شناسایی، همسانه‌سازی و بررسی ویژگی‌های ژن انتقال‌دهنده هگزوز 6 (HXT6) مخمر ساکارومیسس سرویزیه سویه بومی IBRC-M30069

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 کارشناس ارشد بیوتکنولوژی کشاورزی، دانشگاه شهید مدنی آذربایجان، تبریز، ایران

2 دانشیار بیوتکنولوژی کشاورزی، دانشگاه شهید مدنی آذربایجان، تبریز، ایران

3 دانشیار زیست‌شناسی سلولی ملکولی، دانشگاه شهید مدنی آذربایجان، تبریز، ایران

چکیده

مقدمه: مخمر ساکارومایسس سروزیه از جمله مهم‌ترین میکروارگانیسم‌ها برای تولید اتانول است که به‌دلیل کارایی بالای این موجود در جذب و تخمیر قندهای هگزوز است. این گونه مخمر دارای 20 ژن کدکننده پروتئین‌های انتقال‌دهنده هگزوز است. از میان این خانواده ژنی، هفت ژن HXT1-HXT7 نقش مهمی در فرایند تولید الکل دارند. پژوهشگران ثابت کردند که با افزایش میزان بیان این ژن‌ها سرعت تخمیر الکلی افزایش و در نتیجه آن میزان تولید اتانول افزایش می‌یابد.‏‏

مواد و روش ‏‏ها: جداسازی ژن HXT6 با پرایمرهای اختصاصی ژن از طریق PCR از ساکارومیسس سرویزیه سویه بومی IBRC-M30069 انجام شد. با انجام لیگاسیون قطعه تکثیریافته به پلاسمید pGEM-T کلون و به باکتری اشرشیا کلای ترانسفرم شد و تحلیل توالی انجام شد.

نتایج: توالی نوکلئوتیدی چارچوب بازخوانی این ژن به‌طول 1713 جفت باز است و یک پروتئین با 570 اسیدآمینه را رمز می‌کند. براساس تجزیه و تحلیل‌های نرم‌افزارهای بیوانفورماتیکی، وزن مولکولی تخمین‌زد‌ه‌شده و نقطه ایزوالکتریک پیش‌بینی‌شده پروتئین به‌ترتیب 68/62 کیلودالتون و 89/7 بود.‏

بحث و نتیجه‏ گیری: توالی پروتئینی به‌دست‌آمده شباهت زیادی با Hxt6p VL31(EGA76254.1) سویه دیگر ساکارومیسس سرویزیه موجود در NCBI دارد و از بین ژن‌های انتقال‌دهنده هگزوز، بیشترین شباهت و ارتباط را با HXT7 دارد و به نظر می‌رسد این‌ها از یک ژن اجدادی در اثر موتاسیون در طی زمان با تغییر کارکرد دومین‌شان حاصل شده‌اند.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Isolation, cloning and analysis of the hexose transporter 6 gene (HXT6) in a native strain of Saccharomyces cerevisiae IBRC-M30069

نویسندگان [English]

  • Solmaz Azizi 1
  • Alireza Tarinejad 2
  • Mohammad Pazhang 3
1 M.Sc. student of Agricultural Biotechnology, Azarbaijan Shahid Madani University, Tabriz, Iran
2 Associate Professor of Agricultural Biotechnology, Azarbaijan Shahid Madani University, Tabriz, Iran
3 Associate Professor of cell and molecular biology, Azarbaijan Shahid Madani University, Tabriz, Iran
چکیده [English]

Introduction: The Saccharomyces cerevisiae yeast is one of the most important microorganisms to produce ethanol. The S. cerevisiae has 20 genes that encode hexose transporter proteins. Among these gene families, seven genes HXT7-HXT1 have important an role in alcohol production. The researchers proved that alcohol fermentation goes up by increasing the expression of these genes which results in increasing ethanol production.

Materials and methods: In this research, isolation of HXT6 gene by specific primers via PCR technology was achieved. The amplified fragments were cloned into pGEM-T vector and transformed to Escherichia coli and sequence analysis was carried out.

Results: The nucleotide sequence of open reading frame of HXT6 gene revealed a 1713 bp long with a deduced amino acid of 570 residues. The estimated molecular mass and the predicted isoelectric point of the deduced polypeptide were 62.68 kDa and 7.89 respectively.

Discussion and conclusion: The deduced protein sequence showed a high similarity to Hxt6p VL31(EGA76254.1) sequences registered in NCBI and also the highest similarity of this gene with HXT7 ( one of the hexose transporter) was observed. This finding shows that this gene (HXT6) and also HXT7 gene resulted from one ancestor gene by mutation in their functional domain during years.

کلیدواژه‌ها [English]

  • Cloning
  • Saccharomyces cerevisiae
  • HXT6 gene
  • Recombinant plasmids

مقدمه.

