جداسازی و غربال‏ گری باکتری بومی سیتروباکتر‏‏ با تحمل‏ پذیری بالا به نیکوتین و معرفی آن به عنوان بیوکاتالیست برای پاک‏سازی زیستی نیکوتین

نوع مقاله: پژوهشی- فارسی

نویسنده

استادیار میکروبیولوژی، دانشکده علوم، دانشگاه کردستان، سنندج، ایران

چکیده

مقدمه: نیکوتین از آلکالوئیدهای گیاهی سمی است که سازمان حفاظت محیط زیست آمریکا آن را از سال 1994در زمره مواد خطرناک برای سلامت انسان و محیط زیست قرار داده است. پژوهش حاضر، در زمینه غربال‏گری باکتری‏های مقاوم به نیکوتین برای استفاده به عنوان بیوکاتالیست در پاک‏سازی نیکوتین از مکان‏های آلوده انجام شده است. ‏‏‏

مواد و روش‏‏ها: نمونه‏های خاک جمع‏آوری شده از 12 مزرعه زیر کشت توتون به عنوان محل‏های هدف برای نمونه‏گیری انتخاب شد. غنی‏سازی جدایه‏های باکتری تجزیه کننده نیکوتین در محیط‏های پایه نمکی حاوی نیکوتین به عنوان تنها منبع کربن و ازت انجام شد. آزمون الگوی تحمل‏پذیری ذاتی جدایه‏ها به نیکوتین با استفاده از روش رقت در آگار انجام شد. تعیین هویت سویه منتخب بر اساس آزمون‏های فنوتیپیک و فیلوژنیک انجام شد. به منظور تعیین شرایط مطلوب حذف نیکوتین در سویه منتخب، اثر غلظت نخستین نیکوتین، زمان گرماگذاری و اثر منابع کربن و ازت کمکی بررسی شد. اندازه‏گیری میزان نیکوتین باقی مانده با استفاده از کروماتوگرافی مایع با عملکرد بالا (HPLC) انجام شد. ‏‏‏

نتایج: از مجموع 20 سویه جداشده تجزیه کننده نیکوتین، سویه باکتری TPS2 بالاترین مقاومت و حذف نیکوتین را نشان داد. نتایج آزمون‏های فنوتیپیک و فیلوژنیک نشان داد که سویه یاد شده به جنس سیتروباکتر‏‏ (با کد شناسایی KM110046 در بانک ژن) تعلق دارد. بر اساس نتایج به دست آمده از آزماش‏های نیکوتین‏زدایی در سویه TPS2، پس از گذشت 60 ساعت کمابیش 100 درصد نیکوتین حذف شد. البته در شرایطی که 5/2 گرم در لیتر نیکوتین همراه با 5/2 گرم در لیتر قند فروکتوز استفاده شد. ‏‏‏

بحث و نتیجه‏ گیری: نتایج نشان داد که باکتری سیتروباکتر‏‏ غربال‏گری شده گزینه مناسبی برای پاک‏سازی زیستی نیکوتین از پساب صنایع و مکان‏های ‏‏آلوده است‏. انتظار می‏رود که با استفاده از این بیوکاتالیست میکروبی بتوان مشکلات زیست محیطی ناشی از نیکوتین سمی را کاهش داد. مطالعه اخیر نخستین گزارش از معرفی یک میکروارگانیسم بومی تجزیه کننده نیکوتین است. ‏‏‏

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Isolation and Screening of a native Citrobacter sp. with high nicotine-tolerant and its application as a biocatalyst for biodegradation of nicotine

نویسنده [English]

  • Morahem Ashengroph
Assistant Professor of Microbiology, Department of Biological Sciences and Biotechnology, Faculty of Sciences, University of Kurdistan, Iran
چکیده [English]

Introduction: Nicotine is a toxic plant alkaloid and it has been designated as hazardous by the United States Environmental Protection Agency (USEPA) since 1994. The present work was directed to screen nicotine resistant bacteria, that is used as biocatalyst in the biodegradation of nicotine from contaminated sites.

Materials and methods: Collected soil samples from 12 tobacco farms were selected as target sites for sampling. Enrichment nicotine-degrading bacteria were performed in minimal salt media containing nicotine as the sole carbon and nitrogen sources. Agar dilution plate method was performed for determining intrinsic tolerance of bacterial isolates to nicotine. Phenotypic characterization and phylogenetic analysis were used to identify the selected bacterial isolate able to degrade nicotine. To determine the optimal conditions for the bio-removal of nicotine, the effects of initial nicotine concentration, incubation time and the addition of carbon and nitrogen sources in the selected strain were tested. The quantification of residual nicotine in the culture media was measured by high performance liquid chromatography (HPLC).

Results: Among 20 bacterial isolates for degradation of nicotine, the strain TPS2 showed a high level of resistance and degradation efficiency. Results of phenotypic identification and phylogenetic analysis showed the native strain TPS2 belongs to the Citrobacter sp. strain TPS2 (GeneBank accession no. KM110046). According to the results of de-nicotination experiment, the native strain TPS2 is able to remove 100% of nicotine with an initial concentration 2.5 g/l in the presence of 2.5 g/l fructose.

Discussion and conclusion: The results showed that the screened Citrobacter sp. was suitable candidate for degradation of nicotine from wastewater and sites that contaminated with nicotine. It is seemed by using of the microbial biocatalyst the ecosystem contamination of toxic nicotine can be decreased. The present work is the first report on the degradation of nicotine by native microorganisms.

کلیدواژه‌ها [English]

  • Biocatalyst
  • Citrobacter sp
  • Intrinsic tolerance pattern
  • Nicotine degradation

مقدمه.

