بررسی اثر محیط کشت‏ های مختلف در تولید آنزیم آمیلاز توسط یک سویه بومی باسیلوس سوبتیلیس

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 کارشناسی ارشد میکروبیولوژی، واحد فلاورجان، دانشگاه آزاد اسلامی، اصفهان، ایران

2 استادیار بیوشیمی، واحد فلاورجان، دانشگاه آزاد اسلامی ،اصفهان، ایران

3 استادیار میکروبیولوژی، واحد فلاورجان، دانشگاه آزاد اسلامی، اصفهان، ایران

چکیده

مقدمه: آمیلاز از مهم‏ترین آنزیم‏هایی است که در زیست فناوری اهمیت زیادی دارد. آمیلاز با کاربرد تجاری، به‏طور گسترده‏‏ از جنس‏های ‏‏باسیلوس به دست‏ می‏آید. هدف از پژوهش حاضر، شناسایی و جداسازی باسیلوس مولد آنزیم آمیلاز، تعیین فعالیت آنزیم آمیلاز و بررسی اثر تعدادی محیط کشت بر تولید این آنزیم‏ است‏‏. ‏‏‏

مواد و روش‏‏ها: نمونه‏های خاک از منطقه کشاورزی و آب از تالاب چغاخور در استان چهارمحال و بختیاری و نمونه‏های پساب از کارخانه مواد غذایی در استان اصفهان به شکل تصادفی جمع‏‏‏آوری شد. برای‏‏ غربال‏گری‏‏ سویه‏های مولد آنزیم آمیلاز، از محیط نشاسته آگار استفاده شد. فعالیت آنزیم آمیلاز با روش دی نیتروسالیسیلیک اسید (DNS) اندازه‏‏‏گیری شد. اثر محیط کشت‏های تریپتیکیس سوی براث (TSB)، نوترینت براث (NB)، محلول عصاره مخمر، شیر و ملاس چغندر بر تولید آنزیم آمیلاز بررسی شد. ‏‏‏

نتایج: از بین جدایه‏های مولد آنزیم آمیلاز، یک سویه جدا شده از پساب دارای بیش‏ترین فعالیت آنزیم بود. با توجه به جدول باسیلوس‏های کتاب برگی و شناسایی مولکولی‏‏، نمونه جداسازی شده به گونه باسیلوس سوبتیلیس متعلق بود. فعالیت آنزیم آمیلاز توسط باسیلوس سوبتیلیس در محیط تولید برابر با 21/7 (یونیت/ میلی‏لیتر) اندازه‏‏‏گیری شد. ‏‏‏

بحث و نتیجه‏ گیری: در پژوهش حاضر، سویه باسیلوس سوبتیلیس جدا شده از پساب میزان در خور توجهی از تولید آنزیم معادل 21/7 (یونیت/ میلی‏لیتر) را نشان داد. در بین محیط‏های کشت بیش‏ترین میزان فعالیت آنزیم آمیلاز حاصل از باسیلوس سوبتیلیس در محیط ملاس چغندر مشاهده شد‏. با توجه به پژوهش حاضر استفاده از سویه‏های باسیلوس برای دستیابی به آنزیم آمیلاز روشی کارآمد‏ است‏‏. ‏‏‏

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

A Study on Effect of different culture media on amylase enzyme production by a native strain of Bacillus subtilis

نویسندگان [English]

  • Ziba Akbari 1
  • Hashem Nayeri 2
  • Keivan Beheshtimaal 3
1 M.Sc. of Microbiology, Falavarjan Branch, Islamic Azad Univercity, Isfahan, Iran
2 Assistant Professor of Biochemistery, Falavarjan Branch, Islamic Azad Univercity, Isfahan, Iran
3 Assistant Professor of Macrobiology, Falavarjan Branch, Islamic Azad Univercity, Isfahan, Iran
چکیده [English]

Introduction: Amylases are among the most important enzymes and have great significance in present-day biotechnology. Amylase with commercial applications is mainly derived from the genus Bacillus. The main purpose of this study is identification and isolatation amylase enzyme producer Bacillus, determining the amylase enzyme activity and affecting a number of culture medium on amylase enzyme production.