بحران جهانی انرژی و این واقعیت که روزی سوخت‌های فسیلی تمام خواهد شد، از مهم‌ترین دغدغه‌های امروز بشر است. با توجه به رشد جمعیت جهان، مصرف زیاد انرژی، محدودیت منابع نفتی تأمین‌کننده انرژی و افزایش قیمت سوخت، جایگزینی یک منبع انرژی دیگر امری ضروری به شمار می‌رود. تولید اتانول از منابع ارزان‌قیمت به‌عنوان مکمل و یا حتی جایگزین سوخت‌های فسیلی، ضرورتی انکارناپذیر است. برخلاف سوخت‌های فسیلی، اتانول سوختی پاک و تجدیدپذیر است و به آن به‌عنوان یک سوخت سالم، ایمن و جایگزین توجه شده است (1 و 2).

بررسی‌ها نشان می‌دهد فراورده نهایی متابولیسم هگزوزها از جمله گلوکز، فروکتوز و مانوز در مخمر ساکارومایسس سرویزیه[1]در شرایط بی‌هوازی اتانول یا اسید لاکتیک است و اولین مرحله تنظیمی متابولیسم هگزوزها عبور آن‌ها از طریق انتشار تسهیل‌شده و وابسته به پروتئین‌های انتقال‌دهنده غشایی[2]HXT است. طبق اطلاعات موجود، خانواده انتقال‌دهنده هگزوزها در این گونه مخمر شامل پروتئین‌های Hxt1p-Hxt17p،Gal2p ، Snf3p و Rgt2p است. با افزایش فعالیت این انتقال‌دهنده‌ها، تجمع اتانول یا اسید لاکتیک در سلول‌ها بیشتر می‌شود (3). انتقال‌دهنده‌های Hxt1 تا Hxt17 در انتقال گلوکز نقش دارند، Gal2 برای انتقال گالاکتوز، Snf3 و Rgt2 به‌عنوان حسگر گلوکز عمل می‌کنند. این خانواده ژنی الگوی بیان متفاوتی دارند و تنظیم آن‌ها به‌شدت تحت ویژگی کینیتیک انتقال‌دهنده‌ها است و گلوکز اولین فاکتور کنترل‌کننده بیان است (4). HXT1- HXT7 جزو مهم‌ترین ناقلین هستند و از نظر متابولیسمی به هم شباهت دارند و با هم در ارتباط هستند (5). اثر بیان بیشینه این ژن‌ها در مخمرها مطالعه شده است و تولید اتانول را در سویه وحشی مخمر با سویه مهندسی‌شده مقایسه کردند. داده‌های به‌دست‌آمده نشان دادند که تظاهر بیش‌ازحد انتقال‌دهنده‌های هگزوز منجر به افزایش دریافت گلوکز شود. پژوهشگران نشان دادند که با تنظیم‌کردن اولین مرحله مسیر بیوسنتز گلوکز می‌توان منجر به تجمع اسیدلاکتیک شد، که افزایشی در حدود 15درصد در تولید اتانول در مقایسه با سویه وحشی مشاهده کردند (6 و 7).

Hxt6p و Hxt7p یک جفت انتقال‌دهنده هگزوز هستند. شباهت این دو پروتئین به هم خیلی زیاد است و هر دوی آن‌ها شامل 570 اسیدآمینه هستند این دو ژن پشت سر هم روی بازوی راست کروموزوم IV پایین دست HXT3 قرار دارند. شباهت بین آن‌ها 96 جفت باز قبل از کدون آغاز شروع می‌شود و حضور آن‌ها بدین صورت در اکثر استرین‌های آزمایشگاهی گزارش شده است. Hxt6p میل ترکیبی زیادی با گلوکز دارد و دارای میل ترکیبی زیاد Km=1 Mm برای گلوکز است (8- 10). بیان Hxt6p را همانند Hxt2p و Hxt4p غلظت زیاد گلوکز سرکوب می‌کند و تنها ژنی است که از بین این خانواده ژنی تنظیمات بیان آن را Snf3pکنترل می‌کند (8).

هدف این پژوهش، کلون ژن HXT6 با توالی صحیح در داخل وکتورpGEM-T و بررسی آن از نظر ترادف ژنی و آمینواسیدی است؛ همچنین ویژگی‌های فیزیکوشیمیایی توالی پروتئینی به‌دست‌آمده با استفاده از بررسی‌های اختصاصی موجود در پایگاه Swiss-Prot پیش‌بینی شد و بررسی‌های فیلوژنتیکی با سایر ژن‌های این خانواده انجام شد.

 

‏‏مواد و روش ‏ها.

