شناسایی باکتری‏ های جنس Vibrio جداسازی شده از ماهی آکواریومی گوپی (Poecillia reticule) در استخرهای پرورش ماهی کاشان، اصفهان، ایران

نوع مقاله: پژوهشی- انگلیسی

نویسندگان

1 دکتری میکروبیولوژی، واحد فلاورجان، دانشگاه آزاد اسلامی، اصفهان، ایران

2 استادیار میکروبیولوژی، واحد فلاورجان، دانشگاه آزاد اسلامی، اصفهان، ایران

3 استادیار بیوتکنولوژی، واحد فلاورجان، دانشگاه آزاد اسلامی، اصفهان، ایران

چکیده

مقدمه: باکتری‏های گرم منفی از مهم‏ترین باکتری‏های بیماری‏زا برای موجودات دریایی از جمله ماهیان زینتی هستند.

مواد و روش‏‏ ها: در این پژوهش گونه‏های Vibrio از ماهی زینتی گوپی در استخرهای پرورش ماهی کاشان، اصفهان، ایران جداسازی و بر اساس روش‏های تشخیص مولکولی و توالی یابی ژنتیکی شناسایی شدند. نمونه‏های کبد، کلیه، پوست، مغز و آبشش از ماهی زینتی گوپی در منطقه کاشان، اصفهان، ایران در مراحل لارو، بالغ و آماده خارج شدن از سالن گرفته شد. نمونه‏ها روی محیط‏های کشت غنی شده کشت داده و مراحل خالص‏سازی انجام شد. شناسایی اولیه با استفاده از تعیین ویژگی‏های بیوشیمیایی باکتری‏های جداسازی شده انجام شد. تشخیص مولکولی
 بر اساس تکثیر توالی 16SrDNA ژنوم Vibrio cholera حاوی ITS (Internal Transcribed Spacer) و توالی یابی نوکلئوتیدهای تکثیر شده انجام گرفت.

نتایج: باکتری‏های جداسازی شده از انواع گونه‏های Vibrio شامل Vibrio cholera (99 درصد شباهت در توالی)،Vibrio alginolyticus، Vibrio mimicus و Vibrio parahaemolyticus (کمتر از 90 درصد شباهت در توالی) تشخیص داده شدند. حوضچه‏های پرورش ماهی دارای آب قلیایی و مقدار BOD پنج روزه در محدوده سالم نبودند. این شرایط برای گونه‏های Vibrio ایده‏آل است.

بحث و نتیجه ‏گیری: موجودات آبزی در ایران می‏توانند ناقل عوامل پاتوژن انسانی مانند گونه‏های Vibrio باشند. نتایج این بررسی و پژوهش‏های مشابه، باید در سیستم‏های بهداشت پرورش آبزیان مورد توجه قرار گیرد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Detection of Vibrio Species Isolated from Ornamental Guppy Fish in Kashan, Isfahan, Iran Fish culturing Pounds

نویسندگان [English]

  • Samira Kiani 1
  • Nafiseh Sadat Naghavi 2
  • Alireza Nazari 3
1 M.Sc. of Microbiology, Department of microbiology, Falavarjan Branch, Islamic Azad Unversity, Isfahan, Iran
2 Assistant professor of Microbiology, Department of Microbiology, Falavarjan Branch, Islamic Azad Unversity, Isfahan, Iran
3 Assistant professor of Aquatic Animal Health and Diseases, Department of Biotechnology, Falavarjan Branch, Islamic Azad University, Isfahan, Iran
چکیده [English]

Introduction: Gram-negative bacteria are the most pathogenic bacteria for marine organisms including ornamental fish.

Materials and methods: In the present study Vibrio species isolated from ornamental guppy fish in Kashan, Isfahan, Iran fish ponds and were detected according to molecular detection and genetic alignment. Liver, kidney, skin, brain and gill samples were taken from ornamental guppy fish in Kashan, Isfahan, Iran. Samples were cultured on enriched culture media and purification steps were performed based on microbiological methods. Primary identification was done using biochemical characterization of the isolated bacteria. Molecular detection was done based on amplification of 16SrDNA sequence of Vibrio cholera genome containing ITS (internal transcribed spacer); and sequence alignment of the amplified nucleotides.