نیکوتین با فرمول بسته C10H14N2، آلکالوئید اصلی گیاه توتون [1] بوده، به‏طوری که 3 تا 5 درصد وزن خشک (وزنی/ وزنی) برگ‏های توتون را تشکیل می‏‏دهد. این ماده به عنوان تحریک کننده و در عین حال مهار کننده گیرنده‏های گانگلیوزیدی عمل کرده و ایجاد وابستگی و اعتیاد را در مصرف کننده به همراه دارد (1). در ارتباط با آثار زیان‏بار نیکوتین بر سلامت انسان، پژوهش‏های زیادی انجام شد‏‏ه و امروزه بدون شک نیکوتین در ردیف مواد سمی خطرناک معرفی می‏‏شود. با ورود نیکوتین به بدن، اختلالات فیزیولوژیک شدید از قبیل اختلالات گوارشی، اختلالات بینایی و شنوایی، افت شدید فشار خون، افزایش و نامنظم بودن ضربان‏های قلب، کلاپس قلبی- عروقی، نارسایی تنفسی، تشنج و در نهایت، مرگ را به دنبال خواهد داشت (2). نیکوتین هم در دود ناشی از مصرف دخانیات و هم در شیره حاصل از انواع جویدنی تنباکو وجود دارد. همچنین، نیکوتین در زباله‏ها و پسماندهای صنایع مختلف از جمله کارخانه‏های تولید دخانیات، سموم دفع آفات و صنایع دارویی وجود دارد و سبب آلودگی محیط زیست به ویژه‏‏ منابع آب (به خاطر ماهیت هیدروفیلیک نیکوتین) می‏‏شود (3 و 4). سالانه میلیون‏ها تن پسماند حاوی نیکوتین در سرتاسر دنیا تولید می‏‏شود که در برخی از این پسماندها غلظت نیکوتین ورودی بیش از 8/1 درصد (وزنی/ حجمی) تخمین زده شده است (5). این در حالی است که بر اساس استانداردهای زیست محیطی اتحادیه اروپا، چنانچه غلظت نیکوتین در پساب‏ها و فاضلاب‏های تولیدی از 05/0 درصد (وزنی/ حجمی) تجاوز کند، این فاضلاب‏ها در زمره مواد بسیار سمی و خطرناک رده‏بندی ‏‏می‏‏شوند (6). با توجه به روند رو به رشد صنایع مرتبط با نیکوتین و به تبع آن مشکلات درمانی و زیست- محیطی ناشی از تجمع ضایعات و پسماند‏های نیکوتینی در طبیعت، ضرورت حذف نیکوتین سمی از محیط‏های آلوده کاملا ضروری است. برای تصفیه و پاک‏سازی فاضلاب‏های حاوی نیکوتین روش‏های فیزیکی- شیمیایی و زیستی متعددی وجود دارد که در این میان، استفاده از میکروارگانیسم‏ها به عنوان کاتالیست‏های زیستی برای پاک‏سازی محیط‏های آلوده به نیکوتین می‏‏تواند مؤثر و ارزان باشد و ایمنی محیطی را تضمین کند‏‏ (6 و 7). اگرچه نیکوتین در غلظت‏های پایین برای بیشتر‏‏ میکروارگانیسم‏ها به شدت سمی است، با این حال باکتری‏های مختلفی با پتانسیل تجزیه‏کنندگی نیکوتین از منابع مختلف جداسازی و تعیین هویت شده‏اند. از مهم‏ترین باکتری‏های تجزیه کننده نیکوتین می‏‏توان گونه‏های ‏‏مختلف جنس‏های ‏‏آسینتوباکتر [2] (8)، آگروباکتریوم [3] (9)، آرتروباکتر [4] (10 و 11)، سلولوموناس [5] (12)، انسی فر [6] (4)،آگروباکتروم [7] (13)، سودوموناس [8] (5، 14- 19) و رودوکوکوس [9] (20) را نام برد. با توجه به آثار سمی نیکوتین و اینکه ورود آن به اکوسیستم‏های ‏‏آبی و خاکی می‏تواند زندگی انسان و سایر موجودات را تهدید کند و با توجه به نبود پژوهش متکی بر میکروارگانیسم‏های ‏‏بومی، ضرورت جداسازی و غربال‏گری میکروارگانیسم‏های ‏‏با پتانسیل پاک‏سازی نیکوتین مشخص می‏شود. هدف از انجام پژوهش حاضر، در مرحله اول، جداسازی و تعیین ویژگی باکتری‏های ‏‏با پتانسیل تحمل‏پذیری ذاتی بالا نسبت به نیکوتین، بررسی توانایی این باکتری‏ها در استفاده از نیکوتین به عنوان تنها منبع کربن و ازت و در انتها، تأثیر منابع کربن و ازت کمکی بر فرآیند حذف نیکوتین با هدف بهره‏برداری از این بیوکاتالیست برای پاک‏سازی نیکوتین سمی از محیط‏های ‏‏آلوده در پروژه‏های ‏‏آتی است‏. در این راستا سویه‏های باکتری متعددی از خاک‏های زیر کشت توتون از مناطق مختلف ایران جدا و برای نخستین بار تجزیه زیستی نیکوتین در جنس سیتروباکتر‏‏ [10]گزارش شد.

 

‏‏مواد و روش‏ها.

.مواد شیمیایی و محیط‏های ‏‏کشت میکروبیولوژیک: نیکوتین (99 درصد) برای آزماش‏های نیکوتین‏زدایی از شرکت سیگما [11] خریداری شد. متانول با درجه خلوص بالا و مخصوص HPLC از مرک [12] تهیه شد. محیط کشت نوترینت آگار [13] (5 گرم در لیتر پپتون، 3 گرم در لیتر عصاره گوشت و 20 گرم در لیتر آگار و pH برابر با 4/7) از شرکت کاردان آزما [14] خریداری شد. نمک‏های KH2PO4، K2HPO4، NaCl، MgSO4، FeSO4 و CaCl2 برای تهیه محیط‏های پایه نمکی
ʺNic-medium agarʺ متشکل از ترکیبات زیر (بر حسب گرم در لیتر) از کمپانی کیولب [15] خریداری شد‏‏. مواد به کار گرفته شده در واکنش زنجیره‏‏ای ‏‏پلیمراز از شرکت سیناژن تهیه شد.