مخمر ساکارومیسس سرویزیه سویه بومی IBRC-M30069 از مرکز ملی ذخایر ژنتیکی و تنوع زیستی ایران تهیه شده است. نژاد Top10 باکتری اشرشیا کلای[3]، مارکر VC 1kb DNA Ladder و آنزیم و بافر T4 DNA لیگاز شرکت ویوانتس[4]، PCR Master Mix شرکت سیناژن[5]، سیستمpGEM-T وکتور شرکت پرومگا[6]، آنتی بیوتیک آمپی‌سیلین و آغازگرهای

F:5ˊATGTCACAAGACGCTGCTAT3ˊ R:5´CAACTTTCCAGCGTTCTTGA -3'

 

 استفاده شد. محیط کشت اختصاصی[7]YPDحاوی دکستروز، پپتون و عصاره مخمر از شرکت مرک[8] تهیه شده بود.

 pGEM-T یک پلاسمید خطی با Tی منفرد آویزان انتهایی در انتهاهای 3 است که به این شکل از حلقوی‌شدن پلاسمید جلوگیری می‌کند و کارایی واکنش لیگاسیون را با فراورده تکثیری PCR تولیدشده باDNA پلیمرازهای معین مقاوم به حرارت که یک A به انتهاهای 5 آن‌ها اضافه می‌کنند افزایش می‌دهد. این وکتور، یک وکتور high-copy-number است و شامل پروموتورهای T7 و SP6RNA پلیمراز است که در طرفین ناحیه سایت‌های برشی[9] آن قرار دارند. ناحیه سایت‌های برشی آن هم در داخل ناحیه کدکننده –αپپتید آنزیم β- گالاکتوزیداز واقع شده است.

کشت مخمر ساکارومایسیس سرویزیه:پس از کشت مخمر در محیط اختصاصی YPD حاوی 10 گرم دکستروز، 20 گرم پپتون، 10 گرم عصاره مخمر و 15 گرم آگار و رشد کلونی‌ها، تک کلونی‌ها با استفاده از لوپ به محیط کشت مایع منتقل شد. سپس به‌مدت 1 شبانه‌روز در شیکر انکوباتور در دمای 30 درجه سانتی‏گراد قرار داده شد و از آن جهت استخراج DNA ژنومی استفاده شد.

جداسازی DNA: سوسپانسیون حاصل از کشت مخمرها در محیط کشت مایع YPD ابتدا توسط سانتریفیوژ rpm14000 رسوب داده شد و بر روی رسوب حاصل بافر هارجو[10] که حاوی 2% Triton X-100، 1%SDS، 100 mM NaCl، 10 mM Tris-Hcl(pH 8.0) ، 1 mM EDTA است اضافه شد (11)، تیوب‌ها دو دقیقه در داخل اتانول مطلق سرد (یا منفی 80 درجه سانتی‏گراد) و سپس در دمای 95 درجه سانتی‏گراد یک دقیقه قرار گرفتند، این مرحله تکرار و ورتکس شد. در ادامه با افزودن کلروفرم، ورتکس و سانتریفیوژ، فاز بالایی به تیوب جدید منتقل شد و بر روی آن اتانول مطلق اضافه شد و در دمای منفی 20 درجه سانتی‏گراد قرار گرفت. در نهایت، DNA مخمر با استفاده از روش‌های رسوب و خالص‌سازی اسیدنوکلئیک خالص شد و در 50-25 میکرولیتر آب مقطر استریل حل شد.

.واکنش زنجیره‌ای پلیمراز و خالص‌سازی فراورده تکثیری: ابتدا آغازگرهای مناسب به‌منظور جداسازی ژن HXT6 با استفاده از توالی موجود در NCBI با کد دسترسی (NM: 001180651.1) طراحی شد. واکنش زنجیره‌ای پلیمراز برای تکثیر ژن مورد نظر از روی DNA و اثبات حضور فیزیکی ژن در وکتور کلونینگ استفاده شد. برای تهیه 20 میکرولیتر واکنش زنجیره‌ای پلیمراز، 4 میکرولیترMaster mix ، ۲/۰ میکرولیتر آغازگر رفت، ۲/۰ میکرولیتر آغازگر برگشت و 50 نانوگرم DNA به 6/14 میکرولیتر آب مقطر استریل اضافه شد. برنامه استاندارد واکنش زنجیره‌ای پلیمراز شامل مرحله واسرشته‌سازی اولیه به‌مدت 4 دقیقه در94 درجه سانتی‏گراد و در ادامه مرحله تکثیر که شامل 35 چرخه و هر چرخه شامل 60 ثانیه دمای 94 درجه سانتی‏گراد، 50 ثانیه دمای 48 درجه سانتی‏گراد و 80 ثانیه دمای 72 درجه سانتی‏گراد و درنهایت یک مرحله پایانی شامل 10 دقیقه در دمای 72 درجه سانتی‏گراد بود. نیمی از فراورده تکثیری واکنش زنجیره‌ای پلیمراز روی ژل آگارز ۱درصد بارگذاری شدند، تا باندهای تکثیرشده، جدا و تجزیه شوند. پس از آنکه باند مورد نظر مشاهده شد، باقی‌مانده فراورده تکثیری واکنش زنجیره‌ای پلیمراز تاییدشده، خالص‌سازی و رسوب داده شد.