Materials and methods: Soil, water and wastewater samples were collected from agricultural area, choghakhor lake in chahar mahal e bakhtiari province and from food factory in Esfahan. Bacillus isolates were screened for amylolytic properties by starch hydrolysis test on starch agar plate. Amylase producing Bacillus were identified biochemical tests and molecular experiments. Amylase enzyme activity of isolates was measured using di-nitro salicylic acid (DNS) method. Enzyme production was studied in variose medium culture TSB, NB, Yeast extract, molases and milk medium.

Results: The enzyme amylase-producing strains, one sample showed was the highest amylase activity. The Bacillus has been detected as a member of Bacillus subtilis according to Bergey's Manual of Systematic Bacteriology and molecular recognition. The enzyme activity of Bacillus subtilis was measured 7/21 (U/ml) in production media. Trough medium culture maximum amylase production for Bacillus subtilis was achieved in molases medium.

Discussion and conclusion: In this study, Bacillus subtilis strains isolated from wastewater of a significant amount of enzyme producing 7/21 (U/ml) as indicated. Among the medium-amylase from Bacillus subtilis highest enzyme activity was observed in beet molasses. According to this study, the use of Bacillus strains is an efficient way to achieve the amylase enzyme.

کلیدواژه‌ها [English]

  • Amylase
  • Bacillus subtilis
  • Culture medium
  • Wastewater

مقدمه.

آمیلازها آنزیم‏هایی هستند که نشاسته را هیدرولیز‏ می‏کنند. دانه‏های نشاسته در آب سرد نا محلول بوده و بیشتر به آنزیم‏ها ‏و مواد شیمیایی مقاوم هستند (1). در واقع نشاسته پلیمری از گلوکز است که به واسطه پیوندهای گلیکوزیدی به یکدیگر متصل شده‏اند‏ (2). آمیلازها از مهم‏ترین ‏آنزیم‏ها ‏در زیست فناوری محسوب‏ می‏شوند و اهمیت آن‏ها ‏به علت‏ کاربرد گسترده این آنزیم‏هاست‏‏. آمیلازها کاربردهای وسیعی در صنایع مختلف نظیر نساجی، کاغذ‏سازی‏، شوینده‏ها‏، نانوایی و صنایع غذایی اعم از تهیه شربت‏های فروکتوز و گلوکز، آب میوه‏ها‏، شیرین کننده‏ها ‏و نوشیدنی‏های الکلی دارند. کاربرد این آنزیم‏ها ‏امروزه در زمینه پزشکی و شیمی تجزیه نیز گسترده شده است (3- 6). اگر چه بسیاری از گیاهان، جانوران و میکروارگانیسم‏ها ‏توانایی تولید آنزیم آمیلاز را دارند ولی این آنزیم با منشاء میکروبی دارای مصارف صنعتی‏ است‏‏ (2، 6 و 7). در این بین، جنس باسیلوس طیف وسیعی از آنزیم‏های خارج سلولی از قبیل آمیلاز را تولید‏ می‏کند که کاربرد مهمی در صنعت دارد. از باسیلوس‏های مولد آنزیم آمیلاز‏ می‏توان به باسیلوس سوبتیلیس، باسیلوس لیکنی فورمیس، باسیلوس سرئوس و باسیلوس پلی میکسا اشاره کرد (2، 7 و 8). تولید آنزیم آمیلاز به مواردی از قبیل سویه‏ها‏، ترکیب محیط کشت، روش کشت، رشد سلول و زمان گرماگذاری بستگی دارد (9). باتوجه به این که برای تولید آنزیم‏های صنعتی نیاز به سویه مناسب و سپس، فناوری مربوط‏ است‏‏، هدف از پژوهش حاضر جداسازی سویه برتر مولد آنزیم آمیلاز از منابع مختلف شامل خاک،‏‏ پساب و آب، تعیین میزان فعالیت آنزیم آمیلاز و بررسی اثر تعدادی محیط‏های کشت بر تولید آنزیم آمیلاز توسط این سویه است.

‏‏مواد و روش ‏ها.

مواد شیمیایی: در پژوهش حاضر از محیط کشت نوترینت آگار، محیط کشت نشاسته آگار، محیط تریپتیکیس سوی براث، نوترینت براث، لوگول، نشاسته سیب زمینی، دانه سویا، عصاره گوشت، کلسیم کلراید، سولفات منیزیم، فسفات پتاسیم و عصاره مخمر محصول شرکت مرک [1] آلمان و همچنین، از دی‏نیتروسالیسیلیک اسید، بافر سدیم فسفات، نشاسته محلول ویژه سنجش و مالتوز محصول شرکت سیگما [2] آمریکا استفاده شد‏.