KH2PO4: 4; K2HPO4.3H2O: ‏‏3/13; MgSO4.7H2O: ‏‏2/0; CaCl2: ‏‏015/0; NaCl: 5/0; FeSO4.7H2O: ‏‏03/0; Agar: ‏‏20

.نمونه‏برداری ‏‏و غنی‏سازی باکتری‏های تجزیه کننده نیکوتین: با توجه به هدف پژوهش، مناسب‏ترین ‏‏مکان برای نمونه‏گیری خاک‏های زیر کشت توتون بود. برای این منظور 12 مزرعه توتون در اطراف استان‏های مازندران، گیلان، گلستان، اصفهان و کردستان به عنوان محل‏های هدف برای نمونه‏گیری انتخاب شد. نمونه‏های خاکی در ظروف پلاستیکی درب‏دار استریل جمع‏آوری و پس از انتقال به آزمایشگاه تا زمان استفاده در دمای 4 درجه سانتی گراد نگهداری شد. در ادامه برای غنی‏سازی باکتری‏های بومی تجزیه کننده نیکوتین از یک روش غنی‏سازی طبق روش پیشنهادی لیو [16] و همکاران (19)، با اندکی تغییرات، استفاده شد. برای این منظور، ابتدا سوسپانسیونی از نمونه‏های خاک جمع‏آوری شده در سرم فیزیولوژیک استریل (محلول نمک سدیم کلراید با غلظت 85/0 وزنی/ حجمی) تهیه شد. پس از تهیه رقت‏های متوالی از 1-10 تا 5-10 حدود 100 میکرولیتر از سوسپانسیون یاد شده به عنوان مایه تلقیح به محیط‏های پایه نمکی (Nic Medium Agar) انتقال یافت. به محیط یاد شده نیکوتین، پس از استریل شدن از طریق فیلتر‏های سر سرنگی 22/0 میکرونی، در غلظت نهایی 5/2 گرم در لیتر به عنوان تنها منبع کربن و ازت افزوده شد. سپس، محیط‏های کشت تلقیح شده در شرایط تاریکی و در دمای 30 درجه سانتی‏گراد به مدت 3 تا 5 روز گرماگذاری شد. در صورت مشاهده رشد، از تک کلونی‏‏های رشد یافته برای کشت خطی روی پلیت‏های ʺNic-medium agarʺ تا حصول اطمینان از خالص شدن کلونی‏‏ها استفاده شد. پس از بررسی‏های ریخت‏شناسی ‏و انجام برخی آزمون‏های بیوشیمیایی استاندارد، کلونی‏‏های یاد شده به عنوان باکتری‏های واقعی تجزیه کننده نیکوتین در محیط‏های اسلنت دار نوترینت آگار حاوی 1 گرم در لیتر نیکوتین برای آزماش‏های بعدی انتقال داده شدند.

.ارزیابی میزان تحمل‏پذیری ذاتی باکتری‏های تجزیه کننده نیکوتین و انتخاب باکتری کارآمد: با هدف شناسایی و انتخاب سویه‏های باکتری برتر با قابلیت حذف زیستی نیکوتین، در ابتدا آزمون تعیین الگوی تحمل‏پذیری ذاتی جدایه‏ها نسبت به نیکوتین در محیط‏های سنتتیک و کمپلکس با استفاده از روش رقت در آگار[17] انجام شد (21). برای این منظور، ابتدا محیط‏های سنتتیک ʺNic-medium agarʺ و کمپلکس نوترینت آگار با غلظت‏های مختلف نیکوتین تهیه شد (غلظت‏های نیکوتین: 3، 4، 5، 6، 7، 8، 9، 10، 11، 12 و 13 گرم در لیتر). 11 ارلن 250 میلی‏‏لیتری هر کدام حاوی 40 میلی‏‏لیتر محیط نوترینت آگار ذوب شده و 11 ارلن 250 میلی‏‏لیتری حاوی 40 میلی‏‏لیتر
ʺNic-medium agarʺ ذوب شده تهیه و توسط دستگاه اتوکلاو استریل شد. سپس، با استفاده از فیلترهای سرسرنگی 22/0 میکرونی، حجم مورد نیاز از استوک نیکوتین استریل به ارلن‏ها اضافه شد. محیط‏های موجود در ارلن‏های یاد شده درون پلیت‏های (با قطر 12 سانتی‏متری) جداگانه ریخته شد و هر پلیت با خط کش به 20 قسمت مساوی (به تعداد میکروارگانیسم‏های جدا شده) تقسیم شد‏‏. پس از تهیه نیم مک فارلند
 ( CFU/ml108 × 5/1) از سویه‏های باکتری مورد آزمایش، به میزان 10 میکرولیتر از سوسپانسیون میکروبی درون پلیت‏های یاد شده تلقیح شد. پلیت‏ها در دمای 30 درجه سانتی‏گراد به مدت یک هفته گرماگذاری شدند. آزماش‏های سه بار تکرار شد. در ادامه و پس از شناسایی سویه‏های با قابلیت تحمل‏پذیری بالا، به منظور انتخاب سویه منتخب از روش کروماتوگرافی استفاده شد. برای این هدف، سویه‏های تحمل پذیر در محیط غربال‏گری nic-medium brothʺʺ با غلظت نهایی 5/2 گرم در لیتر نیکوتین به مدت 48 ساعت در دمای 30 درجه سانتی‏گراد و دور شیکر rpm 180 رشد داده شدند. سپس، تحلیل‏‏ کیفی HPLC برای انتخاب سویه باکتری کارآمد انجام شد. در تمام مراحل آزمایش، یک نمونه شاهد بدون تلقیح باکتری استفاده شد (19).

.تعیین هویت سویه منتخب TPS2 بر اساس آزمون‏های فنوتیپیک و فیلوژنیک: شناسایی مقدماتی سویه TPS2 بر اساس ویژگی‏های ریخت‏شناسی ‏و آزمون‏های تشخیصی بیوشیمیایی از جمله رنگ و شکل ظاهری کلونی‏، رنگ آمیزی گرم، آزمون‏‏‏‏های کاتالاز و اکسیداز، آزمون‏‏‏ حرکت، احیای نیترات، هیدرولیز اوره، آزمون‏‏‏ اندول، متیل رد، وژپروسکوئر، مصرف سیترات، رشد در شرایط بی هوازی، تولید H2S و رشد بر روی محیط کشت مک کانکی آگار انجام شد (22). در ادامه به منظور شناسایی دقیق‏تر سویه باکتری TPS2، از روش توالی‏یابی 16S rRNA استفاده شد. استخراج DNA ژنومی سویه TPS2 با استفاده از کیت [18] انجام شد. کمیت و کیفیت DNA استخراجی با روش‏های اسپکتروفتومتریک و الکتروفورز مشخص شد. به منظور تکثیر بخشی از توالی 16S rRNA به طول 370 جفت باز از یک جفت پرایمرهای همگانی به نام‏های rw01 (پرایمر رفت با توالی AACTGGAGGAAGGTGGGGAT) و dg74 (پرایمر برگشت با توالی AGGAGGTGATCCAACCGC) استفاده شد (23). تکثیر محصول PCR بر اساس اطلاعات جدول‏های 1 و 2 انجام گرفت.

