جداسازی و بهینه‏ سازی تولید آنزیم پکتیناز یک آنزیم مفید صنعتی از قارچ‏ های آسپرژیلوس نایجر، ریزوپوس اوریزه و پنی‏سیلیوم کریزوژنوم

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 دانشجوی کارشناسی ارشد بیوتکنولوژی میکروبی، دانشگاه اصفهان، ایران

2 دانشیار بیوتکنولوژی میکروبی، دانشگاه اصفهان، ایران

چکیده

مقدمه: آنزیم پکتیناز یکی از مهم‏ترین آنزیم‏های صنعتی جهان محسوب می‏شود که از طیف وسیعی از میکروارگانیسم‏ها مانند باکتری‏ها و قارچ‏های رشته‏ای جداسازی می‏شود. این آنزیم استفاده‏های زیادی در صنایع آبمیوه‏سازی، نساجی و غیره دارد. در این پژوهش، جداسازی و بهینه‏سازی قارچ‏های تولید کننده آنزیم پکتیناز از میوه‏های پوسیده سیب و پرتقال بررسی شد.

مواد و روش ‏‏ها: جداسازی قارچ‏های تولید کننده آنزیم پکتیناز با استفاده از محیط کشت پکتین‏دار و با رنگ آمیزی لگول انجام شد. 3 گونه از بهترین سویه‏ها توسط روش مولکولی توالی ITS1,4 شناسایی شد و بهینه‏سازی تولید آنزیم از این قارچ توسط طرح فاکتوریل در حضور 5 متغیر با 3 سطح در نظر گرفته شد. این 5 متغیر شامل منابع کربنی (آب پنیر، گلوکز و استویا) به همراه سولفات آمونیوم، سولفات منگنز، دما و اسیدیته) در 3 آزمایش جداگانه انجام شد. اندازه‏گیری غلظت آنزیم پکتیناز با روش کلوریمتریک (میلر) انجام شد.

نتایج: نتایج نشان داد که شرایط بهینه تولید آنزیم توسط 3 سویه برتر به نام آسپرژیلوس نایجر، پنی‏سیلیوم کریزوژنوم و ریزوپوس اوریزه در دمای 32 درجه، اسیدیته 6، غلظت 3 گرم بر لیتر سولفات منگنز، 75/ 2 گرم بر لیتر از سولفات آمونیوم و غلظت 10 گرم بر لیتر منابع کربن آب پنیر، استویا و گلوکز است‏. بالاترین میزان تولید آنزیم در شرایط یاد شده در حضور گلوکز با میزان 328/1میلی‏گرم بر میلی‏لیتر برای آسپرژیلوس نایجر و 284/1 و 039/1 میلی‏گرم بر میلی‏لیتر در حضور آب پنیر برای ریزوپوس اوریزه و پنی‏سیلیوم کریزوژنوم مشاهده شد. وزن مولکولی این آنزیم مطابق روش SDS-Page 40 و 37 کیلودالتون به‏دست آمد.

بحث و نتیجه‏ گیری: نتایج پژوهش حاضر نشان داد که 3 سویه قادر به تولید آنزیم در حضور منابع مختلف کربن و دامنه وسیعی از اسیدیته و دماست. همچنین، نتایج پژوهش نشان داد که این سویه‏ ها کاندید مناسبی برای کاربرد در صنعت می‏ باشند‏.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Isolation and optimization of pectinase enzyme production one of useful industrial enzyme in Aspergillus niger, Rhizopus oryzae, Penicilium chrysogenum

نویسندگان [English]

  • Akram Songol 1
  • Mandana Behbahani 2
1 M.Sc. of Biotechnology, Isfahan university, Isfahan, Iran
2 Associate professor of Biotechnology, Isfahan university, Isfahan, Iran
چکیده [English]

Introduction: Pectinase enzyme is one of the most important industrial enzymes which isolated from a wide variety of microorganisms such as bacteria and filamentous fungi. This enzyme has been usually used in the fruit and textile industry. In this study, the isolation and optimization of pectinase-producing fungi on decaying rotten fruits were studied.

Materials and methods: Isolation and screening of pectinase producing fungi performed through plate culture on pectin medium and staining with Lugol's iodine solution. The best strains were identified by ITS1, 4 sequencing as Aspergillus fumigatus, Rhizopus oryzae, Penicilium chrysogenum. The enzyme production was optimized by application of the five factorial design, each at three levels. These factors are carbon sources (whey, glucose and stevia), ammonium sulfate, manganese sulfate, temperature, and pH. Pectinase concentration was measured by the Miller method.

Results: The results indicate that optimum condition for enzyme production for three fungi strains was obtained at 32 °C, pH = 6, 3g / L manganese sulfate, 2.75g / L of ammonium sulfate and 10g / L of each carbon source. The best experiment in obtaining the optimum enzyme contained 1.328 mg / ml of glucose for Aspergillus niger 1.284 and 1.039 mg / ml of whey for Rhizopus oryzae and Penicilium chrysogenum. Molecular weight of enzyme was about 40 and 37 kDa which was obtained by SDS- PAGE.

Discussion and conclusion: The results indicate that three strains could grow in a wide range of carbon source, pH and temperature, which could be a good candidate for industrial application.

کلیدواژه‌ها [English]

  • Pectinase Enzyme
  • Aspergillus fumigatus
  • Rhizopus oryzae
  • Penicilium chrysogenum
  • Optimization
  • Factorial design method

مقدمه.

آنزیم‏ها بیوکاتالیست‏هایی هستند که توسط سلول‏های زنده سنتز می‏شوند. آنزیم‏ها سرعت واکنش‏های شیمیایی را افزایش می‏دهند. بسیاری از باکتری‏ها، قارچ‏ها و گیاهان عالی توانایی تولید آنزیم پکتیناز را دارند (1). آنزیم پکتیناز یک آنزیم پکتینولیتیک است که ماده پکتین را که یک سوبسترای پلی ساکاریدی است‏، در دیواره سلولی گیاهان می‏شکند. پکتین نخستین بار توسط هنری براکونوت در سال 1825 جداسازی و شرح داده شد. آنزیم پکتیناز نخستین‏ بار در سال 1930 با آزمایش‏های بسیاری که در فرآیند تولید آبمیوه انجام شد، کشف شد. در واقع نخستین بار از آنزیم پکتیناز استخراج شده از قارچ‏ها، برای شفافیت و کیفیت بهتر آبمیوه‏ها در صنعت استفاده شد (2). پکتیناز کاربردهای بسیاری از قبیل موارد زیر دارد: استخراج آبمیوه، استخراج روغن، تیمار کردن ضایعات آبی، غذای دام، بهبود در رنگ و پایداری شراب‏های قرمز، خالص‏سازی ویروس‏های گیاهی، استفاده در صنعت کاغذ‏سازی، تخمیر چای و قهوه، خیساندن و نرم کردن فیبرهای گیاهی، بدون صمغ کردن فیبرهای گیاهی و پاک کردن زیستی فیبرهای پنبه در فرآیندهای نساجی (3).

