استاندارد کردن PCR تشخیصی به‏ وسیله اینترنال کنترل تکثیری

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 دانشیار بیوتکنولوژیست، دانشگاه آزاد اسلامی، واحد شهر قدس، تهران، ایران

2 کارشناس ارشد میکروبیولوژی، موسسه ایرانیان ژن فناور (IGF)، تهران، ایران

3 استادیار سلولی و مولکولی، دانشگاه آزاد اسلامی، واحد تهران شرق، تهران، ایران

چکیده

مقدمه: بروز نتایج متفاوت در آزمایشگاه‏ها به علت استاندارد نبودن، از معایب روش‏‏‏‏های تکثیر مولکولی است. در بیشتر مقالات چاپ شده در زمینه تشخیص PCR عوامل عفونی، ‏اینترنال کنترل تکثیری (IC) وجود ندارد. هدف از پژوهش حاضر، طراحی و توسعه یک روش ساده و سریع، برای‏‏‏‏‏‏ ساخت اینترنال کنترل آزمون‏‏ PCR ‏در آزمایشگاه‏های ‏تشخیصی است. ‏
مواد و روش‏‏ ها: در پژوهش حاضر، برای ساخت اینترنال کنترل رقابتی، از پرایمرهای مرکب و روش PCR-Cloning استفاده شد‏‏. بدین ترتیب که پرایمرهای جلویی و عقبی تشخیص PCR ویروس هپاتیت)(HBV، ویروس هرپس سیمپلکس ‏HSV))، مایکوباکتریوم توبرکلوزیس (MTB)،‏‏ مایکوپلاسما پنومونیه (Mpn)،‏‏ کریپتوکوکوس نئوفورمنس ‏(Cne)،‏‏ جنس سالمونلا (Sal. sp) و جنس مایکوپلاسما (M. sp) را در بخش '5 پرایمرهای ژن کینتوپلاست لیشمانیا، به شکل‏‏ دم طراحی و سنتز شد. اینترنال کنترل‏های تکثیری با پلاسمید pTZ57R الحاق و در باکتری اشریشیاکلی JM107 ترانسفورم شد‏‏. تعداد حداقل IC در هر واکنش PCR از طریق رقیق‏سازی ‏‏‏‏و همین‏طور طیف پاسخ PCR همراه با IC بررسی شد‏‏‏‏‏‏‏‏‏. ‏
نتایج: HBVHSVMTBMPNCneSal. sp و M. sp با پرایمر‏های اختصاصی به ترتیب برابر با 272bp-284bp-415bp-345bp-245bp-454bp-262bp و محصول اینترنال کنترل هم به ترتیب
672bp-668bp-661bp-669bp-660bp-662bp-660bp جفت باز بود، که از نظر اندازه، اختلاف مطلوبی بین محصول PCR و IC وجود دارد و به آسانی در ژل قابل تفکیک است. تعداد حداقل IC در هر واکنش، 1000 عدد تعیین شد. حداقل و حداکثر حساسیت آزمون‏‏ PCR همراه با IC برای همه عوامل در حد مطلوبی به دست آمد. در آزمون‏‏ ویژگی با عوامل مختلف هم، هیچ محصول ناخواسته‏ای ‏مشاهده نشد. ‏
بحث و نتیجه گیری: نتایج منفی و مثبت کاذب که به علت‏های‏‏‏ مختلف در روش‏‏‏ PCR رخ می‏دهد از مشکلات مهم این روش‏‏‏ جذاب است‏‏‏. استفاده از یک اینترنال کنترل در تشخیص مولکولی به عنوان کنترل داخلی، می‏‏تواند این خطاها را شناسایی کند. 

کلیدواژه‌ها


عنوان مقاله [English]

Standardization of diagnostic PCR by Internal Amplification Control

نویسندگان [English]

  • Mohammad Hasan shahhosseiny 1
  • Maryam Ghahri 2
  • Mohammad Amin Mahmoudi 2
  • Elham Moslemi 3
1 Associated Professor of Biotechnology, Department of Microbiology, Shahr-e-Qods Branch, Islamic Azad University, Tehran, Iran
2 M.Sc. of Microbiology, Iranian Gene Fanavar Institute (IGF), Tehran, Iran
3 Assistant Professor of Cell and Molecular biology, Biology department, Islamic Azad University, East Tehran Branch, Tehran, iran
چکیده [English]

Introduction: Different data resulting from non-standard molecular techniques in laboratories were considered as one of the deficiencies about amplification techniques. One of the most important aspects about the articles published in PCR detection until now, is absence of internal control (IC) in majority of them. The aim of this study is to design and develop a simple and rapid method to produce internal control for PCR test and its future application in the routine recognition laboratories.