 

جدول 1- مواد مورد نیاز برای انجام واکنش PCR در سویه

مواد

حجم لازم برای واکنش با حجم نهایی 50 میکرولیتر

غلظت اولیه

بافر PCR

5

10 X

مخلوط dNTP

4

5/2 میلی‏‏‏‏مولار

MgCl2

5/1

50 میلی‏‏‏‏مولار

پرایمر Forward

2/0

125 میکرومولار

پرایمر Reverse

2/0

125 میکرومولار

Taq polymerase

2/0

5 واحد آنزیم در میکرولیتر

DNA الگو

1

1 میکروگرم بر میکرولیتر

آب MiliQ

9/37

-

 

جدول 2- چرخه حراتی واکنش PCR انجام شده برای تعیین جنس

ردیف

دما (درجه سانتی‏گراد)

زمان (دقیقه)

تعداد چرخه

سیکل اول

94

2

1

سیکل دوم

94

5/0

30

60

5/0

72

45/0

سیکل سوم

72

2

1

 

محصول PCR با استفاده از ژل الکتروفورز 5/1 درصد، ولتاژ 90 و در شرایط بافری TBE بررسی شد. محصول حاصل از PCR (در حدود 370 جفت باز) برای توالی‏یابی ‏‏‏‏به کمپانی ماکروژن کره جنوبی ارسال شد. برای تعیین همولوژی، توالی حاصل با توالی‏های موجود در بانک NCBI از طریق الگوریتم [19] BLASTN مقایسه شد. به منظور ثبت توالی نهایی به دست آمده در بانک ژنی GeneBank از نرم افزار [20] sequin 13.05 استفاده شد. تجزیه و تحلیل فیلوژنیک و ترسیم درخت به کمک نرم افزارهای BioEdit و [21] MEGA.6 و بر پایه روش neighbor-joining و با Bootstrap 1000 تکرار انجام شد (24).

.ارزیابی میزان حذف زیستی نیکوتین توسط سویه بومی TPS2 و اثر برخی عوامل بر روی آن: در این مرحله، میزان کمی حذف زیستی نیکوتین در سویه باکتری TPS2 که بر اساس تحلیل‏‏های پروفایل تحمل‏پذیری و تحلیل‏‏ کیفی HPLC به عنوان سویه برتر انتخاب شد، سنجش شد. برای این کار محیط‏های کشت ʺNic-medium brothʺ تهیه و با اتوکلاو استریل و سپس، نیکوتین استریل در غلظت‏های مختلف (5/0، 5/1، 5/2 و 4 گرم در لیتر) استفاده شد‏‏. از سویه برتر، 5/0 مک فارلند تهیه و 3 درصد از آن به محیط‏های یاد شده تلقیح شد. سویه یاد شده در یک دوره 48 ساعته در شیکر انکوباتور با دور 180 و دمای 30 درجه سانتی‏گراد رشد داده شد. درصد حذف نیکوتین با استفاده از دستگاه HPLC تعیین شد. در دستگاه [22] HPLC از ستون C18 (اندازه قطر ذرات فاز ثابت 5 میکرون)، به طول 25 سانتی‏متر و قطر داخلی 6/4 میلی‏‏متر استفاده شد. فاز متحرک به کار گرفته شده مخلوطی از متانول/ اسید سولفوریک یک میلی‏‏مولار (به نسبت 5 به 95 حجمی/ حجمی) بود که به شکل ایزوکراتیک با سرعت 5/0 میلی‏‏لیتر در دقیقه روی ستون فرستاده شد. طول موج استفاده شده 260 نانومتر و حجم تزریق شده 20 میکرولیتر بود. تمام مراحل آزمایش در دمای اتاق انجام گرفت (19). در شرایط کروماتوگرافی یاد شده، زمان بازداری [23] برای نیکوتین در زمان 6/6 دقیقه به دست آمد. در ادامه و پس از تعیین غلظت بهینه نیکوتین و بررسی اثر منابع کربن مختلف (گلوکز، فروکتوز، سوکروز، گلیسرول و سیترات سدیم) و منابع ازت مختلف (عصاره مخمر، تریپتون، اوره و کلرید آمونیوم)، دوره زمانی درصد حذف نیکوتین توسط سویه بومی TPS2 در محیط‏های نمکی حاوی نیکوتین به عنوان تنها منبع کربن و ازت و محیط‏های نمکی نیکوتین دار حاوی منابع کربن و ازت بهینه سنجش شد.

 

نتایج.

.نتایج غربال‏گری باکتری‏های مقاوم به نیکوتین و انتخاب سویه باکتری بومی برتر: در آزماش‏های غربال‏گری نخستین، 20 سویه باکتری بومی تجزیه کننده نیکوتین از خاک‏های زیر کشت توتون از مناطق مختلف ایران بر اساس روش غنی‏سازی جداسازی شد که در بررسی‏های ریخت‏شناسی ‏نخستین مشتمل بر 10 باسیل گرم منفی، 3 کوکسی گرم مثبت، 2 باسیل گرم مثبت و 5 کوکوباسیل گرم منفی بودند. تحمل‏پذیری ذاتی میکروارگانیسم‏های جداسازی شده نسبت به نیکوتین در محیط‏های کشت سنتتیک و کمپلکس بر اساس روش رقت در آگار تعیین شد (جدول 3).

 

جدول 3- الگوی تحمل‏پذیری جدایه‏های ‏‏باکتری تجزیه کننده نیکوتین در محیط‏های ‏‏کشت سنتتیک و کمپلکس

محیط کشت نمکی Nic

میزان تحمل‏پذیری (گرم در لیتر)

جدایه باکتری

محیط کشت نوتینت آگار

 

7

11

TPS1

8

12

TPS2

6

11

TPS3

6

12

TPS4

کمتر از 5

کمتر از 10

سایر 16 جدایه باکتری

 

 

 

 

 