یکی از مهم‏ترین انواع آنزیم پکتیناز که استفاده گسترده‏ای نیز در صنعت دارد پلی‏گالاکتوروناز است‏.آنزیم‏های پلی گالاکتورونیک اسید دپلیمریزه شده به 2 نوع پلی‏گالاکتوروناز‏های هیدرولیز‏کننده و پلی‏گالاکتورونات لیاز‏ها طبقه‏بندی می‏شود. با گسترش استفاده از پکتیناز دانشمندان در صدد بهینه کردن تولید این آنزیم برآمدند (4). آن‏ها برای بهینه‏سازی، شرایط محیط کشت را بهبود می‏بخشیدند و یا از سویه‏های قارچی استفاده می‏کردند که بیش‏ترین مقدار تولید را داشته باشد که آسپرژیلوسها چنین ویژگی‏هایی دارند. دانشمندان قارچ‏ها را بر روی محیط کشت‏های ویژه قارچ کشت داده و با اضافه کردن مواد حاوی پکتین به محیط تولید آنزیم را القا می‏کردند و سپس، آنزیم تولید شده را توسط رسوب دادن و یا فیلتراسیون جدا‏سازی می‏کردند. امروزه برای اندازه‏گیری مقدار و فعالیت آنزیم از معرف‏ها استفاده می‏کنند و با تغییرات در شرایط فیزیکی و شیمیایی کشت قارچ، بهترین امکان را برای تولید زیاد آن فراهم می‏کنند (5). در پژوهش حاضر، 7 سویه از میوه‏های در حال پوسیدن سیب و پرتقال جداسازی شد که پس از یک غربال‏گری از نظر رشدی و تولید آنزیم پکتیناز 3 سویه که بهترین عملکرد را داشتن جداسازی شد (6). بیشتر قارچ‏های رشته‏ای مانندگونه‏های آسپرژیلوس، پنیسیلیوم و ریزوپوس که در پژوهش حاضر بررسی شده‏اند توانایی تولید این نوع آنزیم را دارند. این 3 گونه قارچی از گونه‏هایی هستند که به فراوانی در طبیعت یافت می‏شوند. این 3 گونه از قارچ‏های اصلی آلوده کننده مواد غذایی و محصولات کشاورزی هستند که از علت‏های آن توانایی آن‏ها در ترشح آنزیم پکتیناز است‏. هدف از پژوهش حاضر، پیدا کردن سویه‏ای است که آنزیمی با دامنه تحملی بالا در ‏اسیدیته‏هایمختلف، دماهای بالا و منابع کربنی مختلف را تولید کند.

 

‏‏مواد و روش‏ها.

.جداسازی نمونه‏های قارچی از میوه‏ و سبزیجات پوسیده: مقداری میوه‏جات از قبیل سیب و پرتقال پوسیده از مناطق اصفهان و جنوب کشور (از زمین‏های کشاورزی و سوپر میوه) جمع‏آوری شد. سپس، رقیق‏سازی نمونه‏ها در محیط حاوی PBS انجام و رقت‏های مختلف 5، 10، 20 و 30 میلی‏لیتری از محلول PBS روی محیط کشت دکستروز آگار سیب زمینی رشد داده شد.

به منظور جداسازی سویه‏های تولید‏کننده آنزیم پکتیناز از سایر سویه‏ها از یک محیط اختصاصی جامد پکتین‏دار (پکتین 10گرم، فسفات پتاسیم 1گرم، سدیم نیترات 2گرم، پتاسیم کلراید 5/0گرم، منزیم سولفات 7 آبه 5/0گرم، سولفات آهن 7 آبه 01/0گرم، آگار 20 گرم، پپتون 3گرم، سولفات آمونیوم 2گرم، سولفات منگنز 01/0گرم، قند 3گرم، عصاره مخمر 2گرم، سولفات مس 5 آبه 001/0گرم و اسیدیته 6- 7‏)استفاده شد.

محیط کشت در دمای 110 درجه سانتی‏گراد به مدت 10 دقیقه در اتوکلاو استریل شد. سپس، تلقیح نمونه‏ها بر روی محیط کشت و انکوباسیون در 30 درجه سانتی‏گراد برای 5 روز انجام شد. پس از 7 روز انکوباسیون پلیت‏ها با رنگ لگول (پتاسیم یدید یدین) به منظور شناسایی سویه‏های تولید‏کننده آنزیم پکتیناز رنگ‏آمیزی شد. اگر هاله بنفش تیره اطراف کلونی مشاهده شود نشان‏دهنده وجود آنزیم پکتیناز در این سویه‏هاست‏.

ریخت‏شناسی قارچ‏های تولید‏‏کننده آنزیم پکتیناز: با توجه به ویژگی‏های ریخت‏شناختی، قارچ‏ها را می‏توان بر اساس شکل، حضور یا غیاب اسپورهای جنسی، ترتیب کنیدی‏ها، ساختار‏های تناسلی و تولید مثلی و ویژگی‏های هیفی شناسایی کرد. برای ریخت‏شناسی گونه‏های قارچی از محیط کشت‏های اختصاصی MEA[1] و CYA[2] به همراه کلید شناسایی پیت و هاکینگ [3] (رنگ‏آمیزی سویه و مشاهده آن زیر میکروسکوپ) استفاده شد (5).

شناسایی مولکولی سویه‏ها با استفاده از توالی ITS rDNA: در این روش ابتدا DNA قارچ مورد نظر با استفاده از کیت خریداری شده از شرکت سیناژن استخراج شد و با استفاده از پرایمر‏های مربوط به ناحیه ریبوزومی
 ITS rDNA (ITS1 به عنوان پرایمر رفت با توالی 5TCCGTAGGTGAACCTGCGG3 و ITS4 به‏عنوان پرایمر برگشت با توالی 5TCCTCCGCTTATTGATATGC3 )تکثیر شد.

سپس، ژن مربوطه را PCR کرده و سپس الکتروفورز شد و در صورت مثبت بودن و عدم آلودگی DNA قارچ، قطعه مورد نظر تعیین توالی شده و نتیجه حاصل در سایت NCBI، BLAST شد.

بررسی میزان رشد و شمارش میکروارگانیسم‏ها: برای بررسی میزان رشد میکروارگانیسم‏ها در حین فرآیند تولید آنزیم از روش‏های اسپکتروفتومتری و همچنین، اندازه‏گیری قطر کلونی قارچ‏ها استفاده شد. سپس، دوره زمانی که قارچ‏ها بالاترین میزان رشد را دارند مشخص شد (6).

در ابتدا از لام نئوبار برای شمارش اسپورهای تلقیحی قارچ‏ها استفاده شد. تعداد اسپور‏هایی که برای تلقیح پس از 5 روز به کار برده شد به طور تقریبی حدود130 اسپور بر میلی‏لیتر در نظر گرفته شد.

.عامل‏های مورد بررسی برای‏ بهینه‏سازی تولید آنزیم عبارتند از: دما (5 و60 درجه سانتی‏گراد)، ‏اسیدیته (3 و 9)، منبع کربنی (گلوکز، آب پنیر و استویا[4])، سولفات آمونیوم (5/0 و 5 گرم بر لیتر) و سولفات منگنز (1 و 5 گرم بر لیتر) که اثر منفرد و متقابل آن‏‏ها بر تولید آنزیم پکتیناز بررسی شد. علت به‏کارگیری این عامل‏ها تاثیر چشمگیر‏ آن‏ها بر تولید آنزیم پکتیناز در مطالعات قبلی بوده است.

استخراج آنزیم پکتیناز: برای‏ استخراج آنزیم از سویه‏های قارچی تولید کننده محیط کشت مایع تهیه شد. محیط کشت مایع پکتین‏دار برای‏ استخراج آنزیم حاوی: پکتین 10گرم، فسفات پتاسیم 1گرم، سدیم نیترات 2گرم، پتاسیم کلراید 5/0گرم، منزیم سولفات 7 آبه 5/0گرم، سولفات آهن 7 آبه 01/0گرم، آگار 20 گرم، سولفات آمونیوم 2گرم، سولفات منگنز 01/0گرم، سولفات مس 5 آبه 001/0گرم، عصاره مخمر 1/0گرم، پپتون 2/0گرم و قند 1گرم در 100 میلی‏‏لیتر است‏ (7). پس از 7 روز انکوباسیون نمونه‏ها در محیط کشت مایع 22 میلی‏‏لیتر بافر فسفات 1/0 مولار با اسیدیته 5/6 ‏به محیط کشت اضافه کرده برای 30 دقیقه در 19 درجه سانتی‏گراد و دور شیکر rpm 140 بر روی شیکر چرخان قرار داده شد. مخلوط را از طریق کاغذ صافی واتمن فیلتر کرده محلول به‏دست آمده در دور g 8000 در 4 درجه سانتی‏گراد برای 15 دقیقه سانتریفیوژ شد (7).