همسانه‌سازی در پلاسمید pGEM-T: برای اتصال دو قطعه DNA، مواد لازم برای 10 میکرولیتر واکنش لیگاسیون شامل 300-100 نانوگرم (۵/۰ میکرولیتر) پلاسمید pGEM -T، ژن HXT6 (فراورده تکثیری واکنش زنجیره‌ای پلیمراز خالص‌سازی‌شده) به نسبت 3 برابر پلاسمید (900 نانوگرم یا 5/1 میکرولیتر)، بافر×T4-DNA 2 لیگاز (5 میکرولیتر) ، 5 واحد آنزیم T4-DNA لیگاز (۵/۰ میکرولیتر) و 5/2 میکرولیتر آب مقطر استریل در تیوب استریل ۵/۰میلی‌لیتری ریخته شد و به‌مدت یک ساعت در دمای اتاق و سپس به‌مدت یک شب در دمای 4 درجه سانتی‏گراد قرار داده شدند.

.استحالهسلول‌های باکتریایی به‌روش شوک حرارتی: برای استحاله به‌روش شوک حرارتی، ابتدا سلول‌های مستعد باکتری از فریزر 70- درجه سانتی‏گراد و محصول واکنش لیگاسیون از فریزر 20- درجه سانتی‏گراد خارج شدند و به‌مدت 15 دقیقه روی یخ قرار گرفتند، سپس نصف محصول واکنش لیگاسیون (5 میکرولیتر) به 50 میکرولیتر سلول مستعد اشرشیا کلای اضافه شد و به‌آرامی مخلوط شدند و به‌مدت 45 دقیقه روی یخ قرار داده شدند. سپس نمونه‌ها 42 ثانیه در دمای 42 درجه سانتی‏گراد قرارگرفتند و به‌سرعت 2 دقیقه به روی یخ منتقل شدند. در ادامه 850 میکرولیتر محیط کشت LBی مایع بدون آنتی‌بیوتیک به نمونه‌ها اضافه شد و به‌مدت یک ساعت با سرعتrpm 180در دمای 37 درجه سانتی‏گراد در انکوباتور شیکردار قرارگرفتند. درنهایت حدود 20-200 میکرولیتر از سلول‌های باکتریایی ترانسفورم شد و روی محیط LBی جامد حاوی آنتی‌بیوتیک مناسب وX-Gal (5برمو-4کلرو-3ایندول-β-D–گالاکتوپیرانوزید) [11] و IPTG (ایزوپروپیلβ-1-D-تیوگالاکتوپیرانوز) [12] کشت شدند و به‌مدت یک شب در انکوباتور با دمای 37 درجه سانتی‏گراد قرار داده شدند. سپس کلونی‌های سفیدرنگ با انجام واکنش زنجیره‌ای پلیمراز روی آن‌ها تایید شدند و با استفاده از روش استخراج پلاسمید که بیرنبویم و دالی[13] پیشنهاد کردند، استخراج پلاسمید شدند (12). با انجام واکنش زنجیره‌ای پلیمراز دیگری روی پلاسمیدهای استخراج‌شده و تایید آن‌ها، برای توالی‌یابی به مرکز توالی‌یابی کره‌جنوبی (شرکت ماکروژن) [14] ارسال شدند.

بررسی توالی: ویژگی‌های فیزیکوشیمیایی پروتئین به‌دست‌آمده با استفاده از برنامه‌هایProtParam و ProtScale و ساختار دوم پروتئین به‌وسیله برنامه PSIpred تعیین شد. توالی اسیدآمینه‌ای به‌دست‌آمده به‌منظور یافتن پروتئین‌های مشابه در بانک‌های اطلاعاتی با استفاده از برنامه بلاست[15] مرکز ملی اطلاعات بیوتکنولوژی آمریکا (NCBI) جستجو شد و تعدادی توالی پروتئینی از سویه‌های دیگر مخمر ساکارومایسس سرویزیه که بیشترین شباهت را با توالی مد نظر داشتند، انتخاب شدند و برای هم‌ردیف‌سازی چندگانه استفاده شدند. همچنین بررسی فیلوژنتیکی با استفاده از انواع مختلف Hxt6p و انواع ژن‌های HXT با استفاده از نرم‌افزار مگا4 [16] انجام شد. توالی‏های پروتئینی از سویه‌های دیگر مخمر ساکارومایسس سرویزیه که برای تهیه هم‌ردیف‌سازی چندگانه استفاده شدند به‌همراه شماره دستیابی در جدول 1 ذکر شده‌اند.

 

نتایج.