نمونه‏گیری ‏از منابع مختلف: .

نمونه‏گیری ‏از خاک: نمونه‏های خاک کشاورزی از استان چهارمحال و بختیاری در ظروف تمیز و استریل جمع‏‏‏آوری شد. با رعایت شرایط استریل پس از خشک شدن، نمونه‏ها ‏به خوبی ساییده و نرم شدند و از صافی یا الک‏های ریز عبور داده شدند.

نمونه‏گیری از آب: نمونه‏های آب از قسمتی از تالاب چغاخور از عمق حدود 60 سانتی‏متر در ظروف استریل یک لیتری جمع‏‏‏آوری و به آزمایشگاه منتقل شد. علت‏ انتخاب این عمق، همجواری زمین‏های کشاورزی زیر کشت غلات با این قسمت از تالاب بود.

نمونه‏گیری ‏از پساب: نمونه‏های پساب از کارخانه‏های بستنی‏سازی‏، کیک و نوشابه‏سازی‏ در استان اصفهان که حاوی نشاسته و ترکیبات الیگوساکاریدی‏ است‏‏، در ظروف تمیز و استریل جمع‏‏‏آوری شد.

تهیه رقت از نمونه‏ها‏: .

رقیق‏سازی‏ نمونه خاک: از هر نمونه خاک با استفاده از کاغذ تمیز و ترازوی دقیق مقدار یک گرم وزن شده و در کنار شعله به لوله آزمایش حاوی 9 میلی‏لیتر آب مقطر استریل اضافه شد تا رقت 1/0 به دست آید. به علت‏ این که مقدار باکتری‏ها ‏و اسپور‏های موجود درخاک بسیار زیاد است برای جداسازی دقیق آن‏ها ‏از رقت 1-10 تا 5-10 استفاده شد.

رقیق‏سازی‏ نمونه آب و پساب: از نمونه‏های آب و پساب جمع‏‏‏آوری شده در شرایط استریل مقدار ‏1 میلی‏لیتر در کنار شعله به لوله آزمایش حاوی 9 میلی‏لیتر آب مقطر استریل اضافه شد. پس از به دست آمدن رقت 1/0 از نمونه پساب، رقت‏های 1-10 تا 5- 10 تهیه شد‏. سپس، برای‏‏ یکسان بودن شرایط آزمایش از نمونه آب نیز مشابه با دو نمونه خاک و پساب رقت‏های 1-10 تا 5-10 تهیه شد.

کشت نمونه‏ها‏: نمونه‏های خاک، آب و پساب بر روی محیط نوترینت آگار به شکل خطی کشت و خالص‏سازی شد‏. سپس، با استفاده از رنگ‏آمیزی گرم و مشاهدات میکروسکوپی تعیین هویت مقدماتی شد.

غربال‏گری ‏گونه مناسب مولد آنزیم آمیلاز: برای غربال‏گری ‏گونه مناسب مولد آنزیم آمیلاز در ابتدا از محیط کشت نشاسته آگار استفاده شد و محیط‏های کشت برای مدت 48 تا 72 ساعت در دمای 30 درجه سانتی‏گراد ‏گرماگذاری شدند (6 و 9). رنگ محیط کشت نشاسته آگار به علت وجود نشاسته کدر است و گونه‏ای که بتواند نشاسته را هیدرولیز کند باعث شفاف شدن محیط‏ می‏شود. بنابراین، پس‏ از 48 تا 72 ساعت گونه‏هایی که در اطراف کلونی‏ تک خود هاله شفاف ایجاد کرده بودند مولد آنزیم آمیلاز بوده و برای مراحل بعد انتخاب شدند. برای تایید عمل هیدرولیز نشاسته از معرف لوگول استفاده شد که رنگ آبی تیره معرف لوگول در محیط کشت نشاسته آگار، در جایی که هاله حاصل از هیدرولیز نشاسته وجود دارد به رنگ آبی کم رنگ تا بی رنگ متمایل‏ می‏شود.