فعالیت آنزیم پکتیناز با روش کلوریمتریک میلر[5] اندازه‏گیری شد. در این روش 5/0 میلی‏‏لیتر از سوپرناتانت سلول‏های آزاد در 5/0 میلی‏‏لیتر پکتین به همراه بافر استات 1/0 مولار با اسیدیته 6 مخلوط و در شرایط ثابت برای 10 دقیقه در 40 درجه سانتی‏گراد انکوبه شد. سپس، 1 میلی‏لیتر از معرف دی نیتروسالیسیلیک اسید (DNSA)به مخلوط اضافه و برای 5 دقیقه در 90 درجه سانتی گراد جوشانده شد. واکنش با اضافه کردن 1 میلی‏لیتر نمک راچل[6] متوقف شد. سپس، جذب توسط دستگاه اسپکتروفتومتری در طول موج 540 اندازه‏گیری شد. هر واحد فعالیت پکتیناز به عنوان مقدار آنزیمی که 1ماکرومول گلوکز را در هر دقیقه آزاد می‏کند، تعیین می‏شود (8).

.الکتروفورز سدیم دو دسیل سولفات (SDS- PAGE): برای‏ انجام الکتروفورز نیاز به محلولی کمابیش خالص از لحاظ آنزیم مورد نظر است‏ که پس از القای فعالیت و تولید آنزیم در محیط کشت از سانتریکون برای‏ تغلیظ آنزیم استفاده شد. سپس، برای‏ به‏دست آوردن وزن مولکولی آنزیم از روش SDS-PAGE12% استفاده شد. رنگ آمیزی ژل توسط کوماسی بلو R-250 برای‏ ظاهر شدن باندها انجام شد.

طراحی آزمایش و تجزیه و تحلیل آماری: تجزیه و تحلیل آماری براساس نرم افزار مینی‏تب[7] و روش طراحی آزمایش انجام شد. روش‏‏ طراحی آزمایش یکی از روش‏‏‏های بهبود کیفیت است که در دهه‏های 1980 و 1990 به عنوان یک مزیت رقابتی در کشور‏های غربی و ژاپن مطرح شد. استفاده صحیح از روش‏های طراحی آزمایش‏های آماری می‏تواند باعث سهولت در انجام مراحل کار، تولید محصولات جدید و بهبود محصولات موجود شود. در این آزمایش با استفاده از روش،‏‏ و روش فاکتوریل در نرم‏افزار مینی‏تب یک سری آزمایش طراحی شد (9). در ابتدا با استفاده از طراحی آزمایش فاکتوریل کسری 8 آزمایش طراحی شد تا عامل‏های موثر شناسایی شوند؛ سپس، با به کارگیری عامل‏‏های موثر طراحی آزمایش فاکتوریل کامل انجام شد (جدول‏های 1، 2 و 3).

 

 

 

 

 

 

جدول 1- آزمایشات طراحی شده با روش کسری فاکتوریل برای 3 قارچ غربال‏گری شده در حضور منبع کربنی گلوکز

شماره آزمایش

دما

‏اسیدیته

غلظت گلوکز

 (گرم بر لیتر)

سولفات آمونیوم

 (گرم بر لیتر)

سولفات منگنز

 (گرم بر لیتر)

1

5

3

15

5

1

2

5

3

5

5

5

3

60

3

15

5/0

5

4

5

9

15

5/0

1

5

60

9

5

5

1

6

60

3

5

5/0

1

7

5

9

5

5/0

5

8

60

9

15

5

5

 

جدول 2- آزمایشات طراحی شده با روش کسری فاکتوریل برای 3 قارج غربال‏گری شده در حضور منبع کربنی استویا

شماره آزمایش

دما

‏اسیدیته

غلظت استویا

 (گرم بر لیتر)

سولفات آمونیوم

 (گرم بر لیتر)

سولفات منگنز

 (گرم بر لیتر)

1

5

3

15

5

1

2

5

9

15

5/0

1

3

5

3

5

5

5

4

60

3

5

5/0

1

5

60

9

5

5

1

6

60

9

15

5

5

7

5

9

5

5/0

5

8

60

3

15

5/0

5

 

جدول 3- آزمایشات طراحی شده با روش کسری فاکتوریل برای 3 قارج غربال‏گری شده در حضور منبع کربنی آب پنیر

شماره آزمایش

دما

‏اسیدیته

غلظت آب پنیر

 (گرم بر لیتر)

سولفات آمونیوم

 (گرم بر لیتر)

سولفات منگنز

 (گرم بر لیتر)

1

60

9

15

5

5

2

5

9

15

5/0

1

3

60

9

5

5

1

4

60

3

5

5/0

1

5

5

3

5

5

5

6

60

3

15

5/0

5

7

5

3

15

5

1

8

5

9

5

5/0

5

 

 


نتایج.

.رشد میکروارگانیسم‏هایقارچی در فرآیند تولید آنزیم: قارچ‏های تولید کننده آنزیم پکتیناز با رنگ‏آمیزی لگول از بین سویه‏های مختلف با دیدن هاله بنفش رنگ جداسازی شد. با بررسی رشد و میزان تولید آنزیم پکتیناز در سویه‏های انتخابی، سویه‏ای که بالاترین میزان رشد و تولید آنزیم را داشت برای‏ بهینه‏سازی تولید آنزیم در نظر گرفته شد. 3 سویه‏ای که در این آزمایش بهترین عملکرد را نشان دادند با شناسایی ریخت‏شناختی توسط کلید شناسایی پیت و با استفاده از ویژگی‏های میکروسکوپی و ماکروسکوپی بررسی شدند. نتایج این بررسی به شرح زیر است:

سویه 2، در کشت مورد نظر وزیکول‏ها بیشتر دو ردیفه، با قطر میانگین 50 میکرومتر متولا تمامی سطح وزیکول را می‏پوشاند، اندازه متولا 12×6 و اندازه فیالید‏ها 3×7 میکرومتر کنیدی‏ها گرد، بیشتر بسیار زبر و با قطر میانگین 9/3 -5/3 میکرومتر بود، بنابراین، آسپرژیلوس نایجر[8] معرفی شد (شکل 1).

سویه 3، دارای هیف‏های عریض و پهنی بود که از یک نقطه روی هیف اسپورانژیوفور خارج می‏شود و ممکن است این اسپورانژیوفور در قسمت فوقانی منشعب شود. در انتهای اسپورانژیوفور عضو برجسته‏ای به نام کلوملا[9] وجود دارد. از دیگر اجزای این قارچ کیسه‏ متورمی‏ است که اسپورانژیوم نام دارد. در داخل اسپورانژیوم تعداد زیادی کنیدیوسپور با بالغ شدن اسپورانژیوم دیواره آن شکسته و کنیدیوسپور‏ها آزاد می‏شوند؛ با توجه به این ویژگی‏ها این سویه، ریزوپوس اوریزه[10] معرفی شد (شکل 2).

 

 

سویه 5 نیز با توجه به ویژگی‏های میکروسکوپی شامل: هیف‏های شفاف و واجد تیغه میانی، کونیدی‏های دارای دیواره عرضی (تیغه میانی) و کونیدیوفورهایی که منشعب می‏شوند و بخشی به نام متولا را ایجاد می‏کنند. روی هر متولا یک یا چند استریگما یا فیلالید وجود دارد و روی هر فیالید یک ردیف کونیدیوسپور کروی شکل به رنگ آبی یا سبز با دیواره صاف یا خاردار وجود دارد؛ بنابراین، این سویه پنی‏سیلیوم کریزوژنوم[11] معرفی شد (شکل 3).

بر اساس میزان تولید آنزیم پکتیناز در محیط کشت مایع پکتین‏دار، مقایسه‏ای بین سویه‏های استاندارد به‏دست آمده انجام شد. درصد تولید آنزیم با توجه به حجم معینی از اسپور‏ها که توسط لام نئوبار بین 120 تا 130 اسپور شمارش شد، پس از 7 روزه محاسبه شد.

همان‏طور که مشاهده می‏شود (جدول 4) پس از 7 روز بیش‏ترین تولید آنزیم و بیش‏ترین رشد مشاهده شده مربوط به سویه 2، 3 و 5 است‏. بدین ترتیب که سویه 2 بالاترین میزان تولید آنزیم (567/0) را نشان داد و پس از آن سویه 3 و 5 میزان تولید آنزیم بالایی را نشان دادند.

