. ولتاژ دستگاه الکتروفورز بر روی 100 به‌مدت حداقل نیم ساعت تنظیم شد.


نتایج.

جداسازی لاکتوباسیلوس‌ها از سرکه: از دو نوع سرکه (یک نمونه سرکه سیب و دو نمونه سرکه انگور)، 12 نوع جدایه باکتری (شش جدایه از سرکه سیب و شش جدایه از سرکه انگور) جداسازی شد. تصاویر کلنی‌های تعدادی از آن‌ها در شکل -A1 نشان داده شده است.

جداسازی لاکتوکوکوس‌ها از سرکه: با توجه به اینکه مراحل جداسازی لاکتوکوکوس‌ها سه بار تکرار شد، بااین‌حال هیچ باکتری در محیط M17 رشد نکرد.

آزمایش کاتالاز و رنگ آمیزی گرم: پس از تهیة کشت خالص، آزمایش‌های کاتالاز و گرم برای باکتری‌های جداشده انجام شد. تمام باکتری‌ها کاتالاز منفی، گرم مثبت و میله‌ای‌شکل بودند. این نتایج با لاکتوباسیل‌ها هم‌خوانی دارد. تصاویر میکروسکپی تعدادی از آن‌ها بعد از رنگ‌آمیزی گرم، در شکل 1-B آمده است.

 

 

 

شکل 1- (A) کلنی‌های لاکتوباسیلوس‌های جداشده از انواع سرکه‌ها، (B) تصویر رنگ‌آمیزی گرم لاکتوباسیل‌های جداسازی‌شده از سرکه‌ها (C) تغییر رنگ محیط قندی با رشد باکتری


آزمایش تخمیر کربوهیدرات‌ها: نتایج مربوط به آزمون تخمیر کربوهیدرات‌ها در جدول 2 و تصویری از تغییر رنگ محیط کشت قندی در شکل 1-C نشان داده شده است.


 سایر آزمایش‌های بیوشیمیایی: باکتری‌های شماره 4، 5، 6، 7، 8، 9، 10، 11 و 12 (جدول 2) در دمای 15 سانتی‌گراد رشد کردند. باکتری شماره 12 نیز در دمای 45 سانتی‌گراد رشد کرد. تمام باکتری‌ها در غلظت‌های مختلف نمک و در pH 5/4 و 5/6 رشد کردند.

 

جدول 2- نتایج مربوط به آزمون تخمیر کربوهیدرات‌ها

جدایه 12

جدایه 11

جدایه 10

جدایه 9

جدایه 8

جدایه 7

جدایه 6

جدایه 5

جدایه 4

جدایه 3

جدایه 2

جدایه 1

قندها

+

+

+

+

-

+

+

+

+

-

-

-

لاکتوز

-

+

+

-

-

+

+

+

+

+

-

-

ساکارز

-

+

+

-

+

+ ضعیف

+

+

-

+

+

-

مانیتول

+

+

+

+

+

+

+

+

+

-

+

+

مالتوز

+

-

+

+

+

+

+

+

+

+

+

+

گالاکتوز

-

-

-

-

-

-

-

-

+

-

-

-

رافینوز

-

-

+

-

+

-

-

+ ضعیف

-

+

-

-

مانوز

+

+

+

+

+

+

+

+

-

-

-

-

گزیلوز

+

-

+

-

-

+

-

+

+ ضعیف

+ ضعیف

-

+ ضعیف

آرابینوز

-

-

-

-

-

-

-

-

+ ضعیف

-

-

-

رامنوز

-

؟

+

؟

-

-

-

-

-

-

؟

؟

ترهالوز

-

-

-

-

+ ضعیف

-

+

-

+ ضعیف

+

+ ضعیف

-

سلوبیوز

-

+

-

-

-

-

-

-

-

-

-

-

دول سیتول

+

+

+

-

+

+

+

+

+

+

+

+

ملبیوز

-

-

+

-

-

-

-

+

-

-

+

+

ملزیتوز

-

-

+

-

-

-

-

-

+ ضعیف

+ ضعیف

+

-

سالیسین

+

+

+

+

+

+

+

+

+

+

+

+

فروکتوز

بدون گاز

گاز دار

گاز دار

گاز دار

بدون گاز

گاز دار

گاز دار

بدون گاز

گاز دار

گاز دار

گاز دار

بدون گاز

گلوکز

L. brevis

L. plantarum

L. brevis

L. plantarum

L. brevis

L. plantarum

L. plantarum

L. plantarum

L. brevis

L. plantarum

L. brevis

L. brevis

L. plantarum

coryniformis

L. plantarum

L. brevis

L. plantarum

L. brevis

گونه‌های پیش‌بینی‌شده

؟: منظور نا مشخص بودن آزمون در این خصوص است.