تولید آمیلاز: مقدار 30 میلی‏لیتر محیط تریپتیکیس سوی براث در یک ارلن تمیز تهیه شد. پس از استریل شدن با باسیلوس تلقیح و به مدت 24 ساعت در دمای 30 درجه سانتی‏گراد ‏و در شیکر با سرعت 150 دور بر دقیقه [3] گرماخانه گذاری شد. پس از فعال شدن جدایه باسیلوس در محیط تریپتیکیس سوی براث، سوسپانسیون باکتریایی با رقت 108 × 5/1 به میزان 2 میلی‏لیتر در شرایط استریل و در کنار شعله به محیط تولید آنزیم تلقیح شد. ترکیبات محیط تولید آنزیم (10) بر حسب گرم بر لیتر شامل: نشاسته سیب زمینی (10)، دانه سویا (4)،‏ عصاره گوشت (3)،‏ کلسیم کلراید (5/0)، سولفات منیزیم (3/0) و فسفات پتاسیم (1) ‏است‏‏. گرماگذاری محیط تولید به مدت 144 ساعت در دمای 30 درجه سانتی‏گراد ‏و 150 دور بر دقیقه انجام شد.

سنجش فعالیت آنزیم آمیلاز: برای‏‏ بررسی میزان فعالیت آنزیم آمیلاز تولید شده از روش DNS [4] استفاده شد. (7 و 11) برای‏‏ اندازه‏‏‏گیری فعالیت آنزیم آمیلاز در ابتدا از 5/0 میلی‏لیتر آنزیم خام، 5/0 میلی‏لیتر محلول نشاسته 1 درصد و بافرسدیم فسفات با اسیدیته 9/6 استفاده شد. سپس، از 5/0 میلی‏لیتر معرف رنگی دی‏نیتروسالیسیلیک اسید (DNS) برای‏‏ توقف واکنش استفاده شد‏ (7، 9 و 10). جذب نوری محلول در طول موج 540 نانومتر توسط دستگاه اسپکتروفتومتر خوانده شد. بنا بر روش استفاده شده یک واحد فعالیت آنزیم آمیلاز برابر با مقدار آنزیمی است که بتواند یک میکرومول قند احیا کننده را در مدت یک دقیقه در شرایط واکنش آزاد کند. بدین ترتیب نمونه‏های منتخب بر اساس این روش مقایسه و برترین سویه انتخاب شد‏.

رسم منحنی استاندارد مالتوز: برای محاسبه میزان فعالیت آمیلاز نمونه‏های جدا شده، از منحنی استاندارد مالتوز استفاده شد. برای‏‏ ترسیم منحنی استاندارد، از مالتوز با رقت‏های 1/0، 4/0 ، 8/0 ، 2/1، 6/1، 2 و 4 درصد آب دو بار تقطیر و معرف رنگی دی‏نیتروسالیسیلیک اسید استفاده شد‏.

شناسایی باکتری مولد آنزیم آمیلاز.

ویژگی‏های بیوشیمیایی: برای‏‏ شناسایی سویه‏های باسیلوس از آزمون‏‏‏های بیوشیمیایی باسیلوسها استفاده شد‏ (9 و 12).

ویژگی‏های مولکولی‏‏: سویه برتر غربال شده بر مبنای مشاهدات بالا برای‏‏ شناسایی مولکولی‏‏ انتخاب شد‏. عمل PCR با استفاده از دو آغازگر:

FD1:5' AGAGTTTGATCCTGGCTTAG 3'

RD1: 5' TAAGGAGGTGATCCAGCC 3'

انجام شد. برای‏‏ شناسایی فیلوژنتیکی پس‏ از انجام PCRو الکتروفورز روی ژل آگارز، قطعات تکثیر و خالص شده تعیین توالی شد. سپس، مقایسه توالی 16srDNA باسیلوس جدا شده با توالی‏های موجود در پایگاه اطلاعات ژنومی با استفاده از نرم افزار بلاست [5] انجام شد‏.