 

جدول 4- نتایج حاصل از تولید آنزیم پکتیناز در محیط‏کشت مایع پکتین‏دار

سویه‏های قارچی

میزان تولید آنزیم پکتیناز پس از 7 روز (میلی‏گرم/ میلی‏لیتر)

سویه1

358/0

سویه2

567/0

سویه3

447/0

سویه4

357/0

سویه5

414/0

سویه6

230/0

سویه7

249/0

 

 

 

شکل 1- تصاویر ماکروسکوپی و میکروسکوپی از قارچ آسپرژیلوس نایجر (بزرگنمایی ×1000)


شکل 2- تصاویر ماکروسکوپی و میکروسکوپی از قارچ ریزوپوس اوریزه

 

شکل 3- تصاویر ماکروسکوپی و میکروسکوپی از قارچ پنی‏سیلیوم کریزوژنوم (برزگنمایی × 1000)

 

 

براساس میزان آنزیم تولید شده، از بین 7 سویه، سویه‏های آسپرژیلوس نایجر، پنی‏سیلیوم کریزوژنوم و ریزوپوس اوریزه بهترین تولید کننده آنزیم پکتیناز بودند. در ابتدا قبل از انجام آزمایش‏های بهینه‏سازی توسط نرم افزار مینی‏تب یک دوره زمانی برای‏ اینکه هر کدام از قارچ‏های مورد نظر ما در چه دوره زمانی بهترین رشد و بالاترین میزان تولید آنزیم را دارند انجام شد. همچنین؛ یک سری بهینه‏سازی تک فاکتوره استفاده شد. پس از تعیین یک سری شرایط بهینه، بهترین سویه‏ها از نظر میزان تولید آنزیم پکتیناز شناسایی شد.

شکل‏های4، 5 و 6 در زیر به ترتیب منحنی‏های مربوط به رشد قارچ را نشان می‏دهند.

 

 

شکل 4- نمودار رشدی قارچ آسپرژیلوس نایجر در یک دوره زمانی 7 روزه در محیط کشت پکتین‏دار، دمای 30 درجه

 

 

شکل 5- منحنی رشدی ریزوپوس اوریزه در یک دوره زمانی 7 روزه در محیط کشت پکتین‏دار، دمای 30 درجه

 

 

شکل6- منحنی رشد قارچ پنی‏سیلیوم کریزوژنوم در یک دوره زمانی 7 روزه در محیط کشت پکتین‏دار، دمای 30 درجه

نتایج نشان داد که با افزایش زمان، اندازه قطر کلونی افزایش می‏یابد. به‏طوری‏که بالاترین میزان رشد پس از 6 روز به‏دست آمد و پس از آن رشد ثابت ماند.

.شناسایی مولکولی سویه‏ها از طریق توالی ITS rDNA:
3 سویه مورد نظر به شکل مولکولی و از طریق توالی ITSrDNA و پرایمر‏های ITS1,4 (طول پرایمر‏ها به ترتیب 19 و 20 نوکلئوتید بود) توالی‏یابی شدند. توالی‏های به‏دست آمده (سویه 2 حدود 900 نوکلئوتید و سویه 3 و 5 با 1100 نوکلئیک اسید) توسط پایگاه داده NCBI با توالی‏های مشابه بلاست شد. سویه 2 و 3 حدود 100 درصد شباهت را به ترتیب با آسپرژیلوس نایجر سویه F207 و ریزوپوس اوریزه سویه 3/ 8M  نشان دادند. سویه 5 به میزان 86 درصد شباهت را با پنی‏سیلیوم کریزوژنوم ویسکونزین 54-1255 نشان داد که این سویه به عنوان یک سویه جدید با شماره دسترسی KC862754 در سایت GeneBank ثبت شد.

.نتایج بهینه‏سازی تولید آنزیم پکتیناز از قارچ .آسپرژیلوس نایجر، ریزوپوس اوریزه و پنی‏سیلیوم به روش کسری از فاکتوریل: هدف استفاده از طراحی کسری از فاکتوریل، تشخیص عوامل موثر بر تولید آنزیم از قارچهاییاد شده بود.

نمودارهای مربوط به آزمایش‏‏های فاکتوریل کسری انجام شده بر قارچ‏های آسپرژیلوس نایجر، ریزوپوس اوریزه و پنی‏سیلیوم کریزوژنوم در حضور 3 منبع کربنی مختلف گلوکز، آب پنیر و استویا انجام شد تا عوامل موثر بر تولید آنزیم پکتیناز شناسایی شود. سپس، انجام آزمایش‏های فاکتوریل کامل فقط در حضور عوامل موثر انجام شد.P value کوچکتر از 01/0 به این معناست که عامل مورد نظر بسیار مهم است و در صورتی که P value بین 01/0 تا 05/0 باشد، یعنی عامل مورد نظر اثر مهمی در پاسخ دارد. اما P value بیشتر از 1/0 احتمال خطا را نشان می‏دهد و نشان دهنده بی‏اثر بودن عامل است. در بین 5 متغیر ارایه شده در این فرآیند، متغیر‏هایی که دارای P بیشتر از 05/0 هستند اهمیت کمتری داشته و در مدل ارایه شده نقش کمتری دارند. عوامل موثر در آزمایش‏‏های فاکتوریل کسری انجام شده برای 3 سویه مورد نظر در جدول 5 آورده شده است.

.نتایج بهینه‏سازی تولید آنزیم پکتیناز از قارچ‏ آسپرژیلوس نایجر به روش فاکتوریل کامل: برای آسپرژیلوس نایجر در آزمایشی که با منبع کربنی استویا انجام شد، با انجام آزمایش فاکتوریل کامل برای 5 عامل‏ موثر نتایج بدست آمده نشان داد که نقطه مرکزی مقدار‏های استفاده شده برای فاکتور‏های مورد نظر بالاترین میزان تولید آنزیم (876/0 میلی‏‏گرم بر میلی‏‏لیتر) را خود نشان داد. همچنین، در این آزمایش مشاهده شد که قارچ آسپرژیلوس نایجر در دمای 60 درجه، ‏اسیدیته 3، غلظت 15 گرم بر لیتر استویا، 5 گرم بر لیتر سولفات آمونیوم و غلظت 5 گرم بر لیتر سولفات منگنز نیز توانایی تولید آنزیم را به طور قابل توجهی دارد. همچنین، میزان تولید آنزیم پکتیناز در این آزمایش که در حضور منبع کربنی استویا در کنار منبع کربنی پکتین انجام شد نسبت به نمونه شاهد افزایش یافت. آزمایش فاکتوریل کسری که با منبع گلوکز برای آسپرژیلوس نایجر انجام شد، 4 عامل‏ و همچنین، برهمکنش متقابل بین غلظت گلوکز-pH و pH- MnSo4 موثر معرفی شد. با طراحی آزمایش فاکتوریل کامل برای این 4 عامل‏ موثر نتایجی که بدست آمد نشان دهنده تولید بالای آنزیم پکتیناز (328/1 میلی‏‏گرم بر میلی‏‏لیتر) در نقطه مرکزی عامل‏های به‏کار رفته بود. همچنین، این قارچ با استفاده از گلوکز با غلظت 15 گرم بر لیتر، دمای 60 درجه، اسیدیته 3 و غلظت 5 گرم بر لیتر سولفات منگنز نیز رشد مناسب و تولید و فعالیت خوبی از آنزیم پکتیناز را نشان داد. این آزمایش نسبت به نمونه شاهد که فقط حاوی منبع کربنی پکتین بود میزان رشد و تولید آنزیم بالاتری را نشان داد.