Results: The isolated bacteria detected as Vibrio spp., including Vibrio cholera (99% sequence similarity), Vibrio alginolyticus, Vibrio mimicus and Vibrio parahaemolyticus (up to 90% similarity in the genome sequence). The aquaculture ponds had alkaline water and the amount of five-day BOD was not in a safe range, which are favorable conditions for Vibrio species.

Discussion and conclusion: Aquatic organisms in Iran can be carriers of human pathogens such as Vibrio species. The results obtained in the present study and similar investigations should be mentioned in aquaculture healthcare systems.

کلیدواژه‌ها [English]

  • Vibrio spp
  • Ornamental guppy fish
  • Genetic alignment
  • Water Quality

Introduction

More than twenty thousand species of freshwater ornamental fish exist in the world. Guppy fish (Poecillia reticule) is one of the most familiar ornamental fish in many countries, including Iran. The length of the fish is up to 7 cm. The fish swims in mid water. The guppy fish can coexist with all other fish. Examples of guppy fish are snakeskin, red tail, yellow tail, singaporean, blue tail, rabbit tail and glass- belly (1).

All fish are in the exposure of infections caused by different kinds of bacteria, fungi and viruses (2), however bacteria particularly Gram- negative species, are the most common agents of infectious diseases in ornamental fish (3). Environmental factors such as stress, poor quality of water, sewage pollution, unhygienic handling of fish and polluted aquaculture feeding can result in increasing of susceptibility to infections among fish (4 & 5). However, immune system deficiency of fish enhances the morbidity of infection (6).

Streptococcus, Mycobacterium, Aeromonas, Pseudomonas, Edwardsiella, Yersinia and Vibrio are the most infectious bacterial genera in fish (2). Vibrio spp. can cause septicemia in fish. The disease will be adversed by temperature change or environmental stress. It is estimated that vibrios consist approximately 60% of total heterotrophic bacteria in aquarium and are from opportunistic fish pathogens (7). As Vibrio species especially Vibrio cholera is from powerful human pathogens and possibly transmitted among aquarists in countries which are outside cholera endemic areas (8), it is necessary to be considered in aquaculture healthcare systems in our country.

During the last decade, biologists have employed different molecular techniques in phylogenetics, evolution, and population diversity. Analysis of 16S (small subunit) rDNA and, more recently, 16S internal transcribed spacer (ITS) has been used greatly in these studies on prokaryotic microorganisms (9).

The aim of the present study was to detect Vibrio species isolated from ornamental guppy fish using biochemical and molecular species.

 

Materials and methods

Samples and isolation of the bacteria: In a period of time from January to September 2012, skin, gill, kidney and brain tissue samples were obtained from symptomatic guppy in five aquaculture ponds in Kashan, Iran. The samples obtained from a total of 40 symptomatic guppy fish. The included symptoms were: ulcer, pop eye, cloudy eye, dropsy, columnaris, mouth rot, tail rot and bloated stomach. The samples inoculated on enriched culture media including brain heart infusion broth, tripticase soy broth and blood agar. The culture media were incubated at 32°C for 24 hours. The isolated bacteria were identified using conventional biochemical analysis (10 & 11).

Due to the effect of water quality on the general health of fish; the amount of dissolved oxygen (DO), acidity (pH) and five- day biochemical oxygen demand (BOD) of the pond water was measured on the sites of sampling.

DNA extraction and sequence amplification: DNA content of media was extracted using Roche Applied Science DNA extraction kit. Pairs of primers were used according to the specific genome sequences of the biochemical detected bacteria. The characteristics of primers and information about amplification by polymerase chain reaction (PCR) are shown in table 1. A mixture consists of 1X PCR buffer, 0.2 mM dNTP mix, 1.5 mM MgCl2, 0.5 mM of each primer, 1 unit.ml-1 Taq DNA polymerase and 1 mg of the extracted DNA was used for each amplification reaction. The products analyzed by gel electrophoresis using 1% agarose.

Sequence analysis of the amplified fragments: The final products have been sequenced by ABI3730XL system (Bioneer Corporation, Korea) and aligned in BLAST data base. Also the content of amplified fragment was analyzed by Gene runner program version 3.05. Phylogenetic and molecular evolutionary analyses were conducted using MEGA version 4 (13).