تکثیر DNA ژن HXT6: پس از استخراج DNA ژنومی، ژن HXT6 با استفاده از آغازگرهای طراحی‌شده در دستگاهPCR تکثیر شد. محصول PCR یک باند 1713 جفت بازی روی ژل آگارز بود که با ژن HXT6 موجود در بانک اطلاعاتی NCBI مطابقت داشت (شکل 1).

 

شکل 1- الکتروفورز محصول PCR حاصل از تکثیر DNAی ژن HXT6با آغازگرهای اختصاصی طراحی‌شده، باند 1713 جفت بازی که با اندازه مورد انتظار مطابقت داشت. 1 ، 2، 3 و 4 چهار تکرار مستقل هستند.:M(Kb) مارکر kb1.

 

جدول 1- میزان یکسانی و شباهت توالی اسیدآمینه‌ای Hxt6p با سایر توالی‌های اسیدآمینه‌ای سویه‌های دیگر مخمر ساکارومیسس سرویزیه استفاده‌شده در تهیه هم‌ردیف‌سازی مقایسه‌ای و ساخت درخت فیلوژنتیکی.

درصد یکسانی

درصد تشابه

نام سویه

نام اختصاصی ژن

شماره دستیابی

100

99

S.c ROO8

Hxt6p

EWG86690.1

100

99

P301 S.c

Hxt6p

EWG92005.1

100

99

S.c S288c

Hxt6p

NP 010630.1

100

99

YJM993 S.c

Hxt6p

AHY75315.1

100

99

S.c P283

Hxt6p

EWH19042.1

100

99

S. c EC118

Hxt6p

CAY78843.1

100

99

S. c EC118

Hxt7p

CAY78842.1

100

99

S.c S288c

Hxt7p

NP 010629.3

100

99

S.c R103

Hxt6p

EWG96635.1

83

99

S.c VL3

Hxt6p

EGA76254.1

100

83

S. c S288c

Hxt4p

NP 011960.2

99

73

S. c S288c

Gal2p

NP 013182.1

98

72

S. c S288c

Hxt9p

NP 012316. 1

98

71

S. c S288c

Hxt11p

NP 014486.1

98

76

S. c S288c

Hxt3p

NP 010632.1

 

 


.همسانه‌سازی DNA تکثیرشده در پلاسمید pGEM-T: DNA تکثیرشده از واکنش PCR برای ژن HXT6پس از خالص‌سازی از روی باقی‌مانده محصول PCR در وکتور pGEM-T کلون شد. در این وکتور غیرفعال‌شدن –αپپتید با واردشدن DNA الحاقی، اجازه شناسایی نوترکیب‌ها (کلونی‌های سفید) را از طریق غربا لگری سفید-آبی می‌دهد با استناد به این ویژگی پلاسمید، تعدادی از کلونی‌های نوترکیب (سفید) انتخاب شد و درستی واکنش لیگاسیون با PCR روی آن کلونی‏ها تایید شد (شکل 2).

.مراحل تایید کلونی‌ها برای حضور ژن پس از استحالهاشرشیا کلای با پلاسمید pGEM-T+ HXT6: با توجه به اینکه توالی‌یابی قطعه DNA کلون‌شده برای ژن HXT6 هنوز مشخص نشده بود، بنابراین تعدادی از کلونی‌های رشدکرده پس از واکنش استحاله با پلاسمید pGEM-T+ HXT6 برای تایید وجود قطعه کلون‌شده در سه مرحله آزمایش شدند. بدین ترتیب که ابتدا کلونی‌های انتخاب‌شده به‌روش PCR و با استفاده از جفت آغازگر اختصاصی استفاده‌شده در کلونینگ، ارزیابی شدند (شکل 2). در مرحله دوم، تعدادی از کلونی‌هایی که در PCR مثبت بودند) باند مورد نظر را نشان دادند) برای استخراج پلاسمید انتخاب شدند. پس از استخراج پلاسمید PCR دیگری روی DNA پلاسمید استخراج‌شده با استفاده از جفت آغازگر اختصاصی استفاده‌شده در کلونینگ انجام شد (شکل 3).

 

 

 

شکل 2- تصویر الکتروفورز محصول PCR حاصل از بررسی تعدادی از کلونی‌های نوترکیب رشدکرده روی محیط انتخابی پس از استحاله با محصول لیگاسیون با استفاده از جفت آغازگر اختصاصی ژن HXT6، مشاهده باند bp1713 حضور فیزیکی قطعه کلون‌شده در برخی کلونی‌ها را تایید می‌کند. 1، 2، 3 و4 چهار تکرار مستقل هستند. :M(Kb) مارکر. C+: کنترل مثبت. C-: کنترل منفی.