Materials and methods: To produce competitive internal control in this study, composite primers and PCR-Cloning method were used. We designed and synthesized the forward and reverse primers of PCR diagnostic test of Hepatitis B virus(HBV), Herpes simplex virus(HSV), Mycobacterium tuberculosis(MTB), Mycoplasma pneumonia(Mpn), Cryptococcus neoformans(Cne), Salmonella spp (Sal.sp) and Mycoplasma spp (M.sp) in the 5’ primers of Leishmania Kintoplast gene in the tail form. The amplified internal controls were attached to pTZ57R and transformed in E.coli JM107 bacteria. The minimum IC number was studied using dilution technique and also PCR response spectrum with IC.

Results: The size of HBV, HSV, MTB, MPN, C.ne, Sal.sp, M.sp diagnostic product with specific primers were 262, 454, 245, 345, 415, 284, 272 bp and corresponding internal control also were 660, 662, 660, 669, 661, 668, 672 bp respectively, and desirable difference observed between PCR, IC regarding the size was easy to separate in the gel. The minimum IC was identified to 1000 in each reaction and maximum PCR test sensitivity with IC was provided for entire agents appropriately. Further, in specific test using different agents any unwanted product was not observed too.

Discussion and conclusion: The negative and positive false results in PCR tests are one of the difficulties of this exacting technique which may lead to decrease its performance. Using an internal control in molecular detection method as an internal controlling system, could identify these errors.

کلیدواژه‌ها [English]

  • PCR
  • Internal control
  • PCR- cloning

مقدمه.

پیشرفت‏های شگرف بیوتکنولوژی و زیست‏شناسی‏‏‏‏‏‏‏‏‏ مولکولی در سال‏های گذشته موجب تغییر روش‏های تشخیصی عوامل میکروبی، از روش‏های بر پایه کشت به روش‏های مولکولی و بیشتر بر اساس تکثیر اسید‏های نوکلئیک شد‏‏ه است (1). کاربرد روش‏های مولکولی بر پایه PCR برای‏‏‏‏‏‏ شناسایی و تعیین مقدار اسید‏های نوکلئیک در پژوهش‏‏‏‏‏‏‏‏‏ و درمان، روز به روز گسترده‏‏‏‏تر می‏‏شود‏‏. از دهه 90 یک افزایش انفجاری در تعداد مقالات چاپ شده در زمینه روش‏‏‏‏‏‏‏‏‏‏های تکثیر اسید نوکلئیک به ویژه‏‏‏‏‏‏‏‏‏ روش PCR در شناسایی عوامل بیماری‏زا اتفاق افتاده است. شایان ذکر است، متغیرهایی مانند‏‏‏: نوع آزمایشگاه، دستگاه‏های مورد استفاده، نوع و بازده DNA پلیمراز مورد استفاده، کارکنان و سطح آموزش و مهارت‏‏‏‏ها، حضور ممانعت کننده‏ها، هدف‏‏های ژنی متفاوت در عامل مورد شناسایی، سطح بهینه‏سازی ‏‏‏‏آزمون‏‏ با توجه به مهارت‏ها در آزمایشگاه‏ها، روش هایPCR خانگی [1] و شاخص‏های دیگر، باعث شده که ‏در برخی موارد جواب‏های صحیح و قابل تکرار گزارش نشده و فقط برخی از پروتکل‏های چاپ شده در مقالات به طور عملی در آزمایشگاه‏ها تکرار شود (2- 8).

با وجود حساسیت بالا در PCR، موانع و مسایلی نیز در تکثیر قطعات DNA وجود دارد که به عنوان یک سد، مانع از تکثیر و ایجاد جواب‏‏های منفی کاذب می‏‏شود‏‏. حضور مواد بازدارنده در نمونه‏‏های مرضی مانند مایع پلور [2]، مایع مغزی/ نخاعی [3]، خلط [4]، خون محیطی [5]، و دیگر نمونه‏ها مانع از تکثیر می‏‏شود‏‏ (9- 11). روش‏های متعددی برای‏‏‏‏‏‏ نظارت بر حضور مواد ممانعت کننده در PCR گزارش شده است (12- 14) که مهم‏ترین آن‏ها به کارگیری اینترنال کنترل در یک آزمون‏‏ PCR است‏‏‏.