 

 

جدول 5- عامل‏‏های موثر برای 3 سویه مورد نظر توسط روش طراحی آزمایش فاکتوریل کسری

P-Value

عامل‏های موثر

منبع کربن

میکروارگانیسم

<002/0

دما، غلظت گلوکز و سولفات منگنز و ‏اسیدیته

گلوکز

آسپرژیلوس نایجر

<01/0

5 عامل‏

استویا

<001/0

دما، غلظت آب پنیر و سولفات منگنز و ‏اسیدیته

آب پنیر

<03/0

‏اسیدیته غلظت گلوکز و

گلوکز

ریزوپوس اوریزه

<01/0

دما، غلظت سولفات منگنز و سولفات آمونیوم

استویا

0001/0

5 عامل‏

آب پنیر

0001/0

دما

گلوکز

پنی‏سیلیوم کریزوژنوم

0001/0

دما، غلظت استویا و‏اسیدیته

استویا

<01/0

دما، غلظت آب پنیر و سولفات منگنز

آب پنیر

 

 


در مورد منبع کربنی آب پنیر نیز با انجام طراحی آزمایش فاکتوریل کامل با 4 عامل‏ موثر نتایجی که بدست آمد نشان دهنده بالاترین میزان تولید آنزیم (892/0 میلی‏‏گرم بر میلی‏‏لیتر) در شرایط میانی مقدار مورد استفاده برای عامل‏های مورد نظر بود. نکته مهمی که در این آزمایش بدست آمد، رشد قارچ آسپرژیلوس نایجر در دمای 60 درجه، ‏اسیدیته 3، غلظت 15 گرم بر لیتر آب پنیر، 5/0 گرم بر لیتر سولفات آمونیوم بود که آنزیم پکتیناز با این شرایط نیز فعالیت قابل توجهی از خود نشان داد. در این آزمایش نیز میزان تولید آنزیم نسبت به نمونه شاهد بالاتر بود (شکل 7).

 

 

 

شکل 7- منحنی 3 بعدی سطحی تولید آنزیم پکتیناز در حضور منبع کربنی آب پنیر (A)، گلوکز (B) و استویا (C) مربوط به قارچ آسپرژیلوس نایجر

 

 

 

 

 

 

 

 

.نتایج بهینه‏سازی تولید آنزیم پکتیناز از قارچ‏ ریزوپوس اوریزه به روش فاکتوریل کامل: بر اساس آزمایشاتی که برای قارچ ریزوپوس اوریزه با منبع گلوکز انجام شد، 2 عامل‏ ‏اسیدیته و غلظت گلوکز مؤثر معرفی شد. آزمایش دوباره با این 2 عامل‏ مؤثر تکرار شد. تعداد آزمایشاتی که باید انجام می‏شد 22 =4 بود. نتایج به‏دست آمده نشان داد که بهترین شرایط برای تولید بیشتر آنزیم پکتیناز (895/0 میلی‏گرم بر میلی‏لیتر) نقطه مرکزی فاکتور‏‏های مورد نظر (اسیدیته و غلظت گلوکز)در آزمایشات کسری و کامل معرفی شد. البته در ‏اسیدیته 3، دمای 60 درجه سانتی‏گراد، غلظت 15 گرم بر لیتر گلوکز، غلظت 5/0 گرم بر لیتر سولفات آمونیوم و غلظت 5 گرم بر لیتر سولفات منگنز نیز تولید بالای آنزیم پکتیناز توسط سویه ریزوپوس اوریزه در آزمایش‏های فاکتوریل کسری مشاهده شد (شکل 8).

 

 

 

شکل 8- منحنی 3 بعدی سطحی تولید آنزیم پکتیناز در حضور منبع کربنی آب پنیر (A)، استویا (B) و گلوکز (C) مربوط به قارچ ریزوپوس اوریزه

 

 

 

شکل 9- منحنی 3 بعدی سطحی تولید آنزیم پکتیناز در حضور منبع کربنی آب پنیر (A)، استویا (B) و گلوکز (C) مربوط به قارچ پنی‏سیلیوم کریزوژنوم

 

 

.نتایج بهینه‏سازی تولید آنزیم پکتیناز از قارچ‏ پنی‏سیلیوم کریزوژنوم به روش فاکتوریل کامل: در مورد قارچ پنیسیلیوم، آزمایشاتی که با منبع کربنی آب پنیر توسط طراحی فاکتوریل کسری انجام شد 3 عامل‏ موثر را به ما معرفی کرد. با استفاده از این 3 عامل‏ دوباره طراحی آزمایش با فاکتوریل کامل انجام شد. بهترین شرایط برای تولید بالای آنزیم پکتیناز با غلظت 039/1 در دمای 32 درجه سانتی‏گراد، غلظت 10 گرم بر لیتر آب پنیر و غلظت 3 گرم بر لیتر سولفات منگنز بود. در این آزمایش تولید و فعالیت آنزیم پکتیناز در دمای 60 درجه، غلظت 5گرم بر لیتر سولفات منگنز و غلظت 15 گرم بر لیتر آب پنیر نیز به طور مناسبی دیده شد. طراحی آزمایش فاکتوریل کسری که برای منبع کربنی استویا انجام شد 3 عامل‏ مورد نظر موثر معرفی شد. با انجام یک آزمایش فاکتوریل کامل نتایج تولید بهینه آنزیم با غلظت 964/0 میلی‏گرم بر میلی‏لیتر را در دمای 32 درجه، ‏اسیدیته 6، غلظت 3 گرم بر لیتر سولفات منگنز و 75/ 2 گرم بر لیتر سولفات آمونیوم و غلظت 10 گرم بر لیتر استویا معرفی شد. البته نتایج نشان دادند که در دمای 60 درجه، ‏اسیدیته 3، غلظت 5 گرم بر لیتر استویا، غلظت 5 گرم بر لیتر سولفات آمونیوم و غلظت 10 گرم بر لیتر سولفات منگنز نیز تولید آنزیم پکتیناز وجود دارد. در آزمایش‏هایی که با منبع گلوکز انجام شد تنها عامل‏ موثر دما معرفی شد و بهینه تولید آنزیم در نقطه مرکزی میزان عامل‏های تعیین شده با غلظت 160/1 بود که نسبت به نمونه شاهد تولید آنزیم افزایش در خور توجهی نشان داد. با توجه به نتایج بدست آمده در بالا می‏توان گفت که برای هر 3 نوع منبع کربنی بهترین شرایط برای تولید بالای آنزیم پکتیناز نقطه مرکزی مقدار‏های تعیین شده بود (شکل 9).

الکتروفورز سدیم دو دسیل سولفات: آنزیم پکتینازی که در این پژوهش از آسپرژیلوس نایجر، ریزوپوس اوریزه و پنی‏سیلیوم استخراج شد، طبق نتایج الکتروفورز سدیم دودسیل سولفات به ترتیب دارای وزن مولکولی 40، 37 و 37 کیلودالتون بود که در شکل 10 مشاهده می‏شود. با بررسی مطالعات قبلی و نتایج بدست آمده وزن مولکولی کمابیش مشابهی برای 3 سویه مورد نظر گزارش شده است. در نتیجه با توجه به وزن مولکولی گزارش شده در منابع احتمالا نقاط مشخص شده مربوط به آنزیم پکتیناز است.

 

 

 

شکل 10- باند‏های بدست آمده از آنزیم پکتیناز بر روی ژل 12 درصد SDS-PAGE برای ریزوپوس اوریزه باند (B
برای آسپرژیلوس نایجر باند (C) و برای پنی سیلیوم باند (D).

 

 

بحث و نتیجه ‏‏گیری.

.تولید آنزیم پکتیناز برای 3 سویه قارچی در شرایط دمایی مختلف: آنزیم‏ها در دماهای مختلف فعالیت آنزیمی متفاوتی از خود نشان می‏دهند. در دماهای بالا آنزیم‏ها ناپایدار بوده و فعالیت خود را از دست می‏دهند. دمای غیر فعال شدن آنزیم تقریبا همیشه به تجزیه شدن ساختار پروتئینی آنزیم نسبت داده می‏شود (10). نتایج این پژوهش نشان داد که 3 سویه قارچی آسپرژیلوس نایجر، پنی‏سیلیوم کریزوژنوم و ریزوپوس اوریزه در دامنه دمایی 5 تا 60 درجه توانایی رشد و تولید آنزیم پکتیناز را داشتند. البته بالاترین میزان رشد و تولید آنزیم پکتیناز در دمای 30 درجه گزارش شد که دمایی بهینه برای قارچ‏ها و فعالیت آنزیم پکتیناز است‏. از آنجا که تحمل دماهای بالا برای فعالیت آنزیم در صنعت از اهمیت ویژه‏ای برخوردار است، می‏توان نتیجه گرفت که این 3 سویه گزینه‏های مناسبی برای‏ استفاده در صنعت هستند. مطالعات قبلی نیز نشان می‏دهد که سویه‏های آسپرژیلوس نایجر، پنی‏سیلیوم کریزوژنوم و ریزوپوس اوریزه دارای بالاترین میزان رشد و فعالیت آنزیم پکتیناز در دامنه دمایی 28 تا 35 درجه سانتی‏گراد هستند. همچنین، گزارشاتی نیز وجود دارد که آنزیم پکتیناز جداسازی شده از ریزوپوس اوریزه توانایی فعالیت در دمای 70 درجه سانتی‏گراد را برای 45 دقیقه داراست‏؛ ولی گزارشاتی از تحمل دمای بالای 50 درجه برای آسپرژیلوس نایجر و پنی‏سیلیوم وجود ندارد. مارتین[xii] و همکارانش در سال 2004 گزارش کردند که پلی‏گالاکتوروناز حاصل از پنی‏سیلیوم کریزوژنوم حدود 70 درصد از فعالیت خود را در دمای 50 درجه حفظ می‏کند (11). بالدوین[xiii] در سال 1990 گزارش کرد که اثر دما بر روی فعالیت پکتین لیاز حاصل از پنی‏سیلیوم ایتالیتیکوم یک افزایشی را تا 50 درجه نیز نشان می‏دهد. پکتین لیاز حاصل از پنی‏سیلیوم ایتالیکوم پایداری گرمایی بالاتری نسبت به پکتین لیاز‏های حاصل از سویههای پنی‏سیلیومی دیگر دارد (12).