 

شکل 2- الکتروفورز محصول PCR باکتری. ستون سمت چپ بیانگر نشانگر با اندازه (1kb)، ستون‌های شماره‌گذاری‌شده از 1 تا 7 به ترتیب نتایج PCR جدایه‌ها را با آغازگرهای 27F و 1492R، ستون‏های شماره‏گذاری‌شده از 8 تا 13 به‌ترتیب نتایج PCR جدایه‏ها را با آغازگرهای DG47F و RW01R، ستون 14 کنترل منفی نشان می‌دهد.

 


شناسایی باکتری‌ها با استفاده از PCR و توالی‌یابی: آزمایش واکنش زنجیره‌ای پلی‌مراز (PCR) برای ژن s r DNA16 جدایه‌های 1، 5 و 12 انجام شد و محصول PCR برای تأیید تشخیص، توالی‌یابی شدند. نتایج حاصل از PCR، توالی‌یابی و استفاده از ابزار پایه‌ای برای جستجوی برهم‌نهی‌های موضعی (بلست)[xiv]، نشان داد که این سه سویه، لاکتوباسیلوس برویس هستند. تصاویر ژل‌ها در شکل‌ 2 نشان داده شده است.

 

بحث و نتیجه ‏‏گیری.

تاکنون از مواد غذایی متفاوتی به‌ویژه غذاهای تخمیری مانند کیمچی کره‌ای (21)، پائوکای چینی (22)، سوردوغ (23)، پنیر (24) و دیگر محصولات لبنی، باکتری‌های اسید لاکتیک جداسازی شده‏اند. در منـابع مختلـف بـرای جداسازی باکتری‌ها از محـیط کشت MRS استفاده شده سپس شناسایی بیوشیمیایی و مولکولی لاکتوباسیوس‌ها انجام گرفته است. در این پژوهش نیز با استفاده از محـیط کشت MRS کلنی‌های خالص لاکتوباسیلوس به دست آمد، سپس برای شناسایی از آزمایش‌های بیوشیمیایی از جمله قندها استفاده شد. در پژوهش‌های مختلف نیز از این آزمایش‌ها استفاده می‌شود ولی نوع و تعداد قندهای به‌کاررفته متفاوت است. هرچه تعداد قندها بیشتر باشد با اطمینان بیشتری می‌توان گونة باکتری را مشخص کرد ولی برای تشخیص نهایی بیشتر از روش‌های مولکولی مانند PCR و RAPD[xv] استفاده می‌شود؛ زیرا در برخی موارد نتایج آزمایش‌های قندی با آنچه در کتاب برگی آمده است، متفاوت است؛ همان‌گونه که لاکتوباسیلوس شماره 1 که با آزمایش مولکولی مشخص شد برویس است، اما نتایج مربوط به قند سلوبیوز متفاوت است. در اغلب پژوهش‌ها هدف از جداسازی باکتری‌های اسید لاکتیک، غربال‌گری سویه‌هایی بوده است که دارای خاصیت پروبیوتیکی‌اند و یا توانایی بالایی در انجام عملکردی خاص نظیر تولید گابا دارند. سپس از آن‌ها برای تولید غذاهای عملگرا استفاده شده است.

