سنجش ‏فعالیت ‏ضد ‏میکروبی ‏باکتری‏ های ‏جداسازی ‏شده ‏از ‏دریای ‏خزر ‏و ‏شناسایی ‏مولکولی ‏سویه ‏های ‏دارای ‏اثر ‏ضد ‏میکروبی

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 کارشناس ‏ارشد ‏میکروبیولوژی، ‏دانشگاه ‏آزاد ‏اسلامی، ‏واحد ‏تنکابن، ‏ایران

2 کارشناس ‏ارشد ‏محیط ‏زیست، ‏دانشگاه ‏آزاد ‏اسلامی، ‏واحد ‏علوم ‏تحقیقات، ‏تهران، ‏ایران

3 استادیارمیکروبیولوژی، ‏دانشگاه ‏آزاد ‏اسلامی، ‏واحد ‏تنکابن، ‏ایران

چکیده

مقدمه: ‏دسترسی ‏آسان ‏و ‏استفاده ‏گسترده ‏از ‏ترکیبات ‏ضد ‏میکروبی، ‏به ‏پیدایش ‏مقاومت ‏در ‏میان ‏میکروارگانیسم‏ها ‏منجر ‏شده ‏است. ‏بنابراین، ‏غربال‏گری ‏و ‏شناسایی ‏ترکیبات ‏ضد ‏میکروبی ‏با ‏اثر ‏بخشی ‏بالا ‏از ‏میکروارگانیسم‏های ‏ساکن ‏در ‏محیط‏های ‏مختلف ‏امری ‏ضروری ‏است. ‏استفاده ‏از ‏میکروارگانیسم‏ها ‏برای ‏اهداف ‏زیست ‏شناختی، ‏آن‏ها ‏را ‏به ‏عنوان ‏یک ‏ابزار ‏مؤثر ‏برای ‏کنترل ‏پاتوژن‏ها ‏تبدیل ‏کرده ‏است. ‏یکی ‏از ‏این ‏میکروارگانیسم‏ها، ‏باکتری ‏استرپتومایسس ‏گریزئوس ‏است. ‏هدف ‏از ‏مطالعه ‏حاضر، ‏جداسازی ‏باکتری‏های ‏آبزی ‏با ‏اثر ‏ضد ‏میکروبی ‏بر ‏پاتوژن‏های ‏مقاوم ‏گرم ‏مثبت ‏و ‏گرم ‏منفی ‏و ‏در ‏نهایت، ‏شناسایی ‏مولکولی ‏سویه‏های ‏دارای ‏اثر ‏ضد ‏میکروبی ‏است. ‏

مواد ‏و ‏روش‏ها: ‏در ‏مطالعه ‏حاضر، ‏162 ‏سویه ‏از ‏دریای ‏خزر ‏جداسازی ‏شد. ‏پس ‏از ‏کشت ‏روی ‏محیط ‏اختصاصی ‏میکروب‏ها، ‏خاصیت ‏ضد ‏میکروبی ‏باکتری‏های ‏آبزی ‏روی ‏سویه‏های ‏مرجع، ‏سنجیده ‏شد. ‏4 ‏سویه ‏که ‏بیش ‏ترین ‏خاصیت ‏ضد ‏میکروبی ‏را ‏داشتند ‏انتخاب ‏و ‏با ‏روش ‏واکنش ‏زنجیره‏ای ‏پلیمراز ‏و ‏تعیین ‏توالی ‏ژن ‏S ‏rDNA16 ‏به ‏عنوان ‏سویه ‏جدید ‏شناسایی ‏و ‏در ‏بانک ‏اطلاعات ‏ژنی ‏NCBI ‏ثبت ‏شد. ‏

نتایج: ‏از ‏مجموع ‏162 ‏نمونه ‏جداشده، ‏4 ‏باکتری ‏بیش ‏ترین ‏فعالیت ‏آنزیمی ‏را ‏داشتند، ‏نتایج ‏سنجش ‏فعالیت ‏ضد ‏میکروبی ‏آن‏ها ‏نشان ‏دادکه ‏بیش‏ترین ‏اثر ‏ضد ‏میکروبی ‏را ‏روی ‏استافیلوکوکوس ‏اورئوس ‏و ‏باسیلوس ‏سوبتیلیس ‏و ‏کم ‏ترین ‏اثر ‏را ‏روی ‏اشریشیاکلی ‏و ‏سودوموناس ‏آئروجینوزا ‏داشتند. ‏در ‏انتها، ‏پس ‏از ‏تعیین ‏توالی ‏ژنی ‏باکتری‏های ‏دارای ‏اثر ‏ضد ‏میکروبی، ‏مشخص ‏شد ‏که ‏سویه‏ها ‏به ‏استرپتومایسس ‏گریزئوس ‏متعلق ‏هستند. ‏

بحث ‏و ‏نتیجه ‏گیری: ‏در ‏مطالعه ‏حاضر ‏4 ‏سویه ‏باکتریایی ‏دارای ‏اثر ‏ضد ‏میکروبی ‏شناسایی ‏شد. ‏با ‏توجه ‏به ‏قدرت ‏این ‏سویه‏ها ‏در ‏کنترل ‏رشد ‏باکتری‏های ‏پاتوژن ‏مقاوم ‏به ‏آنتی‏بیوتیک ‏می‏توان ‏با ‏خالص‏سازی ‏‏بیشتر ‏مواد ‏ضد ‏میکروبی ‏این ‏میکروارگانیسم‏ها ‏در ‏شرایط ‏بهینه ‏و ‏کنترل ‏شده، ‏در ‏صنایع ‏دارویی ‏و ‏برای ‏درمان ‏پاتوژن‏های ‏خطرناک ‏از ‏آن‏ها ‏استفاده ‏کرد. ‏

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Measurement of antimicrobial activity of isolated bacteria from the Caspian sea and molecular identification of strains with antimicrobial effect

نویسندگان [English]

  • Sajad Harounabadi 1
  • Seyyed Khalil Shokouhi Mostafavi 1
  • Parvaneh Eghbali Shamsabad 2
  • Seyyed Mansour Meybodi 3
1 M.Sc. of Microbiology, Islamic Azad University, Tonekabon branch, Iran
2 M.Sc. of Environment, Science and Research Branch Islamic Azad University, Tehran, Iran
3 Assistant Professor of Microbiology, Islamic Azad University, Tonekabon Branch, Iran
چکیده [English]

Introduction: Easy access and wide use of antimicrobial compounds led to the emergence of resistance among microorganisms. Therefore, screening and identifying antimicrobial compound with high effect of microorganisms in different environments is necessary and vital . Using microorganisms for biological aims change them to an important tool to control pathogens. Streptomyces griseus is one of them. The aim of this study is isolation of marine bacteria with antimicrobial effect against gram positive and negative bacteria. Finally, molecular identification of strains with antimicrobial activity.

Materials and methods: In this study, 162 strains were isolated from the Caspian Sea .The strains were cultured on special medium and finally antimicrobial activity on references strains as measured. Among them four strains with remarkable antimicrobial activity were identified and selected. The strains were subjected to 16S rDNA PCR sequencing. The strains were submitted to NCBI as new Streptomyces griseus strains.

Results: Among 162 strains, 4 strains had the most antimicrobial activity. The result showed, the strains were the most effective on Bacillus subtilis and Staphylococcus aureus (Gram positive bacteria) and the least effect were observed on Escherichia coli and Pseudomonas aeruginosa (Gram negative bacteria). After sequencing, the strains were classified to sterptomyces griseus genu.

Discussion and conclusion: In this study, 4 strains with antimicrobial activity were identified. According to the strength of these bacteria for controlling pathogenic bacteria resistant to antibiotic, we can have more pure microorganisms in optimized and controlled conditions for using in pharmaceutical industries and also for the treatment of dangerous pathogenic bacteria.