.تولید آنزیم پکتیناز برای 3 سویه قارچی در اسیدیته‏های مختلف: فعالیت آنزیم به نحو در خور توجهی از ‏اسیدیته تاثیر می‏پذیرد. این امر به این علت است که اتصال سوبسترا و کاتالیزور بیشتر به توزیع بار، هم بر روی سوبسترا و هم مولکول آنزیم بستگی دارد. توزیع بار بر پروتئینهاتوسط حالت زنجیرههایقابل یونیزه در اسیدآمینه‏های تشکیل دهنده آن‏ها تعیین می‏شود که این امر خود به ‏اسیدیته بستگی دارد و می‏تواند به طور مستقیم بر اتصال سوبسترا و خاصیت کاتالیزوری تاثیر بگذارد. بیش‏ترین فعالیت آنزیم پکتیناز برای سویه‏های قارچی در ‏اسیدیته اسیدیک رو به خنثی است و می‏توان گفت به علت اسید دوست بودن قارچ‏ها بوده و اینکه تحمل آن‏ها به ‏اسیدیته اسیدیک نسبت به باکتری‏ها بیشتر است. طی پژوهشی که توسط هوانگ[xiv] انجام شد یک پلی گالاکتوروناز اسیدی توسط ریزوپوس اوریزه سویه MTCC-1987 در شرایط تخمیر غوطه‏ور جداسازی شد (13).

 نتایج پژوهش حاضر نشان داد که این 3 سویه قارچی دارای توانایی لازم برای‏ فعالیت در دامنه ‏اسیدیته بین 3 تا 9 هستند. بالاترین میزان رشد و فعالیت آنزیم پکتیناز در این آزمایش‏ها در ‏اسیدیته 6 مشاهده شد. همچنین، تولید آنزیم پکتیناز حاصل از این 3 سویه توانایی لازم برای‏ فعالیت در ‏اسیدیته 3 را نیز دارا بود که این یک مزیت برای‏ استفاده آنزیم پکتیناز حاصل از این سویه‏ها در صنایع مختلف به ویژه در صنعت آبمیوه‏سازی است‏. مطالعات قبلی نیز نشان می‏دهد که بالاترین میزان فعالیت آنزیم پکتیناز حاصل از این سویه‏ها در ‏اسیدیته بین 5 تا 5/6 بوده است. پیکولی[xv] در سال 2007 از آسپرژیلوس نایجر برای‏ بهینه‏سازی تولید آنزیم پکتیناز استفاده کرد که بهترین شرایط بهینه برای تولید آنزیم منبع کربن پکتین مرکبات و سبوس گندم، کلسیم کلراید 2/0 درصد و ‏اسیدیته حدود 5/4 بدست آمد. (14). هووا و هانگ[xvi] در سال 2013 با استفاده از روش آماری طراحی باکس بنکن به همراه 4 عامل‏ رطوبت، ‏اسیدیته، دما و زمان تخمیر در 3 سطح استفاده شده است. شرایط بهینه برای آسپرژیلوس اوریزه برای‏ تولید بالای فعالیت آنزیم پکتیناز و سلولاز، 67 درصد رطوبت، اسیدیته 9/5 ‏اسیدیته، دمای 33 درجه سانتی‏گراد و 72 ساعت زمان تخمیر برآورد شد. پیکولی[xvii] در سال 2001 نشان داد که میزان بالای تولید پلی گالاکتوروناز و پکتین استراز توسط پنی‏سیلیوم گریسئوروسئوم در ‏اسیدیتههایبیشتر اسیدی 4 تا 5 و پکتین لیاز در ‏اسیدیتههایخنثی 5 تا 7 بهترین فعالیت آنزیمی را دارند. بانو[xviii] در سال 2003 نشان داد که پنی‏سیلیوم ویریدیکاتوم ماکزیمم تولید پلی‏گالاکتوروناز و پکتین لیاز را در اسیدیته 5/4 تا 5 ‏اسیدیته نشان می‏دهد (15). بانو و همکارانش در سال 2010 نشان دادند که پنی‏سیلیوم کریزوژنوم ماکزیمم تولید پلی گالاکتوروناز را در دمای 35 درجه سانتی‏گراد و ‏اسیدیته 5/6 دارد. مارسیا[xix] و همکارانش در سال 1999 پایداری پلی‏گالاکتوروناز را در مقابل ‏اسیدیته بررسی کردند. نتایج پژوهش ایشان نشان داد که این آنزیم در دامنه ‏اسیدیته 6 تا 8‏ پایدار و بیش‏ترین فعالیت را دارد (16). مارتین و همکارانش در سال 2004 نیز گزارش کردند که پلی گالاکتوروناز حاصل از پنی‏سیلیوم کریزوژنوم در ‏اسیدیته 3 تا 8 ‏پایدار بوده و حدود 70 درصد از فعالیت خود را در دمای 70 درجه حفظ می‏کند. پکتین لیاز تولید شده توسط این میکروارگانیسم در ‏اسیدیته 4 تا 8 ‏اسیدیته (اسیدیک تا خنثی) پایدار است‏. مطالعات انجام شده نشان می‏دهد پلی گالاکتوروناز تولید شده توسط پنی‏سیلیوم ویریدیکاتوم بالاترین فعالیت خود را در ‏اسیدیته 5 تا 8‏ دارد و 80 درصد از فعالیت خود را در‏اسیدیته 9 نشان می‏دهد. پکتین لیاز بیشترین پایداری را در ‏اسیدیته 5/3 تا 5/4 دارد ولی در ‏اسیدیته 5 و 6 ‏ به ترتیب 60 تا 80 درصد از فعالیت خود را حفظ می‏کند (17).

.تولید آنزیم پکتیناز برای 3 سویه قارچی در حضور منابع کربنی مختلف: منابع کربن که اصولا قند‏ها می‏باشند برای رشد میکروارگانیسم بسیار حیاتی هستند و در نبود آ‏ن‏ها میکروارگانیسمهانمی‏توانند رشدی داشته و آنزیم تولید کنند. نتایج حاصل از این پژوهش نشان داد که 3 سویه مورد آزمایش در حضور هر 3 منبع کربن گلوکز، آب پنیر و استویا قابلیت رشد و تولید آنزیم را دارند. بالاترین میزان تولید آنزیم پکتیناز برای قارچ آسپرژیلوس نایجر در حضور منبع کربنی گلوکز و برای قارچ‏های پنی‏سیلیوم و ریزوپوس منبع کربنی آب پنیر بود.

 نتایج مشابهی نیز توسط پژوهشگران دریگر گزارش شده است که سویه‏های آسپرژیلوس نایجر، پنیسیلیوم و ریزوپوس توانایی تولید آنزیم پکتیناز در حضور منابع کربن (سبوس گندم، پکتین، گلوکز، میوههای سیب، پرتقال و غیره) و ‏اسیدیته پایین را دارند. ولی تاکنون هیچ گزارشی از تولید آنزیم پکتیناز توسط این سویه در حضور منبع کربنی آب پنیر و استویا در ‏اسیدیته ‏های بالا ارایه نشده است. آب پنیر یک سوبسترای ارزان قیمت و یک منبع کربنی و نیتروژنی غنی برای‏ رشد میکروارگانیسم‏ها و تولید آنزیم است‏.