.بررسی اثر محیط کشت‏های مختلف بر تولید آنزیم آمیلاز: اثر محیط کشت‏های تریپتیکیس سوی براث (TSB)[6]، نوترینت براث (NB)[7] محلول عصاره مخمر، شیر و ملاس چغندر بر تولید آنزیم آمیلاز توسط سویه برتر جدا شده بررسی شد. قبل از کشت میکروب در این محیط‏ها ‏ابتدا تمام این محیط‏ها ‏با روش ساخت خاص خود تهیه شد. برای فعال‏سازی‏ باسیلوس که در مرحله غربال‏گری‏‏ انتخاب شد از محیط کشت مایع تریپتیکیس سوی براث استفاده شد. سپس، از سوسپانسیون باکتریایی با رقت 108 × 5/1 به میزان 2 میلی‏لیتر در شرایط استریل به هر یک از محیط‏های کشت اضافه شد. محیط‏ها ‏در انکوباتور شیکردار در دمای 30 درجه سانتی‏گراد ‏و 150 دور بر دقیقه قرار گرفتند. سپس، سنجش به روش دی نیتروسالیسیلیک اسید انجام گرفت.

 

نتایج.

نتایج حاصل از کشت نمونه‏ها‏: در ابتدا نمونه‏های جمع‏‏‏آوری شده از خاک، آب و پساب، در محیط نوترینت آگار خالص‏سازی‏ شد. از کشت نمونه‏های خاک، آب و پساب در محیط نشاسته آگار، 20 جدایه توانایی هیدرولیز نشاسته را داشتند. 10 جدایه قطر هاله بزرگتری را نشان دادند.

تولید آمیلاز: تولید آنزیم آمیلاز توسط 10 جدایه مشخص شده در مرحله قبل که در محیط نشاسته آگار بهترین تولید آنزیم آمیلاز را از خود نشان داده بودند بررسی شد. در محیط تولید آنزیم آمیلاز شامل 1 درصد نشاسته به عنوان القا کننده آنزیم، باسیلوس جدا شده از پساب بالاترین میزان تولید آنزیم را در ساعت 72 و به میزان21/7 (یونیت/ میلی‏لیتر) [8] نشان داد. تولید آنزیم آمیلاز در این جدایه در ساعت‏های 24، 48، 72، 96، 120 و 144 به ترتیب برابر با 03/3، 8/4،‏ 2/7،‏ 7/6،‏ 5/5 و 7/4 (یونیت/ میلی‏لیتر) بود (شکل 1).

 

 

 

شکل 1- منحنی تولید آنزیم آمیلاز توسط باسیلوس سوبتیلیس پس از 6 روز گرماگذاری در محیط تولید آنزیم، در 30 درجه سانتی گراد، سرعت شیکر 150 دور بر دقیقه

 

 

ویژگی‏های گونه باکتری:

شناسایی بر مبنای ویژگی‏های بیوشیمیایی: برای شناسایی دقیق جدایه‏ها ‏از آزمون‏‏‏های بیوشیمیایی مطابق جداول برگی[9] (13) استفاده شد. نتایج مربوط به شناسایی جدایه مورد مطالعه در پژوهش حاضر در جدول 1 نشان داده شده است.

شناسایی مولکولی‏‏: از بین سویه‏های جدا شده نمونه‏ای که دارای بیش‏ترین قطر هاله حاصل از هیدرولیز نشاسته در محیط نشاسته آگار و همچنین، بیش‏ترین میزان تولید را در محیط تولید آنزیم داشت برای ادامه پژوهش انتخاب شد‏. باسیلوس مورد نظر بر اساس آزمون‏‏‏های بیوشیمیایی مطابق با جدول شناسایی برگی و تحلیل توالی ژنومی 16s rDNA شناسایی شد. باسیلوس شناسایی شده با باسیلوس سوبتیلیس تشابهی زیادی را نشان داد. آزمون‏‏‏های بیوشیمیایی در جدول 1 و تصویر درخت فیلوژنی در شکل 2 آورده شده است.

 

 

جدول 1- شناسایی جدایه باسیلوس سوبتیلیس توسط ویژگی‏های ظاهری و آزمون‏‏‏های بیوشیمیایی

ویژگی‏های بیوشیمیایی

آزمون‏‏ لیستیناز

منفی

آزمون‏‏ هیدرولیز کازئین

مثبت

آزمون‏‏ هیدرولیز نشاسته

مثبت

آزمون‏‏ هیدرولیز ژلاتیناز

مثبت

آزمون‏‏ تخمیر قند گلوگز

مثبت

تخمیر قند مانیتول

مثبت

آزمون‏‏ تخمیر قند گزیلوز

مثبت

آزمون‏‏ تخمیر قند آرابینوز

مثبت

آزمون‏‏ هیدرولیز اوره

منفی

آزمون‏‏ vp

مثبت

آزمون‏‏ احیای نیترات

مثبت

آزمون‏‏ تجزیه سیترات

مثبت

توانایی رشد در شرایط بی‏هوازی

منفی

کاتالاز

مثبت

رشد در کلراید سدیم 2 درصد

مثبت

رشد در کلراید سدیم 5 درصد

مثبت

رشد در کلراید سدیم 7 درصد

مثبت

 