در بیشتر مقالات چاپ شده در زمینه تشخیص PCR عوامل عفونی، ‏اینترنال کنترل تکثیری [6] (IAC) وجود ندارد. بر خلاف کنترل مثبت، اینترنال کنترل بیشتر یک توالی‏‏ DNA غیر هدف حاضر در نمونه است که به طور هم‏زمان با توالی‏‏ هدف تکثیر می‏شود‏‏. در یک PCR بدون IAC، یک پاسخ منفی یعنی این‏که توالی‏‏ هدف حضور ندارد. اما، آن می‏تواند در عین حال به معنای این باشد که واکنش به علتی مانند: اختلال در دستگاه ترموسایکلر، مخلوط PCR غلط، فعالیت آنزیم DNA پلیمراز، یا حداقل حضور مواد بازدارنده در ماتریکس نمونه، ممانعت شده است. به طور بر عکس، در یک PCR با IAC، یک سیگنال کنترل همیشه تولید می‏شود‏‏ که تکثیر اینترنال کنترل است. این کنترل داخلی حتی در عدم حضور توالی هدف مورد آزمایش تکثیر می‏شود‏‏ و اگر تکثیر نشود یعنی اشکالی در تکثیر (به علت‏های متفاوت) وجود دارد (2 و 6- 8).

هدف از پژوهش حاضر، معرفی استراتژی سریع و ساده برای‏‏‏‏‏‏ طراحی و ساخت اینترنال کنترل آزمون‏‏ PCR تشخیصی، برای عواملی مانند ویروس هپاتیت B (HBV) – ویروس هرپس سیمپلکس 1 و 2 (HSV) – مایکوباکتریوم توبرکلوزیس (MTB) – کریپتوکوکوس نئوفورمنس (Cne) – جنس سالمونلا (Sal. sp) – و جنس مایکوپلاسما (M. sp) به روش رقابتی و از طریق PCR-Cloning، و همین‏طور تعیین حداقل و حداکثر حساسیت آزمون‏‏ به جهت حد تشخیص LOD [7] است.

 

‏‏مواد و روش‏ها.

تهیه سوش‏‏های استاندارد: در این پژوهش گونه‏های متعلق به مولیکوتس به کار رفته برای‏‏‏‏‏‏ آزمون‏‏ PCR مایکوپلاسما پنومونیه[8] و جنس مایکوپلاسما[9] عبارت بودند از: مایکوپلاسما پنومونیه (NCTC 10119)،‏‏ مایکوپلاسما گالیسپتیکوم[10] (رازی 1355)،‏‏ مایکوپلاسما گالیناروم[11] (رازی 1350 و 1346)، مایکوپلاسما اویاپنومونیه[12] (رازی 1364)، مایکوپلاسما آگالاکتیا[13] (رازی 1343)، اوره آپلاسما اوره آلیتیکوم[14] (رازی 1369) مایکوپلاسما آرجینینی[15]، مایکوپلاسما هیورینیس[16]، مایکوپلاسما ارال[17]، مایکوپلاسما سینوویه[18] و اکول پلاسما لیدلاوی[19] (تهیه شده از انستیتو رازی). سوش استانداردکریپتوکوکوس نئوفورمنس[20] از مرکز کلکسیون قارچ و باکتری سازمان پژوهش‏های علمی و صنعتی ایران به شکل لیوفلیزه (ATCC number: 13690) تهیه ودر محیط کشت yeast malt agar حاوی کلرامفنیکل به میزان 400 (میلی‏‏‏‏‏‏‏‏‏‏‏‏‏‏گرم در لیتر) به طور‏‏ اسلنت کشت و سپس، روی آن با محیط کشت سابورو دکستروز براث پوشانده شد. لوله‏ها به مدت 72 ساعت تا یک هفته در دمای 34 تا 37 درجه سانتی‏گراد‏‏‏‏‏‏‏‏‏‏‏ گرمخانه‏‏‏‏گذاری شد. ایجاد کلونی‏‏‏‏‏‏‏‏‏ روی سطح شیبدار و کدورت در بخش مایع نشانه رشد مناسب بود.