 موهد[xx] در سال 2012 فعالیت‏های آنزیماتیکی بین 153 تا 480 IU/g در تخمیر حالت جامد توسط سویه‏هایآسپرژیلوس که از پوسته گندم یا سویا به عنوان منبع کربن استفاده کرده بود به‏دست آورد. همچنین، طبق مطالعاتی که توسط مالوسی[xxi] انجام شد وی به وضوح به تاثیر مثبت پکتین مرکبات بر افزایش تولید آنزیم اندو پلی‏گالاکتوروناز در قارچ آسپرژیلوس اوریزه در کشت غوطه ور اشاره نمود (18). همچنین، بلالی[xxii] توانست از پکتین مرکبات به عنوان تنها منبع کربن برای القای ترشح آنزیم پکتیناز خارج سلولی برای قارچ‏های آسپرژیلوس نایجر و آسپرژیلوس فلاووس استفاده کند (19). او توانست با استفاده از پوست و ضایعات پرتقال به تولید بالایی از پکتیناز از آسپرژیلوس اوریزه در محیط کشت غوطه‏ور برسد (19).

در محیط کشت به‏کار برده شده در این پژوهش برای 3 سویه قارچی از 3 منبع کربنی در کنار منبع کربنی پکتین استفاده شد. بدین صورت که قارچ ابتدا از منبع کربنی گلوکز، استویا و یا آب پنیر برای‏ رشد خود استفاده می‏کند تا زمانی که این منبع کربن تمام شود. قارچ که در مرحله ساکن رشد خود رسیده است برای‏ ادامه بقا از پکتینی که در محیط است به عنوان منبع کربن استفاده می‏کند. برای‏ تجزیه پکتین نیاز به آزاد کردن آنزیم پکتیناز دارد. در مقایسه با این 3 منبع کربنی که استفاده شد گلوکز میزان بالاتری از تولید آنزیم پکتیناز را نشان داد، پس می‏توان نتیجه گرفت که قارچ آسانتر از گلوکز برای‏ رشد خود استفاده کرده درنتیجه با رشد بهتر میسلیوم‏ها آنزیم بیشتری نسبت به نمونه شاهد که فقط از منبع کربنی پکتین استفاده شده بود در محیط تولید می‏شود. همچنین، با مقایسه بین میزان عامل‏های بکار برده شده برای منبع کربنی گلوکز و آب پنیر شرایط یکسانی برای تولید بالای پکتیناز نشان داده شد ولی شرایط برای تولید بالای پکتیناز در استفاده با منبع کرنبی استویا شرایط بهینه متفاوتی را نشان داد که این شاید به ساختار مولکولی استویا برگردد که قارچ در یک شرایط متفاوتی نسبت به منابع کربنی دیگر از آن استفاده می‏کند. مطالعات قبلی نشان داد که آسپرژیلوس اوریزه در شرایط تخمیر حالت جامد با سوبستراهای جامد مختلف مانند پوست برنج، باقیمانده‏های سویا، ساقه نیشکر و تفاله انگور، سلولاز و پکتیناز تولید می‏کند. نتایج نشان داد که باقیمانده سویا بهترین سوبسترا برای آسپرژیلوس اوریزه برای‏ تولید و بالا بردن فعالیت آنزیم‏های پکتیناز و سلولاز است‏ (20).

 

.تولید آنزیم پکتیناز برای 3 سویه قارچی در حضور نمک‏های سولفات آمونیوم و سولفات منگنز: وجود نمک‏هاو فلزات مختلف در محیط می‏تواند اثرات متفاوتی بر تولید و فعالیت آنزیم‏ها داشته باشد. طبق مشاهداتی که وجود دارد برخی از یون‏ها مانند منگنز فعالیت پلی‏گالاکتوروناز را افزایش می‏دهند. در مورد نمک آمونیوم سولفات و اثر آن بر فعالیت آنزیمی، مطالعات نشان داده که نمک‏های سولفات و فسفات در غلظت‏های مناسب باعث افزایش تولید آنزیمی از میکروارگانیسم‏ها می‏شود. طبق مشاهداتی که در این پژوهش انجام شد نمک‏های سولفات منگنز و سولفات آمونیوم از عوامل موثر بر تولید آنزیم معرفی شدند. در گزارشات مشابهی نیز توسط پژوهشگران دیگر ارایه شده که برخی از یون‏ها مانند منیزیم، جیوه و روی، فعالیت آنزیم پکتیناز را به علت بلوکه کردن گروه‏های تیول که در جایگاه فعال آنزیم قرار دارند کاهش می‏دهند (21).

 مطالعات دیگر نشان می‏دهند که فسفات آمونیوم، آمونیوم سولفات، سدیم نیترات، نیترات آمونیوم بهترین منبع نیتروژن برای تولید پکتیناز توسط آسپرژیلوس نایجر (21) و آسپرژیلوس نایجر Y L 128هستند. اثر منابع فلزی در تولید هر 2 آنزیم پکتیناز و سلولاز توسط آسپرژیلوس نایجر نشان می‏دهد که منگنز سولفات 5 آبه بهترین منبع فلز برای فعالیت بالای پکتیناز است (22). سوهل[xxiii] در سال 2007 گزارش کرد که در میان یون‏های فلزی آزمایش شده، اضافه کردن 5 میلی‏مولار کلسیم کلراید فعالیت پکتیناز حاصل از پنی‏سیلیوم کریزوژنوم را تا 56/3 درصد افزایش می‏دهد. منیزیم کلراید و روی کلراید فعالیت آنزیم را تا سطح 2/21 و 8/14 درصد مهار می‏کنند. فلزاتی مانند جیوه کلراید و کبالت کلراید و مس سولفات نیز گزارش شده است که فعالیت آنزیم پکتیناز را حدود 60 درصد کاهش می‏دهند. سوهل[xxiv] در سال 2006 نشان داد که اضافه کردن نیترات آمونیوم و آمونیوم کلراید به محیط کشت حالت جامد قارچ ریزوپوس اوریزه می‏تواند میزان تولید آنزیم پکتیناز را افزایش دهد (23).

.مقایسه 3 سویه قارچی مورد استفاده در این پژوهش از نظر تولید آنزیم پکتیناز: مقایسه میزان تولید آنزیم پکتیناز توسط این 3 سویه مورد آزمایش نشان می‏دهد که سویه آسپرژیلوس نایجر نسبت به 2 سویه دیگر در حضور منبع کربنی گلوکز بالاترین میزان تولید و فعالیت انزیم پکتیناز نشان می‏دهد (شکل 11).

 

شکل 11- مقایسه بالاترین میزان تولید آنزیم پکتیناز در بین 3 سویه مطالعه شده در شرایط بهینه شده

 

البته 2 سویه ریزوپوس اوریزه و پنیسیلیوم نیز در حضور منبع کربنی آب پنیر که در واقع یک زباله زیستی است به عنوان یک سوبسترای ارزان قیمت محسوب می‏شود، توانایی قابل توجهی از تولید آنزیم پکتیناز را نشان دادند. همچنین، هر 3 سویه توانایی تولید آنزیم پکتیناز را در دمای 60 و ‏اسیدیته‏های3 و 9 دارند که این یک مزیت برای استفاده در صنایع آبمیوه و نساجی محسوب می‏شود.

 در آزمایشات مشابهی، اوکافور[xxv] در سال 2010، 5 قارچ رشته‏ای به نام‏های آسپرژیلوس کلاواتوس، آسپرژیلوس نایجر، فوزاریوم، پنی‏سیلیوم کریزوژنوم و تریکودرما را از نمونه‏های مواد زاید کشاورزی جداسازی کرد و با کشت دادن آنها روی محیط‏کشت پایه حاوی پکتین بهترین فعالیت تجزیه پکتین را در سویه آسپرژیلوس نایجر و پنی‏سیلیوم کریزوژنوم مشاهده کرد (24).