 


شکل 2- درخت فیلوژنی برای باسیلوس سوبتیلیس

 

 

شکل 3- مقایسه تولید آنزیم آمیلاز حاصل از باسیلوس سوبتیلیس در محیط‏های کشت: محیط شماره 1 TSB، محیط شماره 2 NB، محیط شماره 3 عصاره مخمر، محیط شماره 4 محیط شیر و محیط شماره 5 محیط ملاس چغندر پس از 72 ساعت (زمان حداکثر تولید) با سرعت شیکر 150 دور بر دقیقه


 

 

 

اثر محیط کشت‏های مختلف بر تولید آنزیم آمیلاز:. محیط‏های تریپتیکیس سوی براث و نوترینت براث که به عنوان محیط‏های غنی کننده میکروارگانیسم‏ها ‏در آزمایشگاه‏ها ‏استفاده‏ می‏شود، تولید در خور توجهی از این آنزیم را نشان ندادند. کم‏ترین فعالیت آنزیم آمیلاز در محیط عصاره مخمر مشاهده شد. در سه محیط TSB، NB و عصاره مخمر سوبسترای مناسب و کافی در اختیار آنزیم وجود ندارد. در محیط ملاس و محیط شیر نسبت به سایر محیط‏ها ‏تولید بالاتری از آنزیم مشاهده شد‏. محیط ملاس و محیط شیر دارای ترکیبات قندی مانند الیگو ساکاریدها و دی ساکاریدها‏ست‏‏. همچنین، در هر دو محیط حضور کلسیم در بهبود فعالیت آنزیم آمیلاز مؤثر است. جدایه باسیلوس سوبتیلیس در محیط ملاس بهترین تولید آنزیم آمیلاز را نشان داد. فعالیت آنزیم آمیلاز حاصل از باسیلوس سوبتیلیس در محیط ملاس پس از 72 ساعت معادل با 041/5 (یونیت/ میلی‏لیتر) بود. کم‏ترین فعالیت آنزیم آمیلاز در مورد باسیلوس سوبتیلیس در محیط عصاره مخمر و معادل 666/2 (یونیت/ میلی‏لیتر) اندازه‏‏‏گیری شد. که نتایج حاصل از آن در شکل 3 آورده شده است.

 

بحث و نتیجه‏‏ گیری.

آمیلاز از مهم‏ترین آنزیم‏ها ‏در زیست فناوری است که با منشاء میکروبی، مصارف صنعتی وسیعی دارد. آمیلاز با کاربرد تجاری به‏طور گسترده‏‏ از جنس‏های باسیلوس به دست‏ می‏آید. در پژوهش حاضر، جداسازی باسیلوس از خاک، آب و پساب انجام گرفت. در حالی که در بیشتر مطالعاتی که جداسازی انجام شده سویه‏ها ‏از یک منبع، نمونه خاک یا آب جمع‏‏‏آوری و جداسازی شدند. یاسوری نجفی [x] و همکاران جداسازی باسیلوس مولد آمیلاز را از نمونه خاک انجام دادند (15). آشوینی[xi] و همکاران باسیلوس مولد آمیلاز را از نمونه آب جداسازی کردند (13). بوزیک [xii] و همکاران در پژوهشی برای تولید α-آمیلاز هضم کننده نشاسته خام از استوک فریز شده باسیلوس لیکنی فورمیس ATCC9945a استفاده کردند (8). در این مطالعه، شناسایی سویه‏های باسیلوس به وسیله آزمون‏‏‏های بیوشیمیایی انجام گرفت. تایید آزمون‏‏‏های مربوط به جدایه برتر در آزمایش‏های حاضر از روش شناسایی مولکولی‏‏ نیز استفاده شد. در بیشتر مطالعات مشابه از آزمون‏‏‏های بیوشیمیایی برای شناسایی سویه‏های باسیلوس استفاده شده است. ادیانجو[xiii] و همکاران باسیلوس لیکنی فورمیس را بر اساس آزمون‏‏‏های بیوشیمیایی شناسایی کردند (6). خان الام[xiv] و همکاران برای‏‏ شناسایی باسیلوس سوبتیلیس از آزمون‏‏‏های بیوشیمیایی استفاده کردند (10). در این مطالعه برای غربال‏گری‏‏ باکتری‏های مولد آنزیم آمیلاز از محیط نشاسته آگار استفاده شد. گویال [xv] از محیط نشاسته آگار برای غربال‏گری‏‏ باسیلوس‏های مولد آنزیم آمیلاز استفاده کرد (1). آشوینی نیز برای غربال‏گری‏‏ باسیلوس‏های مولد آنزیم آمیلاز از محیط نشاسته آگار استفاده کرد. رشد در محیط نشاسته آگار و هیدرولیز نشاسته حکایت از ترشح آنزیم آمیلاز خارج سلولی دارد که در پژوهش حاضر از این محیط استفاده شد‏ و نتایج رضایت بخشی داشت. در مطالعه حاضر، باسیلوس جدا شده از پساب میزان قابل توجهی از تولید آنزیم آمیلاز را نشان داد. قوربل [xvi] و همکاران بالاترین میزان تولید آنزیم آمیلاز توسط سویه باسیلوس را 1/2 (یونیت/ میلی‏لیتر) بیان کردند (16). همدیت[xvii] و همکاران میزان تولید آنزیم آمیلاز توسط باسیلوس را 8/4(یونیت/ میلی‏لیتر) اعلام کردند (17).