سوش استاندارد باسیل سل [21] از آزمایشگاه مایکوباکتریولوژی بیمارستان مسیح دانشوری تهیه شد. همین‏طور DNA‏‏ چندین گونه مختلف مایکوباکتریوم مانند مایکوباکتریوم چلونی‏‏‏– آویومگوردونهاینتراسلولارسزولگای و گزنوپی نیز از دکتر جیم ورنگرن و دکتر سیون هافنر از انستیتو کنترل بیماری‏های عفونی سوئد[22] تهیه شد. سالمونلا تیفی موریومATCC 14028 و چندین نوع سالمونلای دیگر و همین‏طور ویروس هپاتیت B و ویروس هرپس سیمپلکس I و II نیز از بخش ویروس‏شناسی انستیتو پاستور ایران تهیه شد.

استخراج DNA: برای استخراج DNA از میکروارگانیسم‏های مورد مطالعه، ‏از کیت استخراج DNA تولید شرکت سیناکلون بنام DNG با شماره کاتالوگ (DN8118C) استفاده شد. مراحل کاری به طور‏‏ خلاصه عبارت بود از:قرار دادن محلول DNG Plus در ۳٧ درجه و آرام تکان دادن آن، تا به شکل‏‏ یک محلول هم دما و یکنواخت در آید. سپس، ۱۰۰ میکرولیتر از سوسپانسیون عامل با ۴۰۰ میکرولیترمحلول DNG Plus مخلوط ‏و به مدت 15 تا 20 ثانیه ورتکس شد‏‏. نمونه در این مرحله باید به طور کامل به شکل سوسپانسیون درآید و هر گونه تجمع و یا توده‏‏‏‏ای، تخریب شده و از بین رود. سپس، ۳۰۰ میکرولیتر ایزوپروپانول اضافه شده، 10 مرتبه وارونه و متعاقب آن، لوله‏ها در فریزر به مدت ۲۰ دقیقه قرار داده شد. سپس، در rpm۱۲۰۰۰ برای مدت ۱۰ دقیقه سانتریفیوژ شد‏‏. مایع رویی به آرامی خالی ‏و تیوب به طور‏‏ واژگون بر روی دستمال کاغذی قرار داده شد. 1 میلی‏‏‏‏‏‏‏‏‏‏‏‏‏‏لیتر اتانول سرد ٧۵ درصد ‏به رسوب اضافه، به مدت 3 تا 5 ثانیه ورتکس و سپس، در دور rpm ۱۲۰۰۰ برای مدت ۵ دقیقه سانتریفیوژ شد. اتانول ‏کاملاً خالی و رسوب ‏در ۶۵ درجه خشک شد. رسوب که محتوی DNA است در ۵۰ میکرولیترآب همراه با تکان دادن آرام و قرار دادن در ۶۵ درجه خوب حل شد‏‏.

پرایمرها و شرایط PCR: بهینه نمودن آزمون‏‏ PCR برای تشخیصHBVHSVMTBMPNCneSal. sp و M. sp، از طریق بهینه نمودن غلظت اجزایی که در واکنش PCR به کار می‏‏روند و همچنین، طراحی و انتخاب برنامه حرارتی مناسب در دستگاه ترموسایکلر انجام شد‏‏ (جدول 1 و 2). پرایمر‏های مورد استفاده در تشخیص کریپتوکوکوس نئوفورمنس، از مطالعات انجام گرفته توسط لویتز[23] در سال 1991 و وون چانگ [24] در سال 1992 به دست آمده‏‏‏‏اند، که توالی آن‏ها در جدول 1 آمده است (15- 18). پرایمر‏های مورد استفاده در تشخیص ویروس هپاتیت B، پرایمر‏های مخصوص ژن آنتی‏ژن سطحی این ویروسHBS است‏‏‏ (19- 21). برای‏‏‏‏‏‏ تشخیص HSV از ژن DNA-Polymerase استفاده و پرایمرها طراحی شد‏‏ (22). درتشخیص MTB ژن هدف IS6110 (23- 27)، و در مایکوپلاسما پنومونیه P1 adhesin ‏(28)، در جنس مایکوپلاسما ‏‏‏‏‏‏‏‏‏16S rRNA(29- 30) و در جنس سالمونلا ژن invA (31) در نظرگرفته شد.