 

Results

Water quality parameters: The amount of dissolved oxygen (DO), pH and five- day biochemical oxygen demand (BOD) of the pond water are shown in table 2.

The isolated bacteria: All isolates showed similarity to Vibrio spp., according to morphological and biochemical analysis. Detection of bacteria using biochemical tests is shown in table 3. The amount of 5% of samples (2 fish) was infected to Vibrio spp., according to biochemical tests. Both infected fish were obtained from the same pond.

Molecular detection: As the results of molecular amplification, the 750bp fragment amplicon of Vibrio spp. 16SrDNA were obtained (Fig. 1). Both samples were detected as positive by PCR.

 

 

Fig. 1- The amplified fragment for Vibrio spp. 16SrDNA. The amplicon was 750 bp in length.

 

Table 3- The morphological and biochemical characteristics of the isolated bacteria, which were similar to Vibrio spp.

Isolate number 1

Characteristics

Gram- negative bacilli

Morphology and Gram staining

Beta

Haemolysis on blood agar

_

Indole production

+

Methyl red reaction

_

Voges- Proskauer reaction

+

Citrate utilization

+

Urease

+

SH2 production

+

Motility

+

Catalase

_

Oxidase

Fermentative

Oxidative/Fermentative

+

Glucose fermentation

+

Xylose fermentation

_

Lactose fermentation

+

Sorbitol fermentation

+

Saccharose fermentation

+

Mannitol fermentation

Vibrio Spp.

Probable identified species

 

 

 

 

 

Table 1: Primer sequences and characteristics of amplification procedures.

Reference

Amplified fragment

Amplification cycle

Primer sequence

Isolated bacterium

12

16SrDNA

(750 bp)

Step 1: 94°C, 3 min

Step 2: 94°C, 1 min; 63°C, 1 min; 72°C, 1 min (35 repeats)

Step 3: 72°C, 5 min

 

CGGTGAAATGCGTAGAGAT

TTACTAGCGATTCCGAGTTC

Vibrio SPP.

 

Table 2- The average of water quality measures in sampling ponds shows low quality of water for fish culturing.

Water dissolved oxygen (OD)

Five- days biochemical oxygen demand (BOD)

water Temperature (⁰C)

 

pH (acidity) of water

6.98

89.8

25

9.97

 

Table 4- The nucleotide sequence of fragments amplified from Vibrio spp.

 

 

 

Fig. 2. Phylogenic tree confirmed the isolate Vibrio cholera FJ147 after alignment in MEGA version 4.

 


 

 

 

 

 

 

 

 

Sequenceing analysis: Alignment of the amplified regions of both species in BLAST data base detected that the isolated Vibrio spp. has the most sequence similarity to Vibrio cholera (99%). Also this fragment had partial similarity to Vibrio alginolyticus, Vibrio mimicus and Vibrio parahaemolyticus (up to 90%). The nucleotide sequences of the amplified fragments are shown in table 4. Also the phylogenic tree which resulted from alignment in MEGA version 4 illustrated in Fig 2. As shown in phylogenic tree, the sequences belong to Vibrio cholera isolate FJ147. The internal transcribed spacer (ITS) sequences detected in the amplicon by Gene Runner version 3.05.

 

Discussion and conclusion

Researches on bacterial diseases of ornamental fish (including guppy fish) in Iran are not well established. Many isolated Gram- negative pathogenic bacteria have been reported all over the world which often causes severe symptoms such as septicemia in aquatic organisms (3). These bacteria can be transmitted and be pathogenic for human being (14).

Kashan, is one of the largest ornamental fish culture areas in Iran, so this area was selected for fish sampling in the present study. Because guppy fish is one of the most favorable ornamental fish in Iran and is from the most susceptible fish to infection (3), the samples were obtained from the guppy culturing ponds.