 

شکل 3- تصویر الکتروفورز محصول PCR حاصل از بررسی تعدادی از پلاسمیدهای نوترکیب استخراج‌شده، با استفاده از جفت آغازگر اختصاصی ژن HXT6، مشاهده باند bp1713 حضور فیزیکی قطعه کلون‌شده در کلونی‌ها را تایید می‌کند. 1، 2، 3 و4 چهار تکرار مستقل هستند. M(Kb) مارکر. C-: کنترل منفی.

 

نتایج توالی‌یابی با دو پرایمر T7 و SP6 برای ژن HXT6بر روی وکتورpGEM-T نشان‌دهنده این بود که موقعیت قرارگیری آن روی سایت برشی اختصاصی وکتور در جهت معمولی است و کدون آغاز ATG در سمت T7 قرار دارد و یک پروتئین با 570 اسیدآمینه را رمز می‏کند. بررسی ویژگی‌های فیزیکوشیمیایی پروتئین به‌دست‌آمده براساس تجزیه و تحلیل‌های نرم‌افزارهای بیوانفورماتیکی و با استفاده از برنامه ProtParam نشان داد که وزن مولکولی محاسبه‌شده و نقطه ایزوالکتریک پش‏بینی‌شده پروتئین Hxt6p با فرمول مولکولی C2880H4430N712O791S31، به‌ترتیب برابر 68/62 کیلودالتون و 89/7 است و شاخص ناپایداری آن در لوله آزمایش در حدود 04/37 است که در رسته پروتئین‌های پایدار تقسیم‌بندی می‌شود. همچنین شاخص Aliphatic (به‌عنوان یک عامل مهم به‌منظور برآورد مقاومت پروتئین‌ها در برابر حرارت) و نیمه‌عمر این پروتئین در محیط درون‌شیشه‌ای به‌وسیله برنامه ProtParam محاسبه شد که به‌ترتیب 93/95 و در حدود 20 ساعت بود؛ این مقدار بیانگر پایداری و مقاوم‌بودن پروتئین در برابر حرارت است (13) و از کل اسیدهای آمینه،44 اسیدآمینه با بار منفی (Asp+Glu) دارد، درحالی‌که تعداد کل اسیدهای آمینه با بار مثبت آن (Arg+Lys) برابر 46 است.

بررسی ساختار دوم پروتئین Hxt6p با استفاده از PSIpred نشان داد که این پروتئین حاوی 8 رشته بتا و 24 مارپیچ آلفا است (شکل 4).

 

 

 

شکل 4- ساختار دوبعدی Hxt6p با استفاده از برنامه .PSIpred

 

 توالی پروتئینی به‌دست‌آمده از Hxt6p با سایر Hxt6p از سویه‌های دیگر مخمر ساکارومیسس سرویزیه که بیشترین شباهت را داشتند انتخاب شدند و با استفاده از برنامه Multialinge مقایسه شدند (جدول 1) و مشاهده شد که پروتئین به‌دست‌آمده با سویه‌های ROO8 S. c و P301 S. c هیچ تفاوتی از نظر توالی اسیدآمینه‌ای ندارد و با سویه‌هایS. c P283 و S. c S288c در اسیدآمینه 448(Ala/Pro) متفاوت است. همچنین با سویه‌های S. c EC1118 وS. c R103 در 2 اسیدآمینه تفاوت دارد و با Hxt7p از مخمر ساکارومیسس سرویزیه سویه S. c S288c و سویه S. c EC1118 به‌ترتیب در دو و سه اسیدآمینه تفاوت دارد (شکل 5). درخت فیلوژنتیکی نیز که با استفاده از نرم‌افزار مگا4 رسم شده است نشان می‌دهد پروتئین بررسی‌شده ارتباط بسیار نزدیکی با سایر پروتئین‌های همتای خود در سویه‌های دیگر مخمر ساکارومیسس سرویزیه موجود در NCBI دارد (شکل 6).

 

 

 

شکل 5- هم‌ردیفی مقایسه‌ای توالی اسیدآمینه‌ای HXT6 کلون‌شده در وکتور pGEM-T با توالی اسیدآمینه‌ای سایر HXTهای سویه‌های دیگر مخمر ساکارومیسس سرویزیه موجود در NCBI با استفاده از برنامه Multialign. ردیف آخر توالی‌های توافق‌شده را پس از مقایسه نشان می‌دهد.

شکل 6- درخت فیلوژنتیکی به‌روش Neighbor joining، توالی اسیدآمینه‌ای Hxt6p مخمر ساکارومیسس سرویزیه سویه IBRC-M30069 با سایر ژن‌های همتای خود در سویه‌های دیگر ساکارومیسس سرویزیه موجود در بانک اطلاعاتی NCBI با استفاده از نرم‌افزار مگا4 رسم شد کد دسترسی هر پروتئین در داخل پرانتز آورده شده است.