میزان تحمل‏پذیری جدایه‏های باکتری نسبت به نیکوتین در محیط‏های سنتتیک بین 3 تا 8 گرم در لیتر و در محیط‏های کمپلکس 6 تا 12 گرم در لیتر بود. با توجه به نتایج و بررسی جدول 3 مشخص شد که 4 سویه باکتری (نام‏گذاری شده با عنوان TPS1-TPS4) بالاترین مقاومت را نسبت به نیکوتین (بالاتر از 5 گرم در لیتر در محیط‏های سنتتیک و بالاتر از 10 گرم در لیتر در محیط‏های کمپلکس) را نشان دادند که بر این اساس به عنوان سویه‏های برتر برای آزماش‏های بعدی غربال‏گری برگزیده شدند. در بخش دیگر از این کار پژوهشی، با هدف انتخاب سویه برتر، ارزیابی میزان حذف زیستی نیکوتین در سویه‏های مقاوم با استفاده از تحلیل‏‏ کیفی HPLC مطالعه شد (شکل 1). همان‏گونه که در شکل 1 نشان داده شده است سویه مقاوم TPS2 (جدا شده از خاک زیر کشت توتون مازندران) در مقایسه با 3 سویه مقاوم دیگر توانایی بالاتری در حذف زیستی نیکوتین از محیط‏های کشت سنتتیک داشت. در کشت‏های کنترل (حاوی 5/2 گرم در لیتر نیکوتین و بدون تلقیح باکتری) حذف زیستی نیکوتین مشاهده نشده است که نشان می‏‏دهد نیکوتین قابلیت حذف شدن در شرایط غیر زیستی‏‏‏‏ را ندارد.

نتایج تعیین هویت سویه بومی TPS2: سویه TPS2 را که بر اساس پروفایل تحمل‏پذیری و تحلیل‏‏ HPLC قابلیت بالاتری در حذف زیستی نیکوتین از محیط‏های کشت حاوی نیکوتین را داشت را انتخاب و بر اساس ویژگی‏های ریخت‏شناسی ‏و بیوشیمیایی شناسایی شد. جدول 4 ویژگی‏های تاکسونومیک سویه باکتری TPS2 را نشان می‏دهد.

 

 

 

جدول 4- آزمون‏های ‏‏ماکروسکوپی، میکروسکوپی و بیوشیمیایی سویه باکتری TPS2

آزمون‏های ‏‏شناسایی

سویه باکتری TPS2

ریخت شناسی

میله‏ای ‏‏‏‏شکل

واکنش گرم

منفی

کاتالاز

مثبت

اکسیداز

منفی

حرکت

مثبت

مصرف سیترات

مثبت

متیل رد

مثبت

وژپروسکوئر

منفی

هیدرولیز اوره

مثبت

اندول

مثبت

تولید H2S

منفی

رشد روی مک کانگی آگار

مثبت

 

با توجه به صفات فنوتیپیک مطالعه شده، کتاب‏های مرجع و مقالات منتشره در این زمینه، می‏‏توان به‏طور‏‏ موقت سویه TPS2 را در جنس سیتروباکتر‏‏ قرار داد. برای شناسایی دقیق سویه TPS2، ابتدا DNA ژنومی استخراج و سپس، ژن کد کننده 16S rRNA از طریق پرایمرهای جهانی rw01 و dg74 مورد واکنش PCR قرار گرفت (شکل 2 قسمتA ). همان‏گونه که در شکل مشاهده می‏‏شود. توالی نوکلئوتیدی 16S rRNA مورد نظر دارای اندازه‏‏ای ‏‏در حدود 370 جفت باز است که مربوط به ترادف 16S rRNA باکتری اشریشیاکلی [24] (1100-1450/1500 Position) است. پس از توالی‏یابی ‏‏‏‏محصول PCR، تطابق توالی نوکلئوتیدی 16S rRNA سویه باکتری TPS2 با سایر توالی‏های موجود در بانک ژنی NCBI نشان داد که باکتری مورد نظر به جنس سیتروباکتر‏‏ تعلق داشته و دارای درصد تشابه 99 درصدی (با مقدار پوشش E value برابر صفر و query coverage برابر 100) با باکتری سیتروباکتر‏‏ سویه CAS12 (با شماره دسترسی KC550379) است. بنابراین، توالی نوکلئوتیدی 16S rRNA باکتری یاد شده در GeneBank با شماره دسترسی KM110046 ثبت شد. در ادامه نتایج ترسیم درخت فیلوژنیک تایید کرد که سویه TPS2 را می‏‏توان از نظر تاکسونومی به عنوان سویه‏‏ای ‏‏از جنس سیتروباکتر‏‏ طبقه‏بندی ‏‏کرد (شکل 2 قسمتB ).

 

 

 

شکل 1- (A) کروماتوگرام نیکوتین استاندارد و (B) کروماتوگرام هایHPLC ‏‏‏‏حاصل از تجزیه زیستی نیکوتین در شرایط سلول‏های رویشی 4 سویه باکتری مقاوم TPS1، TPS2، TPS3 و TPS4 در محیط ʺʺNic-medium broth حاوی 5/2 گرم در لیتر نیکوتین

 

 

 

شکل 2- (الف): باند الکتروفورز مربوط به تکثیر ژن 16S rRNA باکتری تجزیه کننده نیکوتین (1: مارکر 100 جفت بازی، 2: سویه TPS2 و 3: کنترل منفی). (ب): درخت فیلوژنیک بر اساس توالی ژن 16S rRNA سویه باکتری TPS2 و توالی‏های 11 سویه به دست آمده از بانک ژنی (درخت یاد شده بر اساس الگوریتم neighbor-joining و به کمک نرم افزار MEGA.6 ترسیم شد. اعداد داخل پرانتز نشان دهنده شماره دسترسی سویه‏های باکتری ثبت شده در GenBank است).

 

 

بر اساس نتایج به دست آمده از مطالعات فنوتیپیک و تحلیل‏‏ فیلوژنیک، سویه TPS2 به عنوانباکتری متعلق به جنسسیتروباکتر‏‏ تشخیص داده شد. این سویه برای مطالعات نیکوتین‏زدایی در شرایط سلول‏های رویشی انتخاب شد.

.نتایج حذف زیستی نیکوتین در سیتروباکتر‏‏ سویه TPS2: همان‏طور که در شکل 3 دیده می‏‏شود، اثر غلظت‏های 5/0 تا 4 گرم در لیتر نیکوتین روی حذف زیستی آن توسط سیتروباکتر‏‏ سویهTPS2در محیط پایه نمکی Nic-medium brothʺʺ پس از 48 ساعت گرماگذاری بررسی شده است. بیش‏ترین میزان حذف نیکوتین (3/70 درصد) در غلظت 5/2 گرم در لیتر نیکوتین مشاهده شده است. با توجه به این‏که حذف نیکوتین در غلظت‏های بالاتر از 5/4 گرم در لیتر کاهش پیدا کرده است، نشان دهنده این موضوع است که در غلظت‏های بالاتر نیکوتین فعالیت‏های آنزیماتیکی این سویه باکتری کاهش می‏‏یابد.