 درباره جداسازی لاکتوباسیلوس از سرکه گزارش‌های کمی وجود دارد. در یک نمونه از سرکه سنتی چینی چهار نوع لاکتوباسیلوس فرمنتوم[xvi]، بوچنری[xvii]، کازئی[xviii]و پلانتاروم[xix] شناسایی شده است (7). تاکنون، بر سرکه‌های سیب و انگور پژوهشی صورت نگرفته. با توجه به اینکه این سرکه‌ها به‌صورت سنتی در ایران تهیه می‌شوند و به دلیل خواصشان طب سنتی نیز مصرف آن‌ها را توصیه کرده است، در این پژوهش سعی شد با بررسی سرکه‌های بومی، وجود یا عدم وجود باکتری‌های اسید لاکتیک بررسی شود. به دلیل اهمیت باکتری‌های اسید لاکتیک از نظر خواص پروبیوتیکی، کاربرد این باکتری‌ها در صنایع غذایی رو به افزایش است. امروزه مصرف‌کنندگان به ارتباط بین غذا و سلامت اهمیت می‌دهند و غذاهای عملکردی طرفداران بسیاری در بین مصرف‌کنندگان پیدا کرده است و تولید این نوع غذاها در حال افزایش است؛ بنابراین شناسایی باکتری‌های بومی و بررسی توانایی آن‌ها از نظر خواص پروبیوتیکی، به‌منظور غربال‌گری سویه‌هایی که توانایی بالایی دارند، بسیار مهم است.

 نتایج این پژوهش نشان داد که از سه باکتری شناسایی‌شده با روش مولکولی (PCR و توالی‌یابی)، دو باکتری متعلق به سرکه سیب و یک باکتری متعلق به سرکه انگور بود. با بررسی بیشتر سرکه‌هایی که ماده اولیه و روش تولید آن‌ها متفاوت است می‌توان به ارتباط ماده اولیه و روش تولید با تعداد و تنوع باکتری‌های اسید لاکتیک، پی برد.

 جداسازی لاکتوباسیلوس برویس از سرکه تاکنون گزارش نشده است و مطالعه حاضر اولین گزارش در این رابطه است. با توجه به توانایی این لاکتوباسیل به‌عنوان یک پروبیوتیک، وجود این باکتری در سرکه‌های سنتی ایران ارزش غذایی آن‌ها را بالا می‌برد. علاوه‌بر‌این، با بهینه‌سازی شرایط رشد سویه‌های بومی می‌توان از آن‌ها برای تولید غذاهای عملگرا استفاده کرد.

تشکر و قدردانی

این مطالعه با کمک مالی دانشگاه اصفهان و طرح راهبردی شماره 97886/90 انجام شده است.



[1]- Saccharomyces cerevisiae

[2]- Acetobacter

[3]- Gluconobacter

[4]- Functional food

[5]- Lactic acid Bacteria (LAB)

[6]- Antibios

[7]- Lactobacillus spp

[8]- Bifidobactrium spp

[9]- Sigma –aldrich

[10]- Lactococcus

[11]- Nystatin

[12]- Polymerase Chain Reaction (PCR)

[13]- Freeze- thaw

[xiv]- BLAST

[xv]- Randomly Amplified Polymorphic DNA

[xvi]- Lactobacillus fermentum

[xvii]- Lactobacillus buchneri

[xviii]- Lactobacillus casei

[xix]- Lactobacillus plantarum

 

 

(1)               Hlmys M. Natural cure with apple vinegar. Tehran: Ghoghnus Pub.; 2009.

(2)               Adams MR., Moss MO. Food Microbiology: USA: Royal Society of Chemistry; 2008.

(3)               Ghasemi M. Prevention and treatment of gastrointestinal and liver diseases: Mashahd: Marandiz; 2010.

(4)               Bragg PC., Patricia Bragg N., Bragg PC. Apple Cider Vinegar Miracle Health System. California, USA: Health Science Publications, Inc.; 2003.

(5)               Contor L. Functional Food Science in Europe. Nutrition, metabolism, and cardiovascular diseases: NMCD. 2001;11 (4 Suppl):20-3.

(6)               Jeng K-C., Chen C-S., Fang Y-P., Hou RC-W., Chen Y-S. Effect of microbial fermentation on content of statin, GABA, and polyphenols in Pu-Erh tea. Journal of agricultural and food chemistry 2007; 55 (21): 8787- 92.

(7)               Wu JJ., Ma YK., Zhang FF., Chen FS. Biodiversity of yeasts, lactic acid bacteria and acetic acid bacteria in the fermentation of “Shanxi aged vinegar”, a traditional Chinese vinegar. Food microbiology 2012; 30 (1): 289- 97.