 

شکل 7- درخت فیلوژنتیکی به‌روش Neighbor joining، توالی نوکلئوتیدی ژن HXT6 مخمر ساکارومیسس سرویزیه سویه IBRC-M30069 با سایر ژن‌های انتقال‌دهنده هگزوز مخمر ساکارومیسس سرویزیه موجود در بانک اطلاعاتی NCBI با استفاده از نرم‌افزار مگا4 رسم شد. کد دسترسی هر ژن داخل پرانتز آورده شده است.


همچنین به‌منظور آشکارسازی و کشف روابط خویشاوندی آنالیز کلاستر توالی نوکلئوتیدی ژن HXT6 از مخمر ساکارومیسس سرویزیه IBRC-M30069 با سایر ژن‌های خانواده انتقال‌دهنده‌های هگزوز انجام شد. براین‌اساس مشخص شد ژن HXT6توالی‌یابی‌شده بیشترین شباهت و نزدیکی را با ژن‌های Hxt6pسویهVL31(EGA76254.1) و HXT7 سویه EC1118دارد و کمترین تشابه را با حسگرهای گلوکز یعنی SNF3 و RGT2دارد (شکل 7). همچنین نتایج بلاست در سطح پروتئینی نشان داد پروتئین بررسی‌شده با Hxt4p،Hxt3p ،Gal2p ، Hxt9p وHxt11p به‌ترتیب شباهت 83درصد (یکسانی 100درصد)، 76درصد (یکسانی 98درصد)، 73درصد (یکسانی 99درصد)، 72درصد (یکسانی 98درصد)، 71درصد (یکسانی 98درصد) دارد (جدول 1).

 

بحث و نتیجه ‏‏گیری.

بارها این خانواده ژنی روی پلاسمیدهای مختلف کلون‌شده و افزایش تولید اتانول در سویه مهندسی‌شده در مقایسه با سویه وحشی مخمر مشاهده شده است. به‌طور مثال روسی[xvii] و همکاران از بین انتقال‌دهنده هگزوز ساکارومیسس سرویزیه HXT7 و HXT1را کلون و افزایش تولید اتانول را در سویه مهندسی‌شده مشاهده کردند. در سال 2012 نیزHXT7، HXT1 و GXS1، GXF1 (انتقال‌دهنده زایلوز) از کاندیدا اینترمدیا[xviii] را به پلاسمید pUPG1 کلون کردند. درنهایت به مخمر MT8-1/XkdXI انتقال دادند و نتیجه کارشان را با پلاسمید کنترل مقایسه کردند. آن‌ها افزایش تولید اتانول را با تقویت برداشت گلوکز و زایلوز مشاهده کردند. این نتایج آشکارا نشان می‌دهند که افزایش بیان انتقال‌دهنده‌ها در مخمر می‌تواند توانایی تولید اتانول را به‌وسیله تسهیل مصرف گلوکز بهبود بخشد (14). در ایران نیز ژن HXT2 از طریق بهینه‌سازی PCR از ساکارومایسس سرویزیه IBRC-M30069 جدا و در پلاسمید pTZ57R/T کلون شد. این ژن با شماره دسترسی JQ 323554.1 در بانک جهانی ژن ثبت شده است (15).

 توالی ژن HXT6 ابتدا در وکتور پایه pGEM-T کلون شد تا محدوده استفاده ازآنزیم‌های برشی برای کلونینگ افزایش یابد. برای بیان این ژن نیاز به یک پروموتور قوی نظیر پروموتور[xix]ADH و پروموتور [xx]GAPDH است؛ این پروموتورها باعث افزایش میزان جذب قندهای هگزوز توسط سلول‌های مخمر می‌شود و درنهایت میزان تولید الکل طی فرایند تخمیری را افزایش می‌دهند .

 براساس آنالیزهای مختلف بیوانفورماتیکی (هم‌ردیفی مقایسه‌ای، بلاست، درخت فیلوژنتیکی) مشخص شد این پروتئین شباهت زیادی با Hxt6p ساکارومیسس سرویزیه سویه‌های دیگر ثبت‌شده در NCBI دارد و این نشان می‌دهد Hxt6p در اکثر سویه‌های ساکارومیسس سرویزیه حفظ شده است. همچنین بررسی‌های فیلوژنتیکی HXT6 با سایر خانواده انتقال‌دهنده‌های هگزوز نشان از تشابه و ارتباط نزدیک HXT6 با این خانواده ژنی است و از بین آن‌ها بیشترین تشابه را با HXT7دارد. این مطالعه راهی برای پیشرفت تولید پلاسمیدهای نوترکیب و بیان این ژن برای مطالعه آینده است. در این پژوهش با استفاده از روش مهندسی ژنتیک ژن HXT6 جداسازی و کلون شد. امید است با بررسی بیشتر روی این ژن و سایر ژن‌های این خانواده احتمالاً در آینده مخمر نوترکیب به‌منظور افزایش راندمان تولید الکل طی تخمیر ساکارومیسس سرویزیه تهیه شود.