با توجه به این‏که انتخاب منابع کربن و ازت مناسب به عنوان سوبستراهای کمکی می‏‏تواند در حذف زیستی‏‏‏‏ نیکوتین بسیار مهم باشد، اثر منابع کربن و ازت مختلف بر روی حذف بررسی شد که بر اساس نتایج به دست آمده، از میان منابع کربن، فروکتوز و از بین منابع ازت، عصاره مخمر به عنوان منابع اثرگذار برگزیده شد. در این راستا، مدت دوره حذف نیکوتین با سیتروباکتر‏‏ سویهTPS2در غلظت بهینه 5/2 گرم در لیتر نیکوتین و در حضور 5/2 گرم در لیترفروکتوز و عصاره مخمر در محیط‏های پایه نمکی بررسی شد (شکل 4). همان‏طور که در شکل 4 نشان داده شده است، بیش‏ترین میزان حذف نیکوتین (6/83 درصد) در ساعت 60 مشاهده شد‏‏. این در حالی است که زمانی که نیکوتین همراه با 5/2 گرم در لیتر فروکتوز به عنوان منبعکربن کمکی استفاده شد‏‏ه است ماکزیمم حذف نیکوتین (در حدود 100 درصد) در ساعت 60 مشاهده شد. اضافه کردن 5/2 گرم در لیتر عصاره مخمر به عنوان منبع ازت کمکی به حذف 5/92 درصدی نیکوتین پس از 60 ساعت گرماگذاری منجر شده است.

 

 

شکل 3- نمودار اثر غلظت‏های اولیه نیکوتین بر روی حذف آن در سیتروباکتر‏‏ سویه TPS2 در محیط پایه نمکی حاوی نیکوتین به عنوان تنها منبع کربن و ازت و در دمای گرماگذاری 30 درجه سانتی‏گراد، دور شیکر rpm 180 و پس از 48 ساعت گرماگذاری. نتایج ارایه شده میانگین سه بار آزمایش بوده و بار 1± معرف انحراف معیار است.

 

 

شکل 4- اثر زمان گرماگذاری در حذف نیکوتین توسط سیتروباکتر‏‏ سویه TPS2 در محیط پایه نمکی Nic-medium broth دارای 5/2 گرم در لیتر نیکوتین و یا به همراه 5/2 گرم در لیتر فروکتوز و عصاره مخمر در شرایط دمایی 30 درجه سانتی‏گراد و دور شیکر rpm 180. نتایج ارایه شده میانگین سه بار آزمایش بوده و بار 1± معرف انحراف معیار است.

 

بحث و نتیجه‏‏ گیری.