در پژوهش حاضر، اثر محیط‏های تریپتیکیس سوی براث، نوترینت براث، محلول عصاره مخمر، شیر و ملاس چغندر بر تولید این آنزیم آزمایش شد. محیط ملاس چغندر و محیط شیر، به نسبت تولید آنزیم بیشتری را القا‏ می‏کنند و در این بین محیط ملاس چغندر سبب تولید آنزیم آمیلاز بیشتری نسبت به محیط شیر‏ می‏شود. محیط شیر در ترکیب خود دارای قند گالاکتوز و لاکتوز بوده و محیط ملاس دارای قند رافینوز، ساکاروز و فروکتوز‏ است‏‏. گویال در مطالعه‏ای اثر ترکیبات قندی از قبیل ساکارز، فروکتوز، لاکتوز و گالاکتوز را بر تولید آنزیم آمیلاز به وسیله سویه باسیلوس بررسی کرد و نشان داد که این ترکیبات قندی سبب القا تولید آنزیم آمیلاز‏ می‏شوند (1). از طرفی محیط شیر و محیط ملاس دارای عنصر کلسیم در ترکیب خود‏ هستند. ادیانجو نیز اثر مثبت کلسیم را بر فعالیت آنزیم آمیلاز عنوان کرد (6). احمدی[xviii] بیان داشت که کلسیم بر تولید آنزیم آمیلاز اثر مثیت دارد (11). این طور استنباط‏ می‏شود که ترکیبات موجود در محیط شیر و محیط ملاس سبب القا تولید آنزیم آمیلاز بیشتری نسبت به سایر محیط‏ها ‏می‏شود. در این بین محیط ملاس چغندر محیط تولید به صرفه‏ای است و در مقایسه با سایر محیط‏های استفاده شده به طور رضایت بخشی سبب تولید آنزیم آمیلاز شد.

سویه باسیلوس سوبتیلیس سطح مطلوبی از آنزیم آمیلاز را تولید‏ می‏کند و این سویه‏ می‏تواند به عنوان یک سویه صنعتی مناسب در سطح تجاری مطرح شود. همچنین، میزان تولید آنزیم آمیلاز توسط این سویه در محیط کشت‏های صنعتی‏ می‏تواند با بهینه‏سازی‏ شرایط تولید افزایش یابد.

تشکر و قدردانی

از آقای سجاد خدارحمی تشکر و قدردانی می‏شود.