کلیدواژه‌ها [English]

  • Streptomyces griseus
  • Caspian Sea
  • Antimicrobial Activity

مقدمه. ‏

با ‏وجود ‏تنوع ‏بسیار ‏بالای ‏زندگی ‏در ‏محیط ‏خاکزی، ‏دریاها ‏دارای ‏بزرگترین ‏تنوع ‏زیستی ‏هستند. ‏محیط‏های ‏آبزی ‏منابع ‏بسیار ‏بزرگی ‏برای ‏جداسازی ‏میکروارگانیسم‏های ‏جدید ‏با ‏توانایی ‏تولید ‏متابولیت‏های ‏ثانویه ‏هستند ‏(‏1- ‏3). ‏متابولیت‏های ‏ثانویه ‏ترکیباتی ‏با ‏وزن ‏مولکولی ‏کم ‏هستند ‏که ‏آنتی‏بیوتیک‏ها، ‏سموم، ‏فرومون‏ها، ‏ممانعت ‏کننده‏های ‏آنزیمی ‏و ‏غیره ‏را ‏شامل ‏می‏شوند. ‏این ‏مواد ‏به ‏عنوان ‏تولیدات ‏طبیعی ‏میکروارگانیسم‏ها ‏شناخته ‏می‏شوند ‏و ‏برای ‏رشد ‏طبیعی ‏ارگانیسم‏ها ‏ضروری ‏نیستند ‏(‏4). ‏در ‏مقایسه ‏با ‏ارگانیسم‏های ‏خاکزی، ‏متابولیت‏های ‏ثانویه ‏تولید ‏شده ‏در ‏میکروارگانیسم‏های ‏آبزی ‏جدیدتر ‏و ‏فعالیت‏های ‏زیستی ‏آن‏ها ‏قوی‏تر ‏‏‏است ‏که ‏علت ‏این ‏امر ‏تا ‏حدودی ‏مربوط ‏به ‏شرایط ‏زندگی ‏پیچیده ‏و ‏تنوع ‏گسترده ‏زیستی ‏آن ‏هاست. ‏رقابت ‏بین ‏میکروب‏های ‏آبزی ‏برای ‏فضا ‏و ‏غذا ‏باعث ‏ایجاد ‏یک ‏نوع ‏فشار ‏انتخابی ‏می‏شود، ‏در ‏نتیجه ‏میکروارگانیسم‏ها ‏ترکیباتی ‏طبیعی ‏تولید ‏می‏کنند ‏که ‏ارزش ‏بسیاری ‏در ‏صنعت ‏و ‏پزشکی ‏دارد ‏(‏5). ‏تعداد ‏ترکیبات ‏طبیعی ‏جداسازی ‏شده ‏از ‏میکروارگانیسم‏های ‏آبزی ‏رو ‏به ‏افزایش ‏است ‏به ‏طوری ‏که ‏هر ‏سال ‏صدها ‏ترکیب ‏جدید ‏و ‏مختلف ‏کشف ‏می‏شود ‏و ‏شمار ‏آن‏ها ‏هم ‏اکنون ‏بالغ ‏بر ‏18000 ‏ترکیب ‏است ‏(‏6 ‏و ‏7). ‏تعداد ‏زیادی ‏از ‏این ‏ترکیبات ‏فعالیت ‏دارویی ‏دارند ‏و ‏برای ‏تولید ‏ترکیبات ‏دارویی ‏فعال ‏زیستی ‏بسیار ‏سودمند ‏هستند ‏(‏8). ‏بیماری‏های ‏عفونی ‏تهدید ‏جدی ‏برای ‏سلامت ‏در ‏کشورهای ‏در ‏حال ‏توسعه ‏محسوب ‏می‏شوند. ‏افزون ‏بر ‏این، ‏پیدایش ‏مقاومت‏های ‏دارویی ‏مشکل ‏بسیار ‏جدی ‏در ‏درمان ‏این ‏بیماری‏های ‏عفونی ‏محسوب ‏می‏شود ‏(‏9 ‏و ‏10). ‏آثار ‏بیماری‏های ‏عفونی ‏در ‏محیط‏های ‏آبزی ‏نیز ‏بسیار ‏چشمگیر ‏است. ‏در ‏ابتدا ‏این ‏بیماری‏ها ‏در ‏محیط‏های ‏آبزی ‏با ‏داروهای ‏ضد ‏میکروبی ‏کنترل ‏می‏شد ‏اما ‏استفاده ‏گسترده ‏از ‏داروهای ‏ضد ‏میکروبی ‏در ‏این ‏زمینه ‏سبب ‏ایجاد ‏نوعی ‏فشار ‏انتخابی ‏و ‏ظهور ‏مقاوت ‏باکتریایی ‏شد ‏(‏11). ‏بر ‏اساس ‏گزارش ‏سازمان ‏بهداشت ‏جهانی ‏استفاده ‏گسترده ‏از ‏آنتی‏بیوتیک‏ها ‏‏سبب ‏‏مقاوت ‏‏به ‏‏بسیاری ‏‏از ‏‏پاتوژن‏ها ‏‏شد‏ه ‏است ‏(‏12). ‏باکتری‏های ‏مهم ‏بیمارستانی ‏از ‏قبیل ‏استافیلوکوکوس ‏اورئوس‏[1] ‏به ‏طور ‏معمول ‏به ‏آنتی‏بیوتیک‏های ‏رایج ‏مقاوم ‏شده‏اند‏ ‏(‏13 ‏و ‏14). ‏نگرانی ‏اصلی ‏دیگر ‏در ‏این ‏زمینه ‏مربوط ‏به ‏مقاوت‏های ‏چند ‏دارویی ‏در ‏بین ‏باکتری‏های ‏گرم ‏منفی ‏است. ‏باکتری‏های ‏گرم ‏منفی ‏محیطی ‏به ‏طور ‏جدی ‏بیماران ‏را ‏در ‏بیمارستان‏ها ‏تهدید ‏می‏کنند ‏و ‏به ‏طور ‏وسیعی ‏به ‏نسل‏های ‏اول ‏و ‏دوم ‏و ‏سوم ‏پنی‏‏سیلین‏ها ‏مقاوم ‏هستند. ‏از ‏این ‏دسته ‏باکتری‏ها ‏می‏توان ‏به ‏سودوموناس ‏آئروجینوزا‏[2] ‏اشاره ‏کرد ‏که ‏پاتوژن ‏فرصت ‏طلب ‏بیمارستانی ‏است ‏و ‏بیماران ‏بسیاری ‏را ‏تهدید ‏می‏کند ‏(‏15). ‏امروزه ‏در ‏حدود ‏70 ‏درصد ‏از ‏باکتری‏هایی ‏‏که ‏سبب ‏عفونت ‏دربیمارستان‏ها ‏می‏شوند ‏به ‏طور ‏رایج ‏به ‏یک ‏یا ‏تعداد ‏بیش ‏تری ‏از ‏آنتی‏بیوتیک‏های ‏معمول ‏که ‏برای ‏درمان ‏استفاده ‏می‏شوند، ‏مقاوم ‏هستند ‏(‏16). ‏باکتری‏های ‏آبزی ‏با ‏فعالیت ‏ضد ‏میکروبی ‏از ‏لایه‏های ‏مختلف ‏دریا ‏از ‏قبیل: ‏سطح، ‏عمق، ‏رسوبات ‏و ‏همچنین، ‏از ‏سایر ‏قسمت‏ها ‏و ‏نیز ‏همراه ‏با ‏جلبک‏های ‏دریای ‏استخراج ‏شده ‏اند ‏(‏17). ‏جنس ‏استرپتومایسس‏[3] ‏در ‏میان ‏خانواده ‏اکتینومایست‏ها‏[4] ‏به ‏عنوان ‏عامل ‏تولید ‏کننده ‏آنتی‏بیوتیکی ‏مهمی ‏شناخته ‏شده ‏است ‏و ‏به ‏طور ‏گسترده ‏در ‏اکوسیستم‏های ‏مختلف ‏مانند ‏خاک ‏و ‏آب ‏یافت ‏می‏شود. ‏این ‏جنس، ‏باکتری‏هایی ‏‏گرم ‏مثبت ‏با ‏درصد ‏بسیار ‏بالایی ‏از ‏گوانین ‏و ‏سیتوزین ‏در ‏داخل ‏ماده ‏ژنتیکی ‏خود ‏هستند ‏(‏بالغ ‏بر ‏70 ‏درصد). ‏استرپتومایسس‏ها ‏به ‏طور ‏گسترده ‏به ‏عنوان ‏منبع ‏مهمی ‏برای ‏آنتی‏بیوتیک‏ها ‏و ‏دیگر ‏متابولیت‏های ‏جدید ‏و ‏مهم ‏شناخته ‏شده ‏اند. ‏کمتر ‏از ‏70 ‏نوع ‏از ‏100 ‏نوع ‏آنتی‏بیوتیک ‏تجاری ‏که ‏برای ‏درمان ‏استفاده ‏می‏شوند ‏و ‏نیز ‏بالغ ‏بر ‏55 ‏درصد ‏ازآنتی‏بیوتیک‏های ‏کشف ‏شده ‏بین ‏سال‏های ‏1945 ‏تا ‏1978 ‏از ‏مواد ‏تولید ‏شده ‏از ‏استرپتومایسس‏ها ‏مشتق ‏شده ‏اند ‏و ‏کشف ‏آنتی‏بیوتیک‏های ‏جدید ‏از ‏این ‏جنس ‏همچنان ‏ادامه ‏دارد. ‏(‏18- ‏24). ‏بیشتر ‏استرپتومایسس‏ها ‏تولید ‏کننده ‏محدوده ‏گسترده ‏ایی ‏از ‏آنتی‏بیوتیک‏ها ‏از ‏قبیل: ‏آمینوگلیکوزیدها‏[5]، ‏بتالاکتام‏ها[6]، ‏ماکرولیدها[7]، ‏پپتیدها[8]، ‏پولیین‏ها‏[9]، ‏نوکلوئوزیدها‏[10] ‏و.. ‏. ‏هستند ‏(‏25- ‏28). ‏همچنین، ‏استرپتومایسس‏ها ‏نقش ‏بسیار ‏مهمی ‏در ‏بازیافت ‏مواد ‏آلی ‏و ‏مواد ‏دارویی ‏جدید، ‏آنزیم‏ها، ‏مواد ‏آرایشی ‏و ‏همچنین، ‏تولید ‏مواد ‏ضد ‏تومور ‏ایفا ‏می‏کنند ‏(‏29 ‏و ‏30). ‏تجزیه ‏و ‏تحلیل ‏از ‏طریق ‏روش‏های ‏مولکولی ‏ابزار ‏بسیار ‏ارزشمندی ‏برای ‏جداسازی ‏و ‏تشخیص ‏سویه‏های ‏جدید ‏استرپتومایسس ‏است. ‏شواهد ‏نشان ‏می‏دهد ‏تمایل ‏زیادی ‏برای ‏شناسایی ‏سویه‏های ‏جدید ‏استرپتومایسس ‏از ‏این ‏طریق ‏وجود ‏دارد؛ ‏زیرا ‏این ‏باکتری‏ها ‏تولید ‏کننده ‏قوی ‏متابولیت‏های ‏ثانویه ‏هستند ‏و ‏ارزش ‏چشمگیری ‏در ‏زمینه‏های ‏کشاورزی ‏و ‏پزشکی ‏و. ‏.. ‏دارند ‏(‏31). ‏هدف ‏از ‏پژوهش ‏حاضر،‏ ‏جداسازی ‏و ‏غربال‏گری ‏‏باکتری‏های ‏آبزی ‏از ‏دریای ‏خزر، ‏با ‏توانایی ‏تولید ‏ماده ‏ضد ‏میکروبی ‏بر ‏علیه ‏پاتوژن‏های ‏مقاوم ‏به ‏دارو، ‏گرم ‏مثبت ‏و ‏گرم ‏منفی، ‏و ‏سپس، ‏سنجش ‏قدرت ‏ضد ‏میکروبی ‏آن‏ها ‏برای ‏توجیه ‏بهینه‏سازی ‏‏تولید ‏ماده ‏ضد ‏میکروبی ‏در ‏آن‏ها ‏برای ‏صنایع ‏داروسازی ‏با ‏دو ‏روش ‏کاملا ‏متفاوت ‏آنتاگونیسم ‏میکروبی‏[11] ‏و ‏سنجش ‏از ‏طریق ‏دیسک‏[12] ‏و ‏در ‏انتها، ‏شناسایی ‏مولکولی ‏آن‏ها ‏بود. ‏