نیکوتین به‏طور‏‏ گسترده در صنایع مختلف به ویژه صنایع توتون و تنباکو به کار برده می‏‏شود. حضور نیکوتین سمی در ضایعات و پسمانده‏های حاصل از تولید تجاری توتون می‏‏تواند آثار مخرب زیست محیطی را به همراه داشته باشد، زیرا نیکوتین می‏‏تواند به سهولت به زمین‏های اطراف و آب‏های سطحی و زیرزمینی راه یافته و در پی آن آثار زیان‏بار بر سلامت انسان و اکوسیستم‏های طبیعی داشته باشد (4). از طرفی چنانچه زباله‏های صنایع مرتبط با نیکوتین عاری و یا دارای محتوای نیکوتین پایین باشد، می‏‏تواند به عنوان یک سوبسترای مناسب و ارزان قیمت در تولید فرآورده‏های زیست فناوری از جمله بیوگاز استفاده شوند. در حالی که از روش‏های فیزیکی- شیمایی مختلفی از جمله استخراج به کمک حلال‏های آلی در شرایط قلیا، تقطیر در خلاء و روش آب داغ برای کاهش سمیت نیکوتین در محلول‏های آبی استفاده شده است (3، 6 و 7)، با این وجود، این روش‏ها دارای محدودیت هایی از قبیل سمیت بالا به علت باقی ماندن حلال‏های سمی، هزینه‏های عملیاتی بالا و حذف غیر اختصاصی است. از این رو برای سم‏زدایی نیکوتین مناسب نیست (19). بنابراین، تمایل به توسعه روش‏های حذف زیستی نیکوتین متکی بر میکروارگانیسم‏ها به عنوان بیوکاتالیست‏های اقتصادی کارآمد و سازگار با محیط زیست افزایش یافته است. محتوای آنزیمی بالا و تنوع مسیرهای متابولیسمی در میکروارگانیسم‏ها از ویژگی‏های برجسته‏ایی است که باعث شده تا بسیاری از پژوهشگران سویه‏های میکروبی تجزیه کننده نیکوتین با قابلیت مصرف نیکوتین به عنوان تنها منبع کربن، ازت و انرژی را غربال‏گری و تعیین هویت کنند. با توجه به سمیت بالای نیکوتین برای میکروارگانیسم ها، غربال‏گری سویه‏های میکروبی با تحمل‏پذیری ذاتی بالا ما را قادر می‏‏سازد که سویه‏های بومی کارآمدی را برای حذف و تجزیه نیکوتین جداسازی کنیم. در این راستا، 20 سویه باکتری با قابیلت تجزیه کنندگی نیکوتین از مزارع زیر کشت تنباکو در محیط‏های پایه نمکی حاوی نیکوتین به عنوان تنها منبع کربن، ازت و انرژی، با روش غنی‏سازی جداسازی و الگوی مقاومت آن‏ها نسبت به نیکوتین ارزیابی شد. در میان سویه‏های باکتری تجزیه کننده نیکوتین، سویه TPS2 حداکثر مقاومت و تجزیه‏کنندگی را نسبت به نیکوتین نشان داد (جدول 3 و شکل 1). سویه باکتری TPS2 با توجه به ویژگی‏های فنوتیپیک و تجزیه و تحلیل فیلوژنیک به عنوان سیتروباکتر‏‏ شناسایی و تعیین هویت شد (شکل 2). تا به امروز گزارش‏هایی از کاربرد سویه‏های باکتری متعلق به جنس سیتروباکتر‏‏ در اصلاح و پاک‏سازی زیستی انواع آلاینده‏های محیطی از جمله تجزیه زیستی اسید تانیک، فرآیند حذف کروزول، تجزیه زیستی رنگ‏های آزو، اصلاح زیستی اکسی آنیون سمی سلنات، تجزیه سورفاکتانت‏های آنیونی و حذف سولفات از پسماندهای صنعتی منتشر شده است (25). با این حال، مطالعه پیش رو، نخستین گزارش در مورد تجزیه نیکوتین به وسیله جنس سیتروباکتر‏‏ است. در ادامه این پژوهش، سلول‎های رویشی سیتروباکتر‏‏ سویه TPS2 برای بررسی توانایی تجزیه نیکوتین در غلظت‏های مختلف کافئین و در حضور منابع کربن و ازت کمکی در محیط‏های پایه نمکی بررسی شد. با توجه به اینکه تجزیه زیستی نیکوتین از طریق مسیرهای متابولیکی غیر از گلیکولیز رخ می‏‏دهد و ATP تشکیل نمی‏شود، اضافه کردن سوبستراهای کمکی اعم از منابع ازت و کربن کمکی، به عنوان یک منبع کمکی انرژی، احتمالا می‏‏تواند در بهبود فرآیند تجزیه زیستی نیکوتین مؤثر باشد. بر اساس نتایج به دست آمده، 100 درصد نیکوتین با غلظت اولیه 5/2 گرم در لیتر و در حضور 5/2 گرم در لیتر فروکتوز، بعد از 60 ساعت گرماگذاری توسط باکتری بومی یاد شده حذف شد (شکل‏های ‏‏3 و 4). نخستین تجزیه میکروبی نیکوتین در گونه باکتری آرتروباکتر اکسیدانس[xxv] گزارش شد. باکتری یاد شده قابلیت استفاده از نیکوتین را به عنوان تنها منبع کربن و انرژی دارا بود (10). سویه‏ایی از باکتری سودوموناس گزارش شد که قادر به تجزیه نیکوتین در غلظت 3/1 گرم در لیتر با راندمان 6/99 درصدی پس از 25 ساعت گرماگذاری بود (15). گونگ [xxvi] و همکارانش (20) نیکوتین‏زدایی را با استفاده از سویه باکتری متعلق به رودوکوکوس که قادر به تجزیه کامل نیکوتین در غلظت 1 گرم در لیتر بعد از 52 ساعت گرماگذاری و در شرایط بهینه شه از نظر شاخص‏های محیطی بود را توسعه دادند. یک سویه از آگروباکتریوم که نسبت به نیکوتین مقاوم بود، جداسازی شد که پس از بررسی‏های انجام شده حذف 100 درصدی نیکوتین با غلظت اولیه 1 گرم در لیتر پس از 6 ساعت گرماگذاری و در شرایط بهینه شده کشت مشاهده شد (9). سویه باکتری متعلق به جنس آسینتوباکتر در شرایط بهینه شده از نظر دما، اسیدیته و دور شیکر، قادر به تجزیه 100 درصدی نیکوتین در غلظت بهینه 1 گرم در لیتر است (8). در جدیدترین مطالعه انجام شده توسط لیو و همکاران (19) گونه باکتری غربال‏گری شده سودوموناس جنیکولاتا [xxvii]، با قابلیت مصرف نیکوتین به عنوان تنها منبع کربن و نیتروژن، در دمای بهینه 30 درجه، اسیدیته بهینه برابر 5/6 و دور شیکر بهینه rpm 120 قابلیت حذف کامل نیکوتین در غلظت اولیه 5/1 گرم در لیتر را پس از 4 روز گرماگذاری داشت.در مقایسه با مطالعات گذشته، نتایج آزماش‏های حاضر که با استفاده از سلول‏های رویشی سیتروباکتر‏‏ سویه TPS2 بدون انجام فرآیند‏های بهینه‏سازی آماری انجام شد، حذف منطقی نیکوتین را نشان داد. شایان ذکر است نتایج به دست آمده بدون بهینه‏سازی شاخص‏های محیطی کشت (دما، اسیدیته و دور شیکر) و سایر شاخص‏های احتمالی مؤثر از جمله اثر حجم مایه تلقیح، اثر یون‏های فلزی، تعیین سطح بهینه شاخص‏های تغذیه‏‏ای ‏‏میکروارگانیسم و بررسی میان کنش‏ها به دست آمده است که همین امر توانایی سلول رویشی باکتری بومی یاد شده را به عنوان بیوکاتالیست برای حذف و پاک‏سازی زیستی نیکوتین از محیط‏های آلوده تأیید می‏کند. با توجه به روند رو به توسعه صنایع مرگبار توتون در کشور، عدم مدیریت زیست محیطی و بنابراین، انتشار نیکوتین سمی به اکوسیستم‏های طبیعی، باکتری بومی غربال‏گری شده سیتروباکتر‏‏ سویه TPS2 را می‏‏توان به عنوان یک بیوکاتالیست پاک در تجزیه نیکوتین از محیط زیست و پاک‏سازی آن معرفی کرد. استفاده عملی از باکتری یاد شده برای پالایش زیستی پساب‏های آلوده در مقیاس‏های بالاتر (Scale-up)، نیازمند انجام فرآیندهای بهینه‏سازی و شناسایی ساز و کار آنزیمی تجزیه کننده نیکوتین است. افزون بر این، می‏‏توان ایجاد همزیستی بین باکتری بومی سیتروباکتر‏‏ سویه TPS2 و گیاهان جنس نیکوتینا و بررسی محتوای نیکوتین این گیاهان بعد از یک دوره تیمار مشخص با هدف کاهش غلظت نیکوتین در گیاهان یاد شده را پیشنهاد کرد.

 

 

تشکر و قدردانی

این پروژه در قالب طرح پژوهشی به شناسه 1393/41983/4 با حمایت مالی معاونت پژوهشی دانشگاه کردستان انجام گرفته است. بدین‏وسیله از معاونت پژوهشی دانشگاه کردستان تشکر و قدردانی می‏شود.

 



[1]- Nicotina tabacum L.