[1]- Saccharomyces cerevisiae

[2]- Hexose Transporter

[3]- Escherichia coli

[4]- Vivantis

[5]- Cinnagen

[6]- Promega

[7]- Yeast Extra Pepton Dextrose

[8]- Meark

[9]- Multiple Cloning Region

[10]- Harju

[11]-5-bromo-4-chloro-3-indolylβ-D-galactopyranoside

[12]- Iopropyl β-D-1-thiogalactopyranoside

[13]- Birnboim and. Doly

[14]- Macrogen korea

[15]- Pblast

[16]- MEGA4

[xvii]- Rossi

[xviii]- Condida intermedia

[xix]- Alcohol dehydrogenase

[xx]- Glyceraldehyde-3-phosphate dehydrogenase

(1)               Mohseni M., Ebrahimi H. Isolation, identification and optimization of ethanol producing bacteria from Saccharomyces-based fermentation process of alcohol industries in Iran. Biological Journal of Microorganism 2013; 2 (7): 15- 28.

(2)               Ahi M., Azin M., Shojaosadati SA., Vasheghani Farahani E., Nosrati M. Optimization of media for bioethanol production by Pichia stipitis from sugarcane bagasse pretreated by dilute acid. Biological Journal of Microorganism 2014; 3 (9): 11- 20.

(3)               Guillaume C., Delobel P., Sablayrolles JM., Blondin B. Molecular basis of Fructose utilization by the wine yeast Saccharomyces cerevisiae: a Mutated HXT3 allele enhances fructose fermentation. Applied and environmental Microbiology 2007; 73 (8): 2432- 39.

(4)               Ozcan S., Johnston M. Function and regulation of yeast hexose transporters. Microbiology and Molecular Biology Reviews 1999; 63 (3): 554- 69.

(5)               Perez M., Luyten K., Michel R., Riou CH., Blondin B. Analysis of Saccharomyces cerevisiae hexose carrier expression during wine fermentation: both low- and high-affinity Hxt transporters are expressed. Federation of European Microbiological Societies Yeast Research 2005; 5 (4): 351- 361.

(6)               Gutierrez-Lomeli M., Torres-Guzman JC., Gonzalez-Hernandez GA., Cira-Chavez LA., Pelayo-Ortiz C., Ramirez-Cordova Jde J. Overexpression of ADH1 and HXT1 genes in the yeast Saccharomyces cerevisiae improves the fermentative efficiency during tequila elaboration. Journal of Business. 2008; 93 (4): 363- 71.

(7)               Rossi G., Sauer M., Porro D., Branduardi P. Effect of HXT1 and HXT7 hexose transporter over expression on wild-type and lactic acid producing Saccharomyces cerevisiae cells. Microbial Cell Factories 2010; 9 (1): 1- 10.

(8)               Liang H., Gaber RF. A novel signal transduction pathway in Saccaharomyces cerevisiae defined by SNF3- regulated expression of HXT6. Molecular Biology of the Cell 1996; 7 (12): 1953- 66.

(9)               Reifenberger E., Boles E., Ciriacy M. Kineticcharacterization of individual hexose transporters of Saccaharomyces cerevisiae and their relation to the triggering mechanisms of glucose repression. European Journal of Biochemistry 1997; 245 (2): 324- 333.

(10)           Reifenberger E., Freidel K., Ciriacy M. Identification of novel HXT genes in Saccaharomyces cerevisiae reveals the impact of individual hexose transporters on glycolytic flux. Molecular Microbiology 1995; 16 (1): 157- 67.

(11)           Harju S., Fedosyuk H., Peterson KR. Rapid isolation of yeast genomic DNA: Bust n' Gab. Bio Med Central Biotechnology 2004; 21 (4): 4- 8.

(12)           Birnboim HC. Doly J. A rapid alkaline procedure for screening recombinant plasmid DNA. Nucleic Acids Research. 1979; 7 (6): 1513–1523.

(13)           Gasteiger E., Hoogland C., Gattiker A., Duvaud S., Wilkins MR., Appel RD., Bairoch A. Protein identification and analysis tools on the ExPASy server. In: John M., Walker, editor. The proteomics protocols handbook. Totowa, NJ: Humana Press. 2005: 571- 607

(14)           Takanori T., Tomonori I., Chiaki O., Naoto O., Takayuki O., Akihiko K. Sugar consumption and ethanol fermentation by transporter-overexpressed xylose-metabolizing Saccharomyces cerevisiae harboring a xyloseisomerase pathway. Journal of Bioscience and Bioengineering 2012; 114 (2): 209- 11.

(15)           Amiri S., Tarinejad A., Sharifi Sirchi Gh. Cloning and DNA sequence analysis of the glucose transporter gene2 from Iranian Saccharomyces cerevisiae. Koomesh 2011; 14 (2):138- 43.