 

 ‏مواد ‏و ‏روش‏‏ها. ‏

نمونه‏گیری ‏و ‏کشت ‏باکتری‏های ‏آبزی: ‏نمونه ‏گیری ‏از ‏غرب ‏دریای ‏خزر، ‏(‏شهرستان ‏رامسر ‏واقع ‏دراستان ‏مازندران)، ‏در ‏شرایط ‏کاملا ‏کنترل ‏شده، ‏در ‏فصل ‏پاییز، ‏در ‏سه ‏نوبت ‏از ‏عمق ‏50 ‏سانتی ‏متری ‏و ‏از ‏فاصله ‏150 ‏تا ‏200 ‏متر ‏از ‏ساحل ‏انجام ‏شد. ‏علت ‏لحاظ ‏کردن ‏این ‏فاصله، ‏دور ‏بودن ‏از ‏آلودگی‏های ‏نزدیک ‏به ‏ساحل ‏و ‏وجود ‏سویه‏های ‏غیر ‏بومی ‏بود. ‏نمونه ‏گیری ‏به ‏طور ‏مستقیم ‏با ‏قرار ‏گرفتن ‏داخل ‏آب، ‏فرو ‏بردن ‏دست ‏تا ‏عمق ‏50 ‏سانتی ‏متری، ‏باز ‏کردن ‏درب ‏شیشه ‏داخل ‏آب ‏در ‏همان ‏عمق ‏و ‏پس ‏از ‏پر ‏شدن ‏شیشه ‏بستن ‏درب ‏ظرف ‏در ‏همان ‏لحظه ‏در ‏زیر ‏آب ‏انجام ‏شد. ‏نمونه‏ها ‏داخل ‏ظروف ‏با ‏درب ‏پیچ ‏دار ‏(‏ظروف ‏شیشه‏ای ‏با ‏درب ‏پیچ ‏دار ‏پلاستیکی ‏با ‏قابلیت ‏اتوکلا ‏شدن ‏که ‏قبل ‏از ‏نمونه ‏گیری ‏در ‏دستگاه ‏اتوکلاو ‏کاملا ‏سترون ‏شد ‏ند) ‏قرار ‏گرفتند ‏و ‏در ‏جعبه ‏یخ ‏به ‏سرعت ‏به ‏آزمایشگاه ‏انتقال ‏داده ‏و ‏در ‏مدت ‏حداکثر ‏24 ‏ساعت ‏کشت ‏داده ‏شدند.

سپس، ‏از ‏هر ‏یک ‏از ‏نمونه‏ها ‏در ‏حالت ‏سترون ‏رقت‏های ‏1-10 ‏تا ‏8-10 ‏تهیه، ‏مقدار ‏150 ‏میکرولیتر ‏از ‏هر ‏کدام ‏از ‏رقت‏ها ‏روی ‏سطح ‏پلیتی ‏که ‏حاوی ‏محیط ‏کشت ‏مارین ‏آگار‏[13] ‏بود ‏ریخته ‏و ‏کشت ‏سفره‏ای ‏داده ‏شد. ‏محیط ‏مارین ‏آگار ‏با ‏غلظت ‏یک ‏دهم، ‏ترکیب ‏آن ‏شامل: ‏پپتون‏[14] ‏(‏مرک ‏آلمان) ‏5/0 ‏گرم، ‏عصاره ‏مخمر[15] ‏(‏مرک ‏آلمان) ‏1/0 ‏گرم، ‏فسفات ‏آهن[16] ‏(‏مرک ‏آلمان) ‏1/0 ‏گرم، ‏آگار ‏آگار‏[17] ‏(‏مرک ‏آلمان)[18] ‏15 ‏گرم، ‏آب ‏دریا ‏1 ‏لیتر ‏بود. ‏اسیدیته ‏محیط ‏بین ‏2/7 ‏تا ‏6/7 ‏تنظیم ‏شد. ‏

نمونه‏های ‏مورد ‏نظر ‏در ‏دمای ‏25 ‏درجه ‏سانتی‏‏گراد ‏داخل ‏گرمخانه ‏گذاشته ‏شد. ‏پرگنه‏های ‏مختلف ‏باکتریایی ‏پس ‏از ‏گذشت ‏48 ‏تا ‏72 ‏ساعت ‏و ‏تعدادی ‏نیز ‏پس ‏از ‏20 ‏روز ‏روی ‏پلیت ‏ظاهر ‏شدند ‏(‏32). ‏

. ‏آماده‏سازی ‏‏باکتری‏های ‏جدا ‏شده ‏برای ‏تولید ‏ماده ‏ضد ‏میکروبی: ‏باکتری‏هایی ‏‏که ‏بر ‏اساس ‏شکل ‏و ‏رنگ ‏آمیزی ‏گرم ‏از ‏یکدیگر ‏جدا ‏شده ‏بودند ‏هر ‏یک ‏به ‏طور ‏جداگانه ‏در ‏شرایط ‏سترون ‏و ‏به ‏میزان ‏1 ‏لوپ ‏در ‏300 ‏میلی‏‏لیتر ‏محیط ‏مارین ‏براث‏[19] ‏تلقیح ‏شدند. ‏

ارلن‏های ‏حاوی ‏باکتری ‏تلقیح ‏شده ‏در ‏داخل ‏گرمخانه ‏شیکردار ‏در ‏دمای ‏25 ‏درجه ‏سانتی‏‏گراد ‏و ‏دور ‏rpm ‏220 ‏به ‏مدت ‏7 ‏روز ‏قرار ‏داده ‏شد. ‏پس ‏از ‏گذشت ‏7 ‏روز ‏نمونه‏ها ‏از ‏داخل ‏گرمخانه ‏شیکردار ‏خارج ‏و ‏برای ‏سانتریفیوژ ‏به ‏لوله‏های ‏آزمایش ‏انتقال ‏داده ‏شد. ‏سانتریفیوژ ‏در ‏دور ‏rpm ‏8000 ‏به ‏مدت ‏30 ‏دقیقه ‏انجام ‏و ‏در ‏نهایت، ‏مایع ‏رویی ‏جدا ‏شد ‏(‏32). ‏

استخراج ‏عصاره ‏ضد ‏میکروبی: ‏مایع ‏رویی ‏3 ‏بار ‏و ‏هر ‏بار ‏با ‏100 ‏میلی‏‏لیتر ‏اتیل ‏استات‏[20] ‏تیمار ‏شد. ‏سپس، ‏حلال ‏در ‏دمای ‏37 ‏درجه ‏تبخیر ‏و ‏عصاره ‏میکروبی ‏استخراج ‏شد ‏(‏32). ‏

سنجش ‏فعالیت ‏ضد ‏میکروبی ‏باکتری‏های ‏آبزی: ‏در ‏مرحله ‏سنجش ‏فعالیت ‏ضد ‏میکروبی ‏به ‏یک ‏سری ‏از ‏سویه‏های ‏مرجع ‏برای ‏بررسی ‏اثر ‏ضد ‏میکروبی ‏باکتری‏های ‏آبزی ‏روی ‏آن‏ها ‏نیاز ‏بود. ‏در ‏این ‏مرحله ‏4 ‏باکتری ‏به ‏عنوان ‏سویه ‏مرجع ‏در ‏نظر ‏گرفته ‏شد. ‏این ‏سویه‏ها ‏شامل ‏باسیلوس ‏سوبتیلیس ‏PTCC ‏1720 ‏(‏DSM10)‏[21]، ‏اشریشیاکلی‏[22] ‏PTCC1399 ‏(‏ATCC ‏25922)،‏ ‏استافیلوکوکوس ‏اورئوس ‏PTCC ‏1431 ‏(‏ATCC25923) ‏و ‏سودوموناس ‏آئروجینوزا ‏PTCC ‏1430 ‏(‏ATCC ‏27853) ‏بودند. ‏

بررسی ‏فعالیت ‏ضد ‏میکروبی ‏با ‏دو ‏روش ‏انجام ‏شد:

آنتاگونیسم ‏میکروبی: ‏در ‏این ‏روش ‏باکتری‏های ‏آبزی ‏به ‏شکل ‏زنده ‏برای ‏بررسی ‏اثر ‏ضد ‏میکروبی ‏استفاده ‏شد. ‏در ‏ابتدا، ‏پلیت ‏به ‏دو ‏قسمت ‏مساوی ‏تقسیم ‏شد. ‏در ‏یک ‏قسمت ‏باکتری ‏آبزی ‏به ‏شکل ‏زنده ‏و ‏انبوه ‏کشت ‏داده ‏و ‏به ‏مدت ‏48 ‏ساعت ‏در ‏داخل ‏گرمخانه ‏در ‏دمای ‏30 ‏درجه ‏قرار ‏داده ‏شد ‏تا ‏به ‏اندازه ‏کافی ‏رشد ‏کند ‏و ‏انتشار ‏ماده ‏ضد ‏میکروبی ‏در ‏ژل ‏انجام ‏شود. ‏سپس، ‏از ‏هر ‏یک ‏از ‏سویه‏های ‏مرجع ‏رقت ‏5/0 ‏مک ‏فارلند ‏تهیه ‏شد. ‏سپس، ‏هر ‏یک ‏از ‏سویه‏های ‏مرجع ‏به ‏شکل ‏جداگانه ‏با ‏سوآپ ‏از ‏پایین ‏به ‏بالا ‏به ‏باکتری ‏آبزی ‏که ‏قبلا ‏به ‏شکل ‏انبوه ‏در ‏نیمه ‏بالای ‏پلیت ‏کشت ‏شده ‏بود، ‏به ‏شکل ‏عمود ‏بر ‏آن ‏متصل ‏شدند، ‏به ‏طوری ‏که ‏باکتری ‏مرجع ‏با ‏باکتری ‏آبزی ‏که ‏پیش ‏از ‏این ‏در ‏نیمه ‏بالای ‏پلیت ‏کشت ‏داده ‏شده ‏بود، ‏اتصال ‏یافت. ‏سپس، ‏پلیت‏های ‏حاوی ‏کشت‏های ‏انجام ‏شده ‏به ‏مدت ‏48 ‏ساعت ‏دیگر ‏داخل ‏گرمخانه ‏در ‏دمای ‏30 ‏درجه ‏سانتی‏‏گراد ‏قرار ‏داده ‏شد ‏(‏محیط ‏کشت ‏مورد ‏استفاده ‏در ‏این ‏مرحله ‏مولر ‏هینتون ‏آگار ‏بود ‏که ‏با ‏آب ‏دریا ‏ساخته ‏شده ‏بود. ‏علت ‏استفاده ‏از ‏آب ‏دریا ‏املاح ‏موجود ‏در ‏آن ‏برای ‏رشد ‏باکتری‏های ‏آبزی ‏بود.) ‏نتایج ‏به ‏شکل ‏عدم ‏رشد ‏سویه‏های ‏مرجع ‏بررسی ‏شد. ‏این ‏روش ‏برای ‏اطمینان ‏3 ‏بار ‏تکرار ‏شد. ‏

انتشار ‏از ‏دیسک: ‏در ‏این ‏روش، ‏در ‏ابتدا ‏از ‏هر ‏یک ‏از ‏4 ‏سویه ‏مرجع ‏رقت ‏5/0 ‏مک ‏فارلند ‏تهیه ‏و ‏روی ‏سطح ‏پلیتی ‏که ‏حاوی ‏محیط ‏کشت ‏مولر ‏هینتون ‏آگار‏[23] ‏(‏مرک ‏آلمان) ‏بود ‏کشت ‏سفره‏ای ‏داده ‏شد. ‏سپس، ‏عصاره ‏خام ‏تهیه ‏شده ‏در ‏مراحل ‏قبلی ‏به ‏میزان ‏100 ‏میلی‏‏گرم ‏در ‏میلی‏‏لیتر ‏دراتیل ‏استات ‏حل ‏شد ‏و ‏مقدار ‏20 ‏لاندا ‏(‏میکرولیتر) ‏از ‏آن ‏به ‏دیسک‏های ‏بلانک ‏استریل ‏اضافه ‏شد. ‏دیسک‏های ‏آغشته ‏به ‏مواد ‏ضد ‏میکروبی ‏روی ‏سطح ‏پلیت‏های ‏یاد ‏شده ‏به ‏مدت ‏10 ‏ساعت ‏در ‏دمای ‏8 ‏درجه ‏سانتی‏‏گراد ‏قرار ‏داده ‏شد ‏تا ‏انتشار ‏ماده ‏ضد ‏میکروبی ‏در ‏ژل ‏انجام ‏شود. ‏سپس، ‏پلیت‏ها ‏در ‏دمای ‏37 ‏درجه ‏سانتی‏‏گراد ‏به ‏مدت ‏24 ‏ساعت ‏قرار ‏داده ‏شد. ‏
در ‏نهایت، ‏قطر ‏هاله ‏اطراف ‏هر ‏دیسک ‏بر ‏حسب ‏میلی‏‏متر ‏سنجیده ‏شد. ‏شایان ‏ذکر ‏است ‏که ‏دیسک ‏بلانک ‏حاوی ‏اتیل ‏استات ‏به ‏عنوان ‏شاهد ‏منفی ‏استفاده ‏شد ‏(‏32). ‏(‏این ‏روش ‏نیز ‏برای ‏اطمینان ‏3 ‏بار ‏تکرار ‏شد). ‏

. ‏شناسایی ‏سویه‏های ‏باکتریایی ‏تولید ‏کننده ‏ماده ‏ضد ‏میکروبی ‏با ‏استفاده ‏از ‏روش ‏مولکولی: ‏پس ‏از ‏استخراج ‏DNA ‏از ‏باکتری‏ها ‏با ‏کیت ‏استخراج ‏DNA ‏شرکت ‏سیناژن‏[24]، ‏با ‏استفاده ‏از ‏پرایمرهای ‏جهانی، ‏ماده ‏ژنتیکی ‏SrRNA16 ‏با ‏کمک ‏روش ‏مولکولی ‏واکنش ‏زنجیری ‏پلیمراز ‏تکثیر ‏شد. ‏در ‏این ‏مرحله، ‏باکتری‏هایی ‏‏که ‏توانایی ‏تولید ‏ماده ‏ضد ‏میکروبی ‏را ‏داشتند ‏با ‏استفاده ‏از ‏روش ‏تعیین ‏توالی16S ‏rDNA ‏PCR ‏شناسایی ‏شدند. ‏توالی ‏پرایمرهای ‏ژن ‏مورد ‏نظر ‏در ‏جدول ‏1 ‏نشان ‏داده ‏شده ‏است. ‏

تهیه ‏مخلوط ‏واکنش ‏زنجیری ‏پلیمراز: ‏برای ‏انجام ‏واکنش ‏زنجیری ‏پلیمراز ‏به ‏ترتیب ‏از ‏ddH2O ‏به ‏غلظت ‏037/0 ‏میلی‏‏لیتر ‏(‏37 ‏لاندا) ‏بافر ‏واکنش ‏زنجیری ‏پلیمراز ‏به ‏غلظت ‏005/0 ‏میلی‏‏لیتر ‏(‏5 ‏لاندا) ‏کلرید ‏منیزیم ‏و ‏دزوکسی ‏نوکلئوتید ‏تری ‏فسفات ‏و ‏مخلوط ‏پرایمر ‏به ‏میزان ‏برابر ‏001/0 ‏میلی‏‏لیتر ‏(‏1 ‏لاندا) ‏و ‏در ‏نهایت، ‏از ‏DNA ‏الگو ‏و ‏آنزیم ‏مقاوم ‏به ‏حرارت ‏تک ‏پلیمراز ‏به ‏ترتیب ‏به ‏میزان ‏005/0 ‏(‏5 ‏لاندا) ‏و ‏0004/0 ‏ ‏میلی‏‏لیتر ‏(‏4 ‏دهم ‏لاندا) ‏استفاده ‏شد. ‏مجموع ‏غلظت ‏کل ‏مواد ‏واکنش ‏زنجیری ‏پلیمراز ‏05/0 ‏ ‏میلی‏‏لیتر ‏(‏50 ‏لاندا) ‏بود. ‏مواد ‏مورد ‏نظر ‏به ‏دقت ‏و ‏با ‏رعایت ‏شرایط ‏مناسب ‏برای ‏اجتناب ‏از ‏آلودگی ‏در ‏یک ‏میکروتیوپ ‏2/0 ‏میلی‏‏لیتری ‏ریخته ‏شد. ‏

پس ‏از ‏انجام ‏واکنش ‏زنجیری ‏پلیمراز ‏مقدار ‏5 ‏میکرولیتر ‏از ‏محصول ‏واکنش ‏زنجیری ‏پلیمراز ‏روی ‏ژل ‏آگاروز ‏1 ‏درصد ‏به ‏همراه ‏اندازه ‏نشانگر ‏100 ‏تا ‏1000 ‏الکتروفورز ‏و ‏باندهای ‏اختصاصی ‏مشاهده ‏شد. ‏

برای ‏تعیین ‏توالی ‏محصول ‏واکنش ‏زنجیری ‏پلیمراز ‏ژن ‏SrRNA ‏16، ‏45 ‏میکرولیتر ‏از ‏محصول ‏نهایی ‏واکنش ‏زنجیری ‏پلیمراز ‏به ‏همراه ‏پرایمر ‏Forward (جدول 1) ‏برای ‏تعیین ‏توالی ‏برای ‏شناسایی ‏مولکولی ‏براساس ‏ژن ‏SrRNA ‏16 ‏به ‏شرکت ‏ماکروژن ‏کره ‏جنوبی‏[25] ‏ارسال ‏شد. ‏

توالی‏های ‏ارسال ‏شده ‏از ‏شرکت ‏ماکروژن، ‏توسط ‏نرم ‏افزار ‏کرومس‏[26] ‏مشاهده ‏و ‏کیفیت ‏تعیین ‏توالی ‏از ‏روی ‏پیک‏های‏های ‏ترسیمی ‏بررسی ‏شد. ‏با ‏استفاده ‏از ‏نرم ‏افزار ‏بلاست‏[27] ‏در ‏پایگاه ‏اینترنتی ‏بانک ‏اطلاعات ‏ژنی‏[28] ‏توالی‏های ‏همسان ‏مشخص ‏و ‏درصد ‏تشابه ‏آن‏ها ‏بررسی ‏شد. ‏

 

جدول ‏1- ‏توالی ‏پرایمر ‏مورد ‏استفاده ‏در ‏روش ‏واکنش ‏زنجیره‏ای ‏پلی‏مراز ‏(‏PCR) ‏

رفرنس

پرایمر

تولی ‏پرایمر

طول ‏قطعه ‏تکثیر ‏شده

 ‏(‏33) ‏

Forward ‏پرایمر

AACTGGAGGAAGGTGGGGAT

370 ‏جفت ‏باز

Reverse ‏پرایمر

AGGAGGTGATCCAACCGCA

 


 

 

 

 

نتایج. ‏

سویه‏های ‏جدا ‏شده ‏به ‏اختصار ‏با ‏(‏RS) ‏Ramsar ‏strain ‏نمایش ‏داده ‏شد. ‏شکل ‏1 ‏تصویر ‏ماکروسوپی ‏استرپتومایسس ‏گریزئوس ‏[29]را ‏نمایش ‏می‏دهد. ‏

. ‏یافته‏های ‏به ‏دست ‏آمده ‏به ‏روش ‏کشت ‏متقاطع ‏خطی ‏(‏آنتاگونیسم ‏میکروبی)‏: ‏استرپتومایسس ‏اریترئوس[30] ‏به ‏عنوان ‏شاهد ‏مثبت ‏برای ‏بررسی ‏فعایت ‏ضد ‏میکروبی ‏استفاده ‏و ‏اثر ‏آن ‏روی ‏4 ‏سویه ‏مرجع ‏بررسی ‏شد ‏(‏جدول 2).

یافته‏های به دست آمده در روش دیسک‏گذاری و سنجش هاله ممانعت از رشد: در این روش دیسک حاوی اتیل استات به عنوان شاهد منفی استفاده و اثر سویه های دارای اثر ضد میکروبی با آن مقایسه شد (جدول 3).

شکل ‏2 ‏تصاویر ‏اثر ‏مهاری ‏در ‏روش ‏کشت ‏متقاطع ‏خطی ‏(‏آنتاگونیسم ‏میکروبی) ‏را ‏نمایش ‏می‏دهد. ‏
شکل ‏3 ‏تصویر ‏اثر ‏مهاری ‏در ‏روش ‏کشت ‏دیسک‏گذاری ‏را ‏نمایش ‏می‏دهد. ‏

. ‏شناسایی ‏ژنتیکی ‏سویه‏های ‏دارای ‏اثر ‏ضد ‏میکروبی:سویه‏ها ‏پس ‏از ‏استخراج ‏DNA ‏با ‏روش ‏تعیین ‏توالی
16S ‏rDNA ‏PCR ‏تکثیر ‏و ‏روی ‏ژل ‏آگاروز ‏نمایان ‏شدند ( شکل 4). در نهایت، ‏مشخص ‏شد ‏که ‏4 ‏سویه ‏جدید ‏باکتریایی ‏هستند ‏(‏جدول ‏4). ‏

 

شکل ‏1- ‏تصویر ‏ماکروسکوپی ‏استرپتومایسس ‏گریزئوس

 

 

جدول ‏2- بررسی ‏فعایت ‏ضد ‏میکروبی ‏سویه‏های ‏جداشده ‏به ‏روش ‏کشت ‏متقاطع ‏خطی ‏و ‏اثر ‏آن ‏روی ‏هر ‏4 ‏سویه ‏مرجع

باسیلوس ‏سوبتیلیس

اشریشیاکلی

سودوموناس ‏آئروجینوزا

استافیلوکوکوس ‏اورئوس

نام ‏سویه

+

-

+

+

RS ‏79

+

-

-

+

RS ‏80

+

-

+

+

RS ‏100

+

-

-

+

RS ‏103

+

-

-

+

کنترل

 

جدول 3- ‏یافته‏های ‏به ‏دست ‏آمده ‏از ‏طریق ‏دیسک‏گذاری ‏و ‏سنجش ‏هاله ‏ممانعت ‏از ‏رشد. ‏(‏دیسک ‏حاوی ‏اتیل ‏استات ‏به ‏عنوان ‏شاهد ‏منفی ‏استفاده ‏شد). ‏(‏(‏-) ‏بدون ‏هاله ‏ممانعت، ‏(‏+) ‏هاله ‏بین ‏صفر ‏تا ‏3 ‏میلی‏‏متر، ‏(‏++) ‏هاله ‏بین ‏3 ‏تا ‏5 ‏میلی‏‏متر، ‏(‏+++) ‏هاله ‏بیشتر ‏از ‏5 ‏میلی‏‏متر) ‏

باسیلوس ‏سوبتیلیس

اشریشیاکلی

سودوموناس ‏آئروجینوزا

استافیلوکوکوس ‏اورئوس

نام ‏سویه

+

-

-

++

RS ‏79

++

-

+

++

RS ‏80

+

-

-

++

RS ‏100

+

-

+

+

RS ‏103

-

-

-

-

کنترل

جدول ‏4- ‏چهار ‏سویه ‏جدید ‏باکتریایی ‏جدا ‏شده ‏و ‏ثبت ‏شده ‏در ‏National ‏Center ‏for ‏Biotechnology ‏Information ‏و ‏درصد ‏همسانی ‏آن‏ها ‏با ‏نزدیکترین ‏سویه

شماره ‏ثبت ‏در ‏NCBI

درصد ‏همسانی

نام ‏ثبت ‏شده

نزدیکترین ‏سوش

نام ‏سویه

JN084044

99

Streptomycesgriseusstraincaspian7

Streptomycesgriseus

RS ‏79

JN084045

99

Streptomycesgriseusstraincaspian8

Streptomycesgriseus

RS80

JN084047

99

Streptomycesgriseusstraincaspian10

Streptomycesgriseus

RS ‏100

JN084051

99

Streptomycesgriseusstraincaspian12

Streptomycesgriseus

RS ‏103

 

 

شکل ‏2- ‏تصاویر ‏اثر ‏مهاری ‏در ‏روش ‏کشت ‏متقاطع ‏خطی ‏(‏آنتاگونیسم‏ ‏میکروبی) ‏

 

 

 

شکل ‏3- ‏تصویر ‏اثر ‏مهاری ‏در ‏روش ‏کشت ‏دیسک‏گذاری

 

 

شکل ‏4- نتیجه ‏حاصل ‏از ‏الکتروفورز ‏با ‏ژل ‏1 ‏درصد ‏محصول ‏تکثیر ‏با ‏روش ‏SrDNA ‏16 ‏(‏M ‏بیانگر ‏لدر ‏100 ‏bp ‏DNA، ‏چاهک ‏شماره ‏1 ‏کنترل ‏منفی ‏و ‏چاهک‏های ‏2 ‏تا ‏5 ‏محصول ‏حاصل ‏از ‏تکثیر ‏DNA ‏هدف ‏هستند). ‏

بحث ‏و ‏نتیجه ‏گیری. ‏

در ‏دهه‏های ‏گذشته ‏ترکیبات ‏بسیار ‏زیادی ‏از ‏باکتری‏های ‏آبزی ‏و ‏دیگر ‏منابع ‏برای ‏توسعه ‏و ‏پیشرفت ‏در ‏زمینه‏های ‏پزشکی ‏جدا ‏شده ‏است. ‏هدف ‏از ‏پژوهش ‏حاضر، ‏جداسازی ‏باکتری‏های ‏آبزی ‏با ‏توانایی ‏تولید ‏مواد ‏ضد ‏میکروبی ‏از ‏دریای ‏خزر ‏بود. ‏نمونه‏های ‏فراوانی ‏از ‏منطقه ‏رامسر ‏در ‏استان ‏مازندران ‏جمع ‏آوری ‏شد. ‏فعایت ‏ضد ‏میکروبی ‏در ‏بین ‏162 ‏کلونی ‏مختلف ‏با ‏استفاده ‏از ‏2 ‏روش ‏مختلف ‏سنجیده ‏شد. ‏در ‏روش ‏اول، ‏اثر ‏ضد ‏میکروبی ‏باکتری ‏مورد ‏نظر ‏به ‏شکل ‏زنده ‏به ‏روش ‏آنتاگونیسم ‏میکروبی ‏بررسی ‏شد. ‏نتایج ‏نشان ‏داد ‏که ‏باکتری‏های ‏مورد ‏نظر ‏در ‏100 ‏درصد ‏مورد ‏علیه ‏گرم ‏مثبت‏ها ‏مؤثر ‏بودند ‏ولی ‏اثر ‏آن‏ها ‏روی ‏گرم ‏منفی‏ها ‏بسیار ‏ضعیف ‏بود؛ ‏به ‏طوری ‏‏که ‏اشریشیاکلی ‏در ‏هیچ ‏یک ‏از ‏موارد ‏رشد ‏آن ‏مهار ‏نشد. ‏در ‏روش ‏بررسی ‏از ‏طریق ‏دیسک ‏نیز ‏نتایج ‏تا ‏حدود ‏بسیار ‏زیادی ‏مشابه ‏روش ‏اول ‏بود ‏به ‏طوری ‏‏که ‏گرم ‏مثبت‏ها ‏در ‏همه ‏موارد ‏مهار ‏شدند ‏اما ‏گرم ‏منفی‏ها ‏بسیار ‏مقاوم ‏بودند. ‏در ‏مورد ‏نتایج ‏این ‏دو ‏روش ‏می‏توان ‏گفت ‏که ‏در ‏این ‏دو ‏روش ‏اثر ‏مهاری ‏روی ‏گرم ‏مثبت‏ها ‏بوده ‏است ‏و ‏گرم ‏منفی‏ها ‏به ‏مقدار ‏بسیار ‏کمی ‏مهار ‏شده ‏اند. ‏این ‏امر ‏می‏تواند ‏مربوط ‏به ‏تفاوت ‏ساختار ‏دیواره ‏سلولی ‏در ‏گرم ‏مثبت‏ها ‏و ‏گرم ‏منفی‏ها ‏باشد. ‏در ‏پژوهش‏های ‏مختلف ‏نشان ‏داده ‏شد ‏که ‏اثر‏گذاری ‏مواد ‏ضد ‏میکروبی ‏در ‏برابر ‏گرم ‏مثبت‏ها ‏بیشتر ‏از ‏گرم ‏منفی‏هاست. ‏دیواره ‏سلولی ‏گرم ‏مثبت‏ها ‏متشکل ‏از ‏چندین ‏لایه ‏پپتیدوگلایکن ‏است، ‏در ‏مقابل ‏باکتری‏های ‏گرم ‏منفی ‏دارای ‏غشای ‏خارجی ‏منحصر ‏به ‏فردی ‏هستند. ‏آن‏ها ‏دارای ‏یک ‏لایه ‏ظریف ‏پپتیدوگلایکن ‏هستند. ‏مقاومت ‏گرم ‏منفی‏ها ‏به ‏آنتی‏بیوتیک ‏ناشی ‏از ‏غشای ‏خارجی ‏است. ‏این ‏غضای ‏خارجی ‏متشکل ‏از ‏پلی‏ساکارید ‏است ‏که ‏دارای ‏ترکیبات ‏ساختاری ‏لیپو ‏پلی‏ساکاریدی ‏می‏باشد. ‏این ‏امر، ‏دیواره ‏آن‏ها ‏را ‏غیر ‏قابل ‏نفوذ ‏می‏کند ‏و ‏آن‏ها ‏را ‏از ‏فروپاشی ‏مصون ‏می‏دارد ‏(‏34). ‏نتایج ‏به ‏دست ‏آمده ‏در ‏پژوهش‏های ‏دیگر ‏نیز ‏تا ‏حد ‏زیادی ‏با ‏نتایج ‏پژوهش ‏حاضر ‏انطباق ‏داشت. ‏در ‏پژوهشی ‏که ‏در ‏سال ‏2010 ‏در ‏مورد ‏فعالیت ‏ضد ‏میکروبی ‏باکتری‏های ‏آبزی ‏در ‏خلیج ‏مکزیک ‏انجام ‏شد، ‏نشان ‏داده ‏شد ‏که ‏باکتری‏های ‏گرم ‏منفی ‏به ‏اندازه ‏باکتری‏های ‏گرم ‏مثبت ‏به ‏اثر ‏ضد ‏میکروبی ‏حساس ‏نبودند؛ ‏به ‏طوری ‏‏که ‏مشاهده ‏شد ‏هاله ‏ممانعت ‏از ‏رشد ‏ایجاد ‏شده ‏بر ‏علیه ‏سودوموناس ‏آئروجینوزا ‏بسیار ‏کوچک‏تر ‏از ‏هاله ‏ایجاد ‏شده ‏بر ‏علیه ‏استافیلوکوکوس ‏اورئوس ‏بود ‏و ‏نیز ‏در ‏اطراف ‏اشریشیاکلی ‏هیچ ‏هاله ‏ممانعت ‏از ‏رشدی ‏مشاهده ‏نشد ‏(‏35). ‏در ‏پژوهشی ‏که ‏توسط ‏زنگ‏[xxxi] ‏و ‏همکاران ‏انجام ‏شد ‏نشان ‏داده ‏شد ‏که ‏در ‏42 ‏سویه ‏جدا ‏شده ‏با ‏فعالیت ‏ضد ‏میکروبی ‏در ‏69 ‏درصد ‏موارد ‏باسیلوس ‏سوبتیلیس ‏و ‏در ‏52 ‏درصد ‏از ‏موارد ‏استافیلوکوکوس ‏اورئوس ‏مهار ‏شدند. ‏اما ‏نکته ‏جالب ‏این ‏بود ‏که ‏تنها ‏در ‏4 ‏مورد ‏یعنی ‏در ‏9 ‏درصد ‏از ‏موارد ‏اشریشیاکلی ‏مهار ‏شد ‏(‏32). ‏در ‏پژوهش ‏دیگری ‏در ‏سال ‏1998 ‏نتایج ‏مشابهی ‏به ‏دست ‏آمد، ‏در ‏پژوهش ‏حاضر ‏نیز ‏مشاهده ‏شد ‏در ‏میان ‏126 ‏سویه ‏با ‏فعالیت ‏ضدمیکروبی ‏تنها ‏در ‏4 ‏مورد ‏اشریشیاکلی ‏مهار ‏شد ‏(‏36). ‏در ‏پژوهش ‏انجام ‏شده ‏برای ‏استخراج ‏ماده ‏ضد ‏میکروبی ‏از ‏اتیل ‏استات ‏استفاده ‏شد. ‏این ‏امر ‏در ‏مطالعات ‏دیگر ‏نیز ‏انجام ‏شد ‏به ‏طوری ‏‏که ‏در ‏پژوهش ‏دیگری ‏که ‏در ‏سال ‏2013 ‏انجام ‏شد ‏برای ‏بازیابی ‏فعالیت ‏ضد ‏میکروبی ‏و ‏استخراج ‏ماده ‏ضد ‏میکروبی ‏از ‏حلال ‏اتیل ‏استات ‏استفاده ‏شد ‏(‏37). ‏در ‏مطالعات ‏پیشین ‏نیز ‏این ‏نتیجه ‏به ‏دست ‏آمده ‏بودکه ‏بیشتر ‏ترکیبات ‏ضد ‏میکروبی ‏با ‏اتیل ‏استات ‏استخراج ‏می‏شوند ‏(‏38). ‏ماده ‏ضد ‏میکروبی ‏استخراج ‏شده ‏توسط ‏اتیل ‏استات ‏ممکن ‏است ‏حاوی ‏ترکیبات ‏گوناگونی ‏باشد. ‏از ‏مهم ‏ترین ‏آن‏ها ‏که ‏سبب ‏خاصیت ‏ممانعت ‏کنندگی ‏می‏شود ‏می‏توان ‏به ‏آنتی‏بیوتیک‏ها ‏اشاره ‏کرد. ‏در ‏پژوهشی ‏که ‏در ‏سال ‏2008 ‏انجام ‏شد ‏پس ‏از ‏استخراج ‏ماده ‏ضد ‏میکروبی ‏از ‏طریق ‏کروماتوگرافی ‏ترکیبات ‏ضد ‏میکروبی ‏گونه ‏مشخصی ‏از ‏استرپتومایسس ‏تحلیل ‏شد. ‏در ‏پژوهش ‏حاضر، ‏بر ‏اساس ‏مقایسه ‏پیک‏های ‏جذبی، ‏ترکیبات ‏ماده ‏ضد ‏میکروبی ‏بررسی ‏شد ‏(‏30). ‏در ‏مطالعه ‏دیگری ‏در ‏سال ‏2014 ‏مشخص ‏شد ‏که ‏یک ‏سویه ‏مشخص ‏از ‏استرپتومایسس ‏دارای ‏فعالیت ‏ضد ‏میکروبی ‏است. ‏پس ‏از ‏تجزیه ‏و ‏تحلیل ‏و ‏شناسایی ‏آن، ‏ترکیب ‏ضد ‏میکروبی ‏تولید ‏شده ‏توسط ‏این ‏سویه ‏به ‏طور ‏جزیی ‏شناسایی ‏شد. ‏در ‏پژوهش ‏حاضر ‏مشخص ‏شد ‏که، ‏فعالیت ‏ضد ‏میکروبی ‏تحت ‏تأثیر ‏پروتئیناز ‏K ‏یا ‏درجه ‏حرارت ‏بالا ‏نظیر ‏(‏60 ‏درجه ‏و ‏یا ‏100 ‏درجه ‏سانتی‏‏گراد) ‏از ‏بین ‏نمی‏‏رود. ‏بر ‏اساس ‏این ‏یافته‏ها ‏می‏توان ‏به ‏این ‏نتیجه ‏رسید ‏که ‏ترکیب ‏فعال ‏ضد ‏میکروبی ‏ممکن ‏است ‏دارای ‏ساختاری ‏غیر ‏پروتئینی ‏باشد. ‏(‏عواملی ‏غیر ‏پروتئینی ‏به ‏غیر ‏از ‏آنتی‏بیوتیک‏ها ‏در ‏فعالیت ‏ضد ‏میکروبی ‏دخیل ‏است). ‏در ‏پژوهش ‏حاضر ‏نیز ‏برای ‏شناسایی ‏دقیق‏تر ‏‏‏ساختار ‏و ‏ترکیب ‏ماده ‏ضد ‏میکروبی ‏به ‏پژوهش‏های ‏و ‏آزمایش‏های ‏بیشتری ‏نیاز ‏بود ‏(‏39). ‏در ‏پژوهش ‏دیگری ‏در ‏هند، ‏پتانسیل ‏ضد ‏میکروبی ‏اکتینومایست‏ها ‏بررسی ‏شد. ‏در ‏پژوهش ‏حاضر ‏پس ‏از ‏انجام ‏تجزیه ‏و ‏تحلیل ‏از ‏طریق ‏کروماتوگرافی ‏لایه ‏نازک ‏و ‏استفاده ‏از ‏معرف‏های ‏گوناگون ‏مشخص ‏شد ‏ترکیب ‏ضد ‏میکروبی ‏ممکن ‏است ‏الکل، ‏فنل ‏و ‏یا ‏استروئید ‏باشد ‏(‏40). ‏در ‏زمینه ‏بررسی ‏اثر ‏ضد ‏میکروبی ‏استرپتومایسس‏ها ‏پژوهشی ‏در ‏سال ‏2014 ‏برای ‏جداسازی ‏و ‏تعیین ‏ویژگی‏ها ‏و ‏فعالیت ‏ضد ‏میکروبی ‏استرپتومایسس ‏انجام ‏شد. ‏در ‏پژوهش ‏حاضر، ‏از ‏محیط‏های ‏کشت ‏متفاوت ‏و ‏متنوعی ‏برای ‏برسی ‏فعالیت ‏استرپتومایسس ‏بر ‏ضد ‏پاتوژن‏ها ‏استفاده ‏شد ‏ولی ‏نکته ‏مشترک ‏در ‏نتایج ‏پژوهش ‏حاضر ‏این ‏بود ‏که ‏در ‏محیط ‏کشت‏های ‏متفاوت ‏مقاومت ‏بسیار ‏بالایی ‏در ‏اشریشیاکلی ‏مشاهده ‏شد ‏و ‏همچنین ‏سودوموناس ‏آئروجینوزا ‏نیز ‏تا ‏حد ‏بالایی ‏مقاوم ‏بود ‏اما ‏در ‏مقابل ‏بر ‏خلاف ‏اشریشیاکلی ‏و ‏سودوموناس ‏آئروجینوزا ‏اثر ‏ضد ‏میکروبی ‏بر ‏ضد ‏باسیلوس ‏سوبتیلیس ‏و ‏استافیلوکوکوس ‏اورئوس ‏به ‏میزان ‏بالایی ‏در ‏محیط‏های ‏مختلف ‏مشاهده ‏شد. ‏این ‏امر ‏گویای ‏مقاوت ‏بالای ‏اشریشیاکلی ‏و ‏سودوموناس ‏آئروجینوزا ‏به ‏این ‏نوع ‏از ‏استرپتومایسس ‏است ‏(‏39). ‏در ‏پژوهش ‏دیگری ‏که ‏در ‏سال ‏2003 ‏انجام ‏شد ‏حدود ‏46 ‏درصد ‏از ‏نمونه‏های ‏جدا ‏شده ‏دارای ‏فعالیت ‏ضد ‏میکروبی ‏بودند ‏البته ‏در ‏این ‏بین ‏پایین ‏ترین ‏فعالیت ‏ضد ‏میکروبی ‏که ‏در ‏حدود ‏5 ‏درصد ‏بود ‏برعلیه ‏گرم ‏منفی‏ها ‏مشاهده ‏شد ‏(‏22). ‏شناسایی ‏گونه‏ها ‏با ‏استفاده ‏از ‏روش‏های ‏مولکولی ‏درجه ‏بالایی ‏از ‏سرعت ‏و ‏دقت ‏را ‏فراهم ‏کرد؛ ‏به ‏طوری ‏‏که ‏شناسایی ‏مولکولی ‏به ‏مراتب ‏ساده‏تر ‏‏‏است ‏زیرا ‏پرایمرها ‏هدف‏های ‏بسیار ‏ویژه‏ای ‏در ‏شناسایی ‏اکتینومایست‏ها ‏در ‏روش ‏SrRNA16 ‏می‏باشند ‏و ‏شناسایی ‏با ‏این ‏روش ‏دقیق‏تر ‏‏‏و ‏صحیح‏تر ‏‏‏است ‏(‏40). ‏

تشکر ‏و ‏قدرانی..

از ‏سرکار ‏خانم ‏مهندس ‏بزرگ ‏نیا ‏برای ‏پیشبرد ‏بهینه ‏پژوهش ‏حاضر ‏تشکر ‏و ‏قدردانی ‏می‏شود.



[1]- Staphylococcus aureus

[2]- Pseudomonas aeruginosa

[3]- Streptomyces

[4]- Actinomycete

[5]- Aminoglycosides

[6]- ß-lactams

[7]- Macrolides

[8]- Peptides

[9]- Polyenes

[10]- Nucleosides

[11]- Microbial antagonism ‏(‏cross streak assay) ‏

[12]- Disc diffusion

[13]- Marine-Agar

[14]- Peptone

[15]- Yeast Extract

[16]- Iron Phosphate

[17]- Agar-Agar

[18]- Merck, Germany

[19]- Marine-Broth

[20]- Ethyl acetate

[21]- Bacillus subtilis

[22]- Escherichia coli

[23]- Muller Hinton Agar

[24]- CinnaGen, Iran

[25]- Macrogen Inc. ‏, South Korea

[26]- Chromas

[27]- BLAST

[28]- NCBI

[29]- Streptomyces griseus

[30]- Streptomyces erythreus

[xxxi]- Zheng L

(1)               Attimarad ‏‏SL., ‏‏Ediga ‏‏GN., ‏‏Karigar ‏‏AA., ‏‏Karadi ‏‏R., ‏‏Chandrashekhar ‏‏N., ‏‏Shivanna ‏‏C. ‏‏Screening, ‏‏isolation ‏‏and ‏‏purification ‏‏of ‏‏antibacterial agents from marine Actinomycetes. International Current Pharmaceutical Journal 2012; 1 (12): 394- 402.

(2)               AL-Zereini W. Natural products from marine bacteria [Dissertation] Jordan: Kaiserslautern Univ.; 2006.

(3)               Poosarla A., Ramana LV., Krishna RM. Isolation of potent antibiotic producing Actinomycetes from marine sediments of Andaman and Nicobar Marine Islands. Journal of Microbiology And Antimicrobials 2013; 5 (1): 6- 12.

(4)               Ogunmwonyi INH. Assessment of antibiotic production by some marine Streptomyces isolated from the Nahoon beach [Dissertation]. south Africa: Fort Hare Alice Univ.; 2010.

(5)               Jeganathan P., Rajasekaran KM., Asha Devi NK., Karuppusamy S. Antimicrobial activity and Characterization of Marine bacteria. Indian Journal ofPharmaceutical And Biological Research 2013; 1 (4): 38- 44.

(6)               Jeganathan P., Rajasekaran KM., Asha Devi NK. Antimicrobial activity and Characterization of Marine bacteria in Coastal sea water. Scholars Academic Journalof Pharmacy 2014; 3 (1): 73- 8.

(7)               Pabba SK., Samatha B., Prasad MR., Nidadavolu SH., Charya MA S. Isolation and screening of marine bacteria for antimicrobial activity along Vishakapatanam Coast. Journal of Microbiology And Biotechnology Research 2011; 1 (2): 86- 9.

(8)               Gokulkrishnan K., Kusum S., Boopalan K. Antimicrobial activity of marine bacteria isolated from the Mangalore Coast, West Coast of India. Recent Research In Science And Technology 2011; 3 (4): 15- 17.

(9)               Vimal V., Rajan BM., Kannabiran K. Antimicrobial activity of marine Actinomycete, Nocardiopsis sp. VITSVK 5 (FJ973467). Asian Journal of Medical Sciences 2009; 1 (2): 57- 63.

(10)           Subashini J., Kannabiran K. Antimicrobial activity of Streptomyces sp. VITBT7 and its synthesized silver nanoparticles against medically important fungal and bacterial pathogens. Scholars Research Library 2013; 5 (3): 192- 200.

(11)           Anand P., Chellaram C., Kumaran S., Shanthini CF. screening for antibiotic production marine bacteria against fish pathogens. International Journal of Pharma And Bio Sciences 2011;2 (1): 314- 25.

(12)           Tahmasby H., Barati S., Momtaz H., Rafiee Dolatabadi M., Ghasemi M., Ahmadi Salianeh SV., et al. An Investigation of beta-lactam antibiotics resistance in Escherichia coli isolates and molecular detection of Escherichia coli O157:H7 in cage birds from Shahrekord, Iran. Biological Journal of Microorganism 2014; 9 (3): 35- 44.

(13)           Parungao MM., G. Maceda EB., F. Villano MA. Screening of antibiotic-producing Actinomycetes from marine, Brackish and terrestrial sediments of Samal Island, Philippines. Journal of Research in Science, Computing, and Engineering 2007; 4 (3): 29- 38.

(14)           Reisi M., Tajbakhsh E., Momtaz H. Isolation and identification of antibiotic resistance genes in Staphylococcus aureus isolates from respiratory system infections in shahrekord., Iran. Biological Journal of Microorganism 2014; 10 (3): 97- 106.

(15)           Ceylan C., Okmen G., Ugur A. Isolation of soil Streptomyces as source antibiotics active against antibiotic-resistant bacteria. Eurasian Journal of Biosciences 2008; 2: 73- 82.

(16)           Bisht R., Katiyar A., Singh R., Mittal P. Antibiotic resistance–a global issue of concern. Asian Journal of Pharmaceutical and Clinical Research 2009;2 (2): 34- 9.

(17)           Jayanth K., Jeyasekaran G., Shakila J. Isolation of marine bacteria, antagonistic to human pathogens. Indian Journal of Marine Sience 2002; 31 (1): 39- 44.

(18)           Maleki H., Dehnad A., Hanifian S., Khani S. Isolation and molecular identification of Streptomyces sp. with antibacterial Activity from Northwest of Iran. Biolmpacts 2013; 3 (3): 129- 34.

(19)           Sethi S., Kumar R., Gupta S. Antibiotic production by microbes isolated from soil. International Journal of Pharmaceutical Sciences And Research 2013; 4 (8): 2967-73.

(20)           Ningthoujam DS., Sanasam S., Nimaichand S. Screening of Actinomycete isolates from niche habitats in Manipur for antibiotic activity. American Journal of Biochemistry Andbiotechnology 2009; 5 (4): 221- 5.

(21)           Ripa FA., Nikkon F., Rahman BM., Khondkar P. In vitro antibacterial activity of bioactive metabolite and crude extract from a new Streptomyces sp. Streptomyces rajshahiensis. International Journal of Pharmtech Research 2010; 2 (1): 644- 48.

(22)           Rifaat HM., Abd El Naser NH., Helmy SM., Ali AM. Taxonomical studies on certain Streptomycetes exhibiting antimicrobial activity isolated from Egyptian soils. Journal of Culture Collections 2006; 5: 25- 34.

(23)           Kay M., Hojati Z., Motovali-Bashi M. Increase of Clavulanic acid production by using recombinant Streptomyces clavuligerus strain including claR gene. Biological Journal of Microorganism 2014; 10 (3): 37- 44.

(24)           Khayatmaher R., Amoozegar MA., Seyedmahd S., Hamedi J., Naghavi MR., Foroozanfar F., et al. Isolation and screening of phytotoxin producing Actinomycetes and determination of phytotoxin effect spectrum of selected strains. Biological Journal of Microorganism 2012; 2 (1) 1- 22.

(25)           Malibari AA. Isolation and screening of antibiotic producing streptomycetes from western region soils of Saudi Arabia. Journal of King Abdulaziz University 1991; 3: 31- 42.

(26)           Sahin N. Investigation of the antimicrobial activity of some Streptomyces Isolates. Turkish Journal of Biology 2002; 27: 79- 84.

(27)           Anansiriwattana W., Tanasupawat S., Amnuoypol S., Suwanborirux K. Identification and antimicrobial activities of Actinomycetes from soils in Samed island, and geldanamycin from strain PC4-3. The Thai Journal of Pharmaceutical Sciences 2006; 30: 49- 56.

(28)           B. Ilić S., S. Konstantinović S., B. Todorović Z. UV/VIS analysis and antimicrobial activity of Streptomyces isolates. Medicine and Biology 2005; 12 (1): 44- 6.

(29)           George M., Cyriac N., Nair A., Hatha AA M. Diversity of Bacillus and Actinomycetes in the water and sediment samples from Kumarakom region of Vembanadu lake. Indian Journal of Geo-Marine Sciences 2011;40 (3): 430- 7.

(30)           Remya M., Vijayakumar R. Isolation and characterization of marine antagonistic Actinomycetes from west coast of India. Medicine And Biology 2008;15 (1): 13- 19.

(31)           Smaouti S., Mathieu F., Fguira LF., Merlina G., Mellouti L., Taxonomy and antimicrobial activities of a new Streptomyces sp. TN17 isolated in the soil from an Oasis Tunis. Archives of Biological Sciences 2011; 63 (4): 1047- 56.

(32)           Zheng L., Han X., Chen H., Lin W., Yan X. Marine bacteria associated with marine microorganisms: the potential antimicrobial resources. Annals of Microbiology 2005; 55 (2): 119- 24.

(33)           Teng LJ., Hsueh PR., Huang YH., Tsai JC. Identification of Bacteroides thetaiotaomicron on the Basis of an unexpected specific amplicon of universal 16S Ribosomal DNA PCR. Journal of Clinical Microbiology 2004; 42 (4): 1727-30.

(34)           Pandey B., Ghimire P., Agrawal VP. Studies on the antibacterial activity of the Actinomycetes isolated from the Khumbu Region of Nepal. International Journal of Biological Sciences 2004: 1- 4.

(35)           Cetina A., Matos A., Garma G., Barba H., Vázquez R. Antimicrobial activity of marine bacteria isolated from Gulf of Mexico. Revista Peruana De Biologia 2010; 17 (2): 231- 6.

(36)           Ivanova EP., Nicolan DV., Yumoto N., Taguchi T., Okamoto K., Tatsu Y., Yoshikawa S. Impact of conditions of cultivation and adsorption on antimicrobial activity of marine bacteria. Maine Biology 1998; 130: 545- 51.

(37)           Ramazani A., Moradi S., Sorouri R., Javani S., Garshasbi M. screening for antibacterial activity of Streptomyces species isolated from Zanjan province, Iran. International Journal of Pharmaceutical, Chemical and Biological Sciences 2013; 3 (2): 342- 9.

(38)           Arasua VM., Duraipandiyana V., Agastiana P ., Ignacimuthu S. Antimicrobial activity of Streptomyces spp. ERI-26 recovered from Western Ghats of Tamil Nadu. Japanese Journal of Medical Mycology 2008; 18 (3): 147- 53.

(39)           Maataoui H., Iraqui M., Jihani S., Ibnsouda S., Haggoud A. Isolation, characterization and antimicrobial activity of a Streptomyces strain isolated from deteriorated wood. African Journal of Microbiology Research 2014; 8 (11): 1178- 86.

(40)            Rana S., Salam M D. Antimicrobial potential of Actinomycetes Isolated from soil samples of Punjab, India. Journal Of Microbiology & Experimentation 2014; 2 (1): 1- 6.