[2]- Acinetobacter

[3]- Agrobacterium

[4]- Arthrobacter

[5]- Cellulomonas

[6]- Ensifer

[7]- Ochrobactrum

[8]- Pseudomonas

[9]- Rhodococcus

[10]- Citrobacter

[11]- Sigma-Aldrich, St. Louis, MO

[12]- E. Merck, Darmstadt, Germany

[13]- Nutrient Agar

[14]- Kardanazma company, Iran

[15]- Quelab, UK

[16]- Liu

[17]- Agar dilution method

[18]- Cinna Pure TM KIT

[19]- http://www.ncbi.nlm.nih.gov/blast/

[20]- http://www.ncbi.nlm.nih.gov/Sequin

[21]- http://www.megasoftware.net/mega.php

[22]- JASCo Pu 980

[23]- Retention time

[24]- E. coli

[xxv]- Arthrobacter oxidans

[xxvi]- Gong

[xxvii]- Pseudomonas geniculata

 

(1)               Armstrong DW., Wang X., Ercal N. Enatiomeric composition of nicotine in smokeless tobacco, medicinal products, and commercial reagents. Chiriality 1998; 10 (7): 587- 91.

(2)               Sabha M., Tanus-Santos JE., Toledo JC., Cittadino M., Rocha JC., Moreno H. Transdermal nicotinemimics the smoking-induced endothelial dysfunction. Clinical Pharmacology and Therapeutics 2000; 68 (2): 167- 74.

(3)               Soloway SB. Naturally occurring insecticides. Environmental Health Perspectives 1976; 14 (2): 109- 17.

(4)               Lei LP., Zhang W., Wei HL., Xia ZY., Liu XZ. Characterization of a novel nicotine-degrading Ensifer sp. strain N7 isolated from tobacco rhizosphere. Annals of Microbiology 2009; 59 (2): 247- 52.

(5)               Li HJ., Li XM., Duan YQ., Zhang KQ., Yang JK. Biotransformation of nicotine by microorganism: the case of Pseudomonas spp. Applied Microbiology and Biotechnology 2010; 86 (1): 11-7.

(6)               Civilini M., Domenis C., Sebastianutto N., Bertoldi M. Nicotine decontamination of tobacco agro-industrial waste and its degradation by microorganisms. Waste Management and Research 1997; 15 (4): 349- 58.

(7)               Meher KK., Panchwagh AM., Rangrass S., Gollakota KG. Biomethanation of tobacco waste. Environmental Pollution 1995; 90 (2): 199- 202.

(8)               Li HJ., Duan YQ., Ma GH., Lei LP., Zhang KQ., Yang JK. Isolation and characterization of Acinetobacter sp. ND12 capable of degrading nicotine. African Journal of Microbiology Research 2011; 5 (11): 1335- 41.

(9)               Wang SN., Liu Z., Xu P. Biodegradation of nicotine by a newly isolated Agrobacterium sp. strain S33. Journal of Applied Microbiology 2009; 107 (3): 838- 47.

(10)           Sguros PL. Microbial transformations of the tobacco alkaloids. I. Cultural and morphological characteristics of a nicotinophile. Journal of Bacteriology 1955; 69 (1): 28- 37.

(11)           Kodama Y., Yamamoto H., Amano N., Amachi T. Reclassification of two strains of Arthrobacter oxidans and proposal of Arthrobacter nicotinovorans sp. nov. International journal of systematic bacteriology 1992; 42 (2): 234- 9.

(12)           Gravely LE., Geiss VL., Gregory., CF. Process for reduction of nitrate and nicotine content of tobacco by microbial treatment. US patent 4557280; 1978.

(13)           Yuan YJ., Lu ZX., Huang., LJ., Li Y., Lu FX., Bie XM., et al. Biodegradation of nicotine from tobacco waste extract by Ochrobactrum intermedium DN2. Journal of Industrial Microbiology and Biotechnology 2007; 34 (8): 567- 70.

(14)           Wang SN., Xu P., Tang HZ., Meng J., Liu XL., Huang J., et al. Biodegradation and detoxification of nicotine in tobacco solid waste by a Pseudomonas sp. Biotechnology Letters 2004; 26 (19): 1493- 6.

(15)           Ruan AD., Min H., Peng X., Huang Z. Isolation and characterization of Pseudomonas sp. strain HF-1, capable of degrading nicotine. Research in Microbiology 2005; 156 (5): 700- 6.

(16)           Wang SN., Liu Z., Tang HZ., Meng J., Xu P. Characterization of environmentally friendly nicotine degradation by Pseudomonas putida biotype A strain S16. Microbiology 2007; 153 (5): 1556- 65.

(17)           Chen CM., Li XM., Yang JK., Gong XW., Li B., Zhang KQ. Isolation of nicotine-degrading bacterium Pseudomonas sp. Nic 22., and its potential application in tobacco processing. International Biodeterioration and Biodegradation 2008; 62 (3): 226- 31.

(18)           Wang HH., Yin B., Peng XX., Wang JY., Xie ZH., Gao J., et al. Biodegradation of nicotine by newly isolated Pseudomonas sp. CS3 and its metabolites. Journal of Applied Microbiology 2012; 112 (2): 258- 68.

(19)           Liu Y., Wang L., Huang K., Wang W., Nie X., Jiang Y., et al. Physiological and biochemical characterization of a novel nicotine-degrading bacterium Pseudomonas geniculata N1. PLOS ONE; 2014; 9 (1): e84399.

(20)           Gong XW., Yang JK., Duan YQ., Dong JY., Zhe W., Wang L., et al. Isolation and characterization of Rhodococcus sp. Y22 and its potential application to tobacco processing. Research in Microbiology 2009; 160 (3): 200- 4.

(21)           Wiegand I., Hilpert K., Hancock REW. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nature Protocols 2008; 3(2): 163- 75.

(22)           Holt JG., Krieg NR., Sneath PHA., Staley JT., Williams ST. Bergey‘s manual of determinative bacteriology.9th ed. Baltimore, Maryland; Williams and Wilkins; 1994.

(23)              Leong DU., Greisen KS. PCR detection of bacteria found in cerebrospinal fluid. In: Persing DH., Smith TF., Tenover FC and White TJ. Diagnostic Molecular Microbiology: Principles and Applications. Mayo Foundation, Rochester; 1993.

(24)           Tamura K., Stecher., G., Peterson D., Filipski A., Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution 2013; 30 (12): 2725- 9.

(25)           Ren Y., Peng L., Zhao G., Wei C. Degradation of m-cresol via the ortho cleavage pathway by Citrobacter farmeri SC01. Biochemical Engineering Journal 2014; 88: 108- 14.