Risks of infections and poisoning are one of the challenges facing ornamental aquaculture industry. Microbial diseases of ornamental fish are divided into two categories of infectious and parasitic diseases. Infectious diseases mainly caused by bacteria, viruses and fungi. The bacterial strains that are associated with fish infection are mostly usual saprophytic species which exist extensively in the aquatic environments. A few of these species are of the real obligate pathogens. These microorganisms exist on the external surface of body or tissue and may be present in healthy- appearing fish. These bacteria almost show their pathogenic features, when the environmental conditions are not suitable for fish or fish exposed to different kinds of stresses (1 & 5). As shown in table 4 Kashan aquaculture ponds had alkaline water. Also the amount of five- day BOD was not in a safe range. These conditions are favorable for Vibrio species.

The genus Vibrio includes symbionts and commensals that are found inside and on the surface of marine animals. Indeed many species are pathogenic to animals (15). In the present study Vibrio species were isolated from guppy ornamental fish. 16SrDNA analysis detected the most similarity to Vibrio cholera (99%), although the alignment in other specie showed up to 90% similarities to Vibrio alginolyticus, Vibrio mimicus and Vibrio parahaemolyticus. All species, especially Vibrio cholera, the etiologic agent of cholera, have been established as human pathogens (12 & 15).

In a previous report, Vibrio cholerae 01 has been detected from aquarium water and fish imported in Thailand and Sri Lanka (8). This bacterium has been detected as autochthonous microorganisms to various aquatic environments (16).

The present study in Iran as well as the previous reports all over the world shows that aquatic organisms can be carriers of human pathogens.

(1) Evans JP., Magurran AE. Multiple benefits of multiple mating in guppies. Proceedings of the National Academy of Sciences 2000; 97 (18): 10074- 6.

(2) Noga EJ. Fish disease: diagnosis and treatment. 1st Ed., USA: Iowa State University Press; 2000.

(3) Lewbart GA. Bacteria and ornamental fish.Seminars in Avian and Exotic Pet Medicine 2001; 10 (1): 48- 56.

(4) Reilly A., Käferstein F. Food safety and products from aquaculture. Journal of Applied Microbiology 1998; 85 (S1): 249S- 257.

(5) Kigigha LT., Oku IY., Ojesanmi AS. Enumeration and characterization of bacteria associated with backwater fish species in Wilberforce island Bayelsa state Nigeria. Continental Journal of Biological Sciences 2012; 5 (1): 32- 7.

(6) Toranzo AE Magariños B and Romalde JL. A review of the main bacterial fish diseases in mariculture systems. Aquaculture 2005; 246 (1- 4): 37- 61.

(7) Shariff M., Subashinghe RP., Arthur JR. Diseases in Asian aquaculture, 1st Ed., Malaysia: Fish Health Section, Asian Fisheries Society; 1992.

(8) Plesník V., Procházková E. Vibrio cholerae 01 in a fish aquarium. Epidemiology Microbiology and Immunology 2006; 55 (1): 30- 1.

(9) Boyer SL., Flechtner VR., Johansen JR. Is the 16S–23S rRNA internal transcribed spacer region a good tool for use in molecular systematics and population genetics? A case study in cyanobacteria. Molecular Biology and Evolution 2001; 18 (6): 1057- 69

(10)            Holt JG., Krieg NR., Sneath PHA., Staley JT., Williams ST. Bergey's manual of determinative bacteriology, 12th Ed., USA: Lippincott Williams and Wilkins,; 2012.

(11)            Mahon MR., Lehman DC., Manuselis G. Textbook of diagnostic microbiology, 4th Ed., USA: W.B. Saunders; 2010.

(12)            Tarr CL., Patel JS., Bopp CA., Puhr ND., Sowers EG., Strockbine NA. Identification of Vibrio isolates by a multiplex PCR assay and sequence determination. Journal of Clinical Microbiology 2007; 45 (1): 134- 40.

(13)            Tamura K., Dudley J., Nei M., Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 2007; 24: 1596- 9.

(14)            Geran J. The proper care of goldfish. 1st Ed., USA: TFH Publications; 1992.

(15)            Thompson FL., Iida T., Swings J. Biodiversity of Vibrios. Microbiology and Molecular Biology Reviews 2004; 68 (3): 403- 31.

(16)           Senderovich Y., Izhaki I., Halpern M. Fish as reservoirs and vectors of Vibrio cholerae. Public Library of Science since One 2010; 5 (6): e8607.