(8)               Omar NB., Ampe F., Raimbault M., Guyot J-P., Tailliez P. Molecular diversity of lactic acid bacteria from cassava sour starch (Colombia). Systematic and applied microbiology 2000; 23 (2): 285- 91.

(9)               Gardner NJ., Savard T., Obermeier P., Caldwell G., Champagne CP. Selection and characterization of mixed starter cultures for lactic acid fermentation of carrot, cabbage, beet and onion vegetable mixtures. International journal of food microbiology 2001; 64 (3): 261- 75.

(10)           Satokari RM., Vaughan EE., Smidt H., Saarela M., Mättö J., de Vos WM. Molecular approaches for the detection and identification of bifidobacteria and lactobacilli in the human gastrointestinal tract. Systematic and applied microbiology 2003; 26 (4): 572- 84.

(11)           Karahan A., Başyiğit Kılıç G., Kart A., Şanlıdere Aloğlu H., Öner Z., Aydemir S., et al. Genotypic identification of some lactic acid bacteria by amplified fragment length polymorphism analysis and investigation of their potential usage as starter culture combinations in Beyaz cheese manufacture. Journal of dairy science 2010; 93 (1): 1- 11.

(12)           Lee J-Y., Kim C-J., Kunz B. Identification of lactic acid bacteria isolated from kimchi and studies on their suitability for application as starter culture in the production of fermented sausages. Meat science 2006; 72 (3): 437- 45.

(13)           Leroy F., De Vuyst L. Lactic acid bacteria as functional starter cultures for the food fermentation industry. Trends in Food Science & Technology 2004; 15 (2): 67- 78.

(14)           Yan P-M., Xue W-T., Tan S-S., Zhang H., Chang X-H. Effect of inoculating lactic acid bacteria starter cultures on the nitrite concentration of fermenting Chinese paocai. Food Control 2008; 19 (1): 50- 5.

(15)           O'Sullivan G., Kelly P., O'Halloran S., Collins C., Collins J., Dunne C., et al. Probiotics: an emerging therapy. Current pharmaceutical design 2005; 11 (1): 3- 10.

(16)           Hörmannsperger G., Haller D. Molecular crosstalk of probiotic bacteria with the intestinal immune system: clinical relevance in the context of inflammatory bowel disease. International Journal of Medical Microbiology 2010; 300 (1): 63- 73.

(17)           Vanderpool C., Yan F., Polk DB. Mechanisms of probiotic action: implications for therapeutic applications in inflammatory bowel diseases. Inflammatory bowel diseases 2008; 14 (11): 1585- 96.

(18)           Tannock GW. Identification of lactobacilli and bifidobacteria. Current Issues in Molecular Biology 1999; 1 (1): 53- 64.

(19)           Wackett LP. Antibiosis in the environment. Environmental microbiology reports 2014; 6 (5): 532- 3.

(20)           Servin AL. Antagonistic activities of lactobacilli and bifidobacteria against microbial pathogens. FEMS microbiology reviews 2004; 28 (4): 405- 40.

(21)           Seok J-H., Park K-B., Kim Y-H., Bae M-O., Lee M-K., Oh S-H. Production and characterization of kimchi with enhanced levels of γ-aminobutyric acid. Food Science and Biotechnology 2008; 17 (5): 940-6.

(22)           Li H., Gao D., Cao Y., Xu H. A high γ-aminobutyric acid-producing Lactobacillus brevis isolated from Chinese traditionalpaocai. Annals of Microbiology 2008; 58 (4): 649- 53.

(23)           Rizzello C., Cassone A., Di Cagno R., Gobbetti M. Synthesis of angiotensin I-converting enzyme (ACE)-inhibitory peptides and γ-aminobutyric acid (GABA) during sourdough fermentation by selected lactic acid bacteria. Journal of agricultural and food chemistry 2008; 56 (16): 6936- 43.

(24)           Siragusa S., De Angelis M., Di Cagno R., Rizzello C., Coda R., Gobbetti M. Synthesis of γ-aminobutyric acid by lactic acid bacteria isolated from a variety of Italian cheeses. Applied and environmental microbiology 2007; 73 (22): 7283- 90.