واکنش PCR با مقادیر زیر انجام شد‏‏: ۵ میکرولیتر از DNA استخراج شده با استفاده از پرایمر‏های جلویی و عقبی با غلظت نهایی ٤/٠ میلی‏‏‏‏‏‏‏‏‏‏مول (یک میکرولیتر از غلظت 10 میلی‏‏‏‏‏‏‏‏‏‏مولار)، ‏٥/٢ میکرولیتر از بافر PCR (X‏‏‏۱۰)، ‏٧٥/٠ میکرولیتر کلرید منیزیم (2MgCl) ‏‏‏‏(از غلظت ۵۰ میلی‏‏‏‏‏‏‏‏‏‏مولار)، ‏٥/٠ میکرولیتر مخلوط dNTP (۱۰ میلی‏‏‏‏‏‏‏‏‏‏‏‏‏‏مولار) و 5/1 واحد آنزیم Taq DNA Polymerase (بیوفلوکس)، در حجم نهایی ٢٥ میکرولیتر تکثیر شد. پروفایل حرارتی هر آزمون‏‏ در جدول 2 آمده است. پس از به پایان رسیدن سیکل‏های حرارتی، برای مشاهده DNA تکثیر شده از روش‏‏‏ الکتروفورز استفاده شد. محصولات PCR در کنار سایز مارکر و کنترل‏ها، در ژل آگاروز 5/1 درصد و با استفاده از سایبرگرین و نور UV در دستگاه ژل داکومنتیشن بررسی شد‏‏.

 

حساسیت و ویژگی: برای‏‏‏‏‏‏ بررسی حساسیت جفت پرایمرهای مورد استفاده، رقت‏هایی از سوسپانسیون عوامل با تعداد مشخص تهیه شد و استخراج DNA از این رقت‏ها به روش DNG-Plus (سیناکلون) انجام و سپس، آزمون PCR برای رقت‏های تهیه شده انجام شد. آزمون ویژگی هم با استفاده از گونه‏های مختلف آزمایش و ارزیابی شدند.

ساخت اینترنال کنترل (IC)‏‏‏: برای‏‏‏‏‏‏ ساخت اینترنال کنترل رقابتی به روش PCR-Cloning، پرایمرهای جلویی و عقبی هر عامل در بخش '5 پرایمرهای ژن کینتوپلاست لیشمانیا (32- 33) با اندازه محصول 620 جفت باز، به شکل‏‏ دم (Tail) طراحی و سنتز شد (جدول 1).

برای انجام واکنش PCR برای‏‏‏‏‏‏ تکثیر قطعه اینترنال کنترل، ۵ میکرولیتر از DNA استخراج شده لیشمانیا با استفاده از پرایمرهای جلویی و عقبی IC با غلظت نهایی ٤/٠ میکرومول، ٥/٢ میکرولیتر از بافر 10X PCR، ٧٥/٠ میکرولیتر کلرید منیزیم (2MgCl) ‏(از غلظت ۵۰ میلی‏‏‏‏‏‏‏‏‏‏مولار)، ٥ /٠ میکرولیتر مخلوط dNTP (۱۰ میلی‏‏‏‏‏‏‏‏‏‏‏‏‏‏مولار) و 5/1 واحد آنزیم Taq DNA Polymerase، در حجم نهایی ٢٥ میکرولیترتکثیر شد. چرخه‏های حرارتی شامل 35 سیکل متوالی (شامل: ٩۴ درجه سانتی‏گراد‏‏‏‏‏‏‏‏‏‏‏ ۳۰ ثانیه، ۶0 درجه سانتی‏گراد‏‏‏‏‏‏‏‏‏‏‏ ۳۰ثانیه و ٧۲ درجه سانتی‏گراد‏‏‏‏‏‏‏‏‏‏‏ ۱دقیقه) و یک سیکل پلیمریزاسیون نهایی ٧۲ درجه سانتی‏گراد‏‏‏‏‏‏‏‏‏‏‏ به مدت 25 دقیقه بود. پس از به پایان رسیدن سیکل‏های حرارتی، برای مشاهده DNA تکثیر شده از روش‏‏‏ الکتروفورز استفاده شد. قطعه حاصل با پلاسمید pTZ57R کمپانی فرمنتاس به مدت 60 دقیقه در 22 درجه سانتی‏گراد لایگیت و سپس، در باکتری اشریشیا کلی JM107 ترانسفورم و کانستراکت حاصل از طریق غربال‏گری سفید/ آبی [25] در محیط حاوی آمپی‏سیلین، X-GAL و IPTG انتخاب شد‏‏. کلون‏های مناسب از طریق استخراج پلاسمید با کیت استخراج پلاسمید
‏‏‏(Thermo scientific Inc.‏‏‏) ‏‏‏و آزمون‏‏ PCR، تأیید شد‏‏ند.

کلونینگ محصول PCR و اینترنال کنترل: پس از خالص‏سازی ‏‏‏‏محصولات PCR و ICها که در جدول 1 آمده است، با استفاده از کیت T/A cloning کمپانی Thermo scientific، محصولات PCR در وکتور pTZ57/R کلون شد‏‏ند. پلاسمید‏های حاوی محصولات PCR حاصل با GeneJET Plasmid Miniprep Kit (K0502) کمپانی Thermo Scientific استخراج شد‏‏. سپس، با روش PCR، پلاسمید‏های حاوی محصولاتPCR و ICها با استفاده از پرایمر‏های تشخیصی تأیید شد‏‏ند.

تعیین غلظت ایده آل IC: هدف از تعریف غلظت DNA ایده آل IC برای PCR، تأیید غلظت بهینه IC است که با ژن هدف، کم‏ترین رقابت در تکثیر را انجام دهد (9). برای‏‏‏‏‏‏ به دست آوردن غلظت بهینه، غلظت‌‏های متفاوت پلاسمید حاویIC و DNA‏های استاندارد آزمایش شد‏‏. غلظت DNA عوامل مورد استفاده در آزمون‏‏ و همچنین IC، به وسیله اسپکتروفتومتر در طول موج260 نانومترتعیین شد. رقت‏های حاوی مقادیر DNA متفاوت عوامل میکروبی که از طریق رقت‏‏های سری [26] تهیه شده بود با مقادیر ثابت IC، آزمون‏‏ شد‏‏. برای PCR، 5 میکرولیتر از DNA ‏عامل میکروبی با 1 میکرولیتر از IC مخلوط و در میکس PCR استفاده شد‏‏. ‏

توالی‏یابی: تعیین توالی DNAها در دو جهت با استفاده از روش ختم زنجیره [27] و به وسیله کمپانی ماکروژن کره انجام شد‏‏. ‏

 

جدول ۱- توالی پرایمر‏های مورد استفاده برای‏‏‏‏‏‏ تشخیص DNA عوامل و تکثیر اینترنال کنترل

عامل

آغازگر

توالی (5´………..3´)

ژن هدف

سایز محصول ‏(جفت باز)

کریپتوکوکوس نئوفرمنس

ITS1

TCC GTA GGT GAA CCT GCG G

Internal transcribed spacer (ITS) regions

415

CN4

ATC ACC TTC CCA CTA ACA CAT T

ICFCneo

TCC GTA GGT GAA CCT GCG GTCgCAgAACgCCCCTACC

661

ICRCneo

ATC ACC TTC CCA CTA ACA CAT TAGGGGTTGGTGTAAAATAGGC

ویروس هپاتیت B

HBVF

CAA ggT ATg TTg CCC gTT Tg

HBS

262

HBVR

AAA gCC CTg CgA ACC ACT gA

ICFHBV

CAA ggT ATg TTg CCC gTT TgT CgC AgA ACg CCC CTA CC

660

ICRHBV

AAA gCC CTg CgA ACC ACT gAA ggg gTT ggT gTA AAA TAg gC

هرپس سیمپلکس ویروس

HSV-F

 ACC TAC Cgg CAT ACA AgC TCA

DNA polymerase

454

HSV-R

 AAg Tgg CTC Tgg CCT ATg TCC

ICFHSV

 ACC TAC Cgg CAT ACA AgC TCATCg CAg AAC gCC CCT ACC

662

ICRHSV

 AAg Tgg CTC Tgg CCT ATg TCCAgg ggT Tgg TgT AAA ATA ggC

مایکوباکتریوم توبرکلوزیس

MTBF

 CgT gAg ggC ATC gAg gTg gC

IS61110

245

MTBR

gCg TAg gCg TCg gTg ACA AA

ICFMTB

 CgT gAg ggC ATC gAg gTg gCT CgC AgA ACg CCC CTA CC

660

IICRMTB

gCg TAg gCg TCg gTg ACA AAA ggg gTT ggT gTA AAA TAg gC

 

ادامه جدول ۱- توالی پرایمر‏های مورد استفاده برای‏‏‏‏‏‏ تشخیص DNA عوامل و تکثیر اینترنال کنترل

مایکوپلاسما پنومونیه

MPNF

Agg CTC Agg TCA ATC Tgg CgT ggA

P1 adhesin

345

MPNR

ggA TCA AAC AgA TCg gTg ACT ggg T

ICFMPN

Agg CTC Agg TCA ATC Tgg CgT ggA TCg CAg AAC gCC CCT ACC

669

ICRMPN

ggA TCA AAC AgA TCg gTg ACT ggg TAg ggg TTg gTg TAA AAT Agg C

جنس مایکوپلاسما

MspF

ggg AgC AAA CAg gAT TAg ATA CCC T

16 S rRNA

272

MspR

TgC ACC ATC TgT CAC TCT gTT AAC CTC

ICFMsp

ggg AgC AAA CAg gAT TAg ATA CCC TTC gCA gAA CgC CCC TAC C

672

ICRMsp

TgC ACC ATC TgT CAC TCT gTT AAC CTC Agg ggT Tgg TgT AAA ATA ggC

جنس سالمونلا

SalspF

gTg AAA TTA TCg CCA CgT TCg ggC AA

invA

284

SalspR

TCA TCg CAC CgT CAA Agg AAC C

ICFSal

gTg AAA TTA TCg CCA CgT TCg ggC AAT CgC AgA ACg CCC CTA CC

668

ICRSal

TCA TCg CAC CgT CAA Agg AAC CAg ggg TTg gTg TAA AAT Agg C

 

جدول 2- پروفایل حرارتی و سایز محصولات بعد از تکثیر

عامل

پروفایل حرارتی

سایزمحصول (جفتباز)

کریپتوکوکوس نئوفرمنس

Pre-Denaturation ‏‏‏‏‏‏‏‏‏‏‏‏6 دقیقه، 94 درجه سانتی‏گراد

Denaturation ‏‏‏‏‏‏‏‏‏30 ثانیه، 94 درج

(1)               Shahhosseiny MH., Tehrani R. Polymerase Chain Reaction (PCR). Ed 2. Shahre Ghods: Islamic Azad University; 2011: 89- 105.

(2)               Hoorfar j., Malorny B., Abdulmawjood A., Cook N., Wagner M., Fatch P. Practical considerations in design of internal amplification controls for Diagnostic PCR assays. Journal of Clinical Microbiology 2004; 42 (5): 1863- 8.

(3)               Protocol for the validation of alternative microbiological qualitative methods 2001. Document NV- DOC. D- 2001 -04 -25 (http://nmkl.org/NordVal/NodVal.htm). NordVal, Oslo, Norway.

(4)               Microbiology of food and animal feeding stuffs. Protocol for the validation of alternative methods (EN ISO 16140) 2002. European Committee for Standardization, AFNOR; Paris, France.

(5)               Microbiology of food and animal feeding stuffs. Polymerase chain reaction (PCR) for the detection of foodborne pathogens. General method and specific requirements. 2002. Draft international standard ISO/DIS 22174. DIN, Berlin, Germany. 4. Hoorfar, J. 1999. EU seeking to validate and standardize PCR testing of food pathogens. ASM News (41) 65: 799.

(6)               Hoorfar J., and Cook N. Critical aspects of standardization of PCR. Methods Molecular Biology 2002; 216 (69): 51- 64.

(7)               Malorny B., Tassios PT., Ra°dstro¨m P., Cook N., Wagner M., and Hoorfar J. Standardization of diagnostic PCR for the detection of foodborne pathogens. Int. J. Food Microbiol. 2003; 83 (2): 39- 48.

(8)               Schoder DA., Schmalwieser G., Schauberger M., Kuhn J., Hoorfar M. Physical characteristics of six new thermocyclers. Clinical Chemistry 2003; 49 (43): 960- 3.

(9)               Cortez-Herrera E., Sperhacke RD., Becker D., Kritski A., Zaha A., Rosa-Rosetti., ML. Internal control in PCR for Mycobacterium tuberculosis: Usefulness and improvement of the diagnosis. Braz. Arch. Biology and Technology 2008; 51 (4): 685- 91.

(10)           Kolk AHJ., Noordhoek GT., De Leeuw O., Kuijper S., Van Embden JDA. Mycobacterium smegmatis strain for detection of Mycobacterium tuberculosis by PCR used as internal control for inhibition of amplification and for quantification of bacteria. Journal of Clinical