پلاکشمینارا سیمها[xxvi] در سال 2012 با جداسازی و غربال‏گری قارچ‏های تولید کننده آنزیم پکتیناز از خاک‏های کشاورزی و غیر‏کشاورزی مختلف، 44 سویه قارچی را جداسازی کرد که 4 تا از این قارچ‏ها آنزیم تجزیه‏کننده پکتین بیشتری تولید می‏کنند. 4 سویه آسپرژیلوس فلاووس، آسپرژیلوس نایجر، آسپرژیلوس ژاپونیکوسو کیتومیوم گلوبوسوم بودند که آن‏ها را در دما و ‏اسیدیتههایمختلف برای تولید پکتیناز آزمایش کرد. دمای بهینه حدود 30 درجه سانتی‏گراد و ‏اسیدیته بهینه حدود 8/6 بود و بالاترین میزات تولید آنزیم مربوط به آسپرژیلوس نایجر بود (25).

 موهد[xxvii] در سال 2012 قارچ‏های تولیدکننده پکتیناز را از محیط‏های مختلف خاک و میوه‏های پوسیده جدا‏سازی و در محیط کشت آگار پکتین‏دار تغییر شکل یافته رشد داد. سویه‏های به دست آمده شامل موکور، آسپرژیلوس، پنیسیلیوم، ریزوپوس و تریکودرما بود که از بین این‏ها ریزوپوس با استفاده از پکتین 5/1 درصد به عنوان منبع کربن، اوره به عنوان منبع نیتروژن و منگنز سولفات در دمای 45 درجه سانتی‏گراد بیش‏ترین فعالیت را برای تولید پلی‏گالاکتوروناز نشان داد. ‏اسیدیته مناسب برای خالص‏سازی پلی‏گالاکتوروناز از این قارچ حدود 5 و بهترین دما برای آن 55 درجه سانتی‏گراد‏ به دست آمد (26).

تشکر و قدردانی

در پایان از حمایت‏های دانشکده علوم و فناوری نوین دانشگاه اصفهان و کمیته فراوردههایطبیعی تشکر و قدردانی می‏شود.



[1]- Malt Yeast Agar

[2]- Czapek Yeast Extract Agar

[3]- Pitt and Hocking

[4]- Stevia

[5]- Miller

[6]- Rochell

[7]- Minitab Software

[8]- Aspergillus niger

[9]- columella

[10]- Rhizopus Oryzae

[11]- Penicilium chrysogenum

[xii]- Martin

[xiii]- Baldwin

[xiv]- Huwang

[xv]- Picolli

[xvi]- Hoa and Hung

[xvii]- Piccoli

[xviii]- Banu

[xix]- Marssia

[xx]- Mohed

[xxi]- Malussi

[xxii]- Balali

[xxiii]- Sohel

[xxiv]- Sohel

[xxv]- Okafor

[xxvi]- Plakshimnara

[xxvii]- Mohd

 

 

(1)               Acuna-Arguelles ME., Gutierrez-Rajas M., Viniegra-Gonzalez G., Favela-Toress E. Production and properties of three pectinolytic activities produced by A. niger in submerged and solid state fermentaion. Apply Microbiology Biotechnology 1995; 43 (56): 808- 14.

(2)               Ahmed M. Study on jute retting bacteria. Journal Apply Bacteriology 1963; 26 (7): 117-126.

(3)               Alana A., Alkorta I., Dominguez JB., Llama M.J., Serra JL. Pectin lyase activity in a Penicillium italicum strain. Apply Environment Microbiology 1990; 56 (12): 3755- 59.

(4)               Alkorta I., Garbisu C., Llama M.J., Serra JL. Industrial applications of pectic enzymes: A review. Process. Biochemistry 1998; 33 (1): 21- 8.

(5)               Akhter Asifsiddiqui M., Pande V., Arif M. Purification and characterization of polygalacturonase from rhizomucor pusillus isolated from decomposting orange peels. Hindawi Publishing Corporation Enzyme Research 2012; 8 (4): 234- 41.

(6)               Asifsiddiqui M., Pande V., Arif M. Production, purification, and characterization of polygalacturonase from rhizomucor pusillus isolated from decomposting orange peels. Hindawi Publishing Corporation Enzyme Research 2012; 8 (7): 234- 41.

(7)               Alammorshed M., Uddin A., Begum F., sultan T., Azad AK. Production of pectinase by aspergillus niger cultured in solid state media. International Journal of Biosciences 2011; 1 (6): 33- 42.

(8)               Alvarez G. Intraspecific ITS variability in the kingdom fungi as expressed in the international sequence database and its implication for molecular species identification. Evolutionary bioinformatics 2003; 4 (5): 193- 201.

(9)               Angayarkanni J., Palaniswamy M., Murugesan S and Swaminathan K. Improvement of tea leaves fermentation with Aspergillus spp. pectinase. Journal Bioscience Bioengginering 2002; 94 (6): 299-303.

(10)           Banu A., Kalpana M., Gnanaprabhal RG., Pradeep VB., Palaniswamy M. Production and characterization of pectinase enzyme from penicillium chrysogenum. Indian Journal of Science and Technology. 2012; 3 (4): 377- 81.

(11)           Balali A., Bajwa R., Latif Z. Status of aspergillus niger srains for pectinase production potential. Institute of Mycology and Plant Pathology 2009; 21 (7): 77- 82.

(12)           Baldwin A. Intragenomic variation in the ITS rDNA region obscures phylogenetic relationships and inflates estimates of operational taxonomic units in genus Laetiporus. Mycologia 1995; 103 (4): 731-740.

(13)           Huwang F., Kim KS., Zimmerman W., Fiechter A. Pectinolytic enzymes from actinomycetes for the degumming of ramie bast fibers. Apply Environment. Microbiology 1994; 60 (7): 2107- 12.

(14)           Picolli PG., Queiroz M.V., Pereira OL., Araújo EF. Morphological and molecular differentiation of the pectinase producing fungi Penicillium expansum and Penicillium griseoroseum. Brazilian Journal Microbiology 2007; 38 (9): 71- 7.

(15)           Banu R., Kumbhar BK., Sarkar BC. Enzymatic hydrolysis of carrot for increased juice recovery. Journal. Food Science. Technology 2003; 40 (4): 35- 9.

(16)           Marssia MASC., Fonseca MJV., Said S. Purification and partial characterization of exopolygalacturonase I from Penicillium frequentans. Microbiology Research 2002; 157 (5): 19- 24.

(17)           Martini D. Description of the phylogenetic analysis of utilized Gonium pectorale strains. Mycology 2003; 3 (4): 276- 83.

(18)           Malussi V. Quasi-random maximum simulated likelihood estimation of the mixed multinomial logit model. Transportation Research Part B: Methodological 2001; 35 (7): 677- 93.

(19)           Balali G. ITS1., ITS4 for identified fungi. Mycology 1993; 5 (4): 432- 40.

(20)           Delcheva G., Pishtiyski G., Dobrev A., Krusteva S. Immobilization of Aspergillus niger pectinase on polyacrylonitrile copolymer membrane. Trends Applied Science Researh 2007; 2 (5): 419- 25.

(21)           Dalal S., Sharma A., Gupta MN. Enzymatic pretreatment to enhance oil extraction from fruits. A multipurpose immobilized 2007; 16 (4): 1- 5.

(22)           Fawole OB., Odunfa SA. Pectolytic moulds in Nigeria. Letter Apply Microbiology 1992; 15 (7): 266-268.

(23)           Sohel D. Plant or fungal sequences? An alternative optimized PCR protocol to avoid ITS (nrDNA) misamplification. Brazilian Archives of Biology and Technology 2001; 53 (1): 346- 52.

(24)           Okafur F. Impact of DNA sequence-data on the taxonomy of anamorphic fungi. Fungal Diversity 2005; 5 (7): 365- 72.

(25)           Plakshimnara T. Better the devil you know? Guidelines for insightful utilization of nrDNA ITS in species-level evolutionary studies in plants. Mycology 2007; 4 (7): 134- 43.

(26)           Mohed E., Asadi A., Akbari M. Effective factors in agricultural apple waste in Islamic Republic of Iran: A comparative study. Journal Humman Ecology 2010; 32 (6): 47-53.