[1]- ‏‏MERCK

[2]- ‏‏Sigma

[3]- ‏‏r. p. m ‏‏

[4]- ‏‏3‏‏, 5- Dinitrosalicylic ‏‏Acid ‏‏Solution

[5]- ‏‏BLAST

[6]- ‏‏Tripticase ‏‏Soy ‏‏Broth

[7]- ‏‏Ntrient ‏‏Broth ‏‏

[8]- U/ml

[9]- ‏‏Bergey

[x]- ‏‏Yasouri Najafi

[xi]- ‏‏Ashwini

[xii]- ‏‏Bozic

[xiii]- ‏‏Adeyanju ‏‏

[xiv]- Khan Alam

[xv]- ‏‏Goyal

[xvi]- ‏‏Ghorbel

[xvii]- ‏‏Hmidet

[xviii]- ‏‏Ahmadi 

(1)               Goyal N., Gupta J K., Soni S K. A novel raw starch digesting thermostable α-amylase from Bacillus sp. I-3 and its use in the direct hydrolysis of raw potato starch. Enzyme and Microbial Technology 2005; 37: 723- 34

(2)               De Souza M P., De Oliviera E M P. Application of microbial α-amylase in industery- A Review. Brazilian Journal of Microbiology 2010; 41: 850- 61

(3)               Aiyer Prasanna V. Amylases and their applications. African Journal of Biotechnology 2005; 4 (13): 1525- 9.

(4)               Burhan A., Coral U N., Colak G., Aygan Ashabil O. Enzymatic properties of a novel thermostable, thermophilic, alkaline and chelator resistant amylase from an alkaliphilic Bacillus sp. isolate ANT-6. Process Biochemistry 2003; 38: 1397- 403.

(5)               Gupta R., Gigras P., Mohapatra H., Goswami V K., Chauhan B. Microbial α-amylases: a biotechnological perspective. Process Biochem 2003; 38: 1599- 616.

(6)               Adeyanju M M., Agboola FK., Omafuvbe B O., Oyefuga O H., Adebawo O O. A thermostable extracellulare α-amylase from Bacillus licheniformis isolated from cassava steep water. Biotecnology 2007; 6 (4): 473- 80.

(7)               Kaboosi H, Tabari N, Samadlouie H, Optimization of α-amylase production by Bacillus amyloliquefaciens using response surfaces methodology. Biological Journal of Microorganism 2014; 3(11): 79-90.

(8)               Bozic N., Ruiz J., Lopez –Santin J., Vujcic Z. Production and properties of the highly efficient raw starch digesting α-amylase from a Bacillus licheniformis ATCC9945a. Biochemical Engineering Journal 2010; 5248- 255.

(9)               Thaddeus C E., Hubert B. Purification, characterization, and synergistic action of phytate-resistant α-amylase and α-glucosidase from Geobacillus thermodenitrificans HRO10. Journal of Biotechnology 2006; 125: 27- 38.

(10)           Khan A J., Priya R. A study on partial purification and characterization of exteracellular amylase from Bacillus subtilis. Advances in Applied Science Research 2011; 2 (3): 509- 19.

(11)           Ahmadi A., Ghobadia S., Khajeh K., Nomanpour B., Badoei Dalfard A. Purification of α-Amylase from Bacillus sp. GHA1 and Its Partial Characterization. Journal Iran Chemical Society 2010; 7 (2) 432- 40.

(12)           Bernfield P. Amylases α and β. In Methods in Enzymology edited by Colowich SP Kaplan. 1955; 1: 149- 58.

(13)           Ashwini K., Gaurav K., Karthik L., Bhaskara Rao K V. Optimization, production and partial purification of extracellular α- amylase from Bacillus sp. marini. Archives of Applied Science Research 2011; 3 (1): 33- 42.

(14)           Holth J G., Krieg N R., Sneath P H A. Staley J T Williams S T. Bergeys manual of determination bacteriology. 9th ed. U. S. A: Williams and Wilkins; 1994.

(15)           Yasouri Najafi F., Rasa M., Sarir R. Extracellular and purification of a thermostable α-amylase from Bacillus coagulans found in Iranian soil sample. International Journal of Chemical Science 2003; 1 (4): 322- 40.

(16)           Ghorbel R E., Maktouf S., Massoud E B., Bejar S., Chaabouni S E. New Thermostable Amylase from Bacillus cohnii US147 with a Broad pH Applicability. Applied Biochemistery Biotechnology 2009; 157:50- 60.

(17)           Hmidet N., Maalej H., Haddar A., NasriA M. A Novel α-Amylase from Bacillus mojavensis A21: purification and Biochemical Characterization. Applied Biochemistery Biotechnology 2010; 162: 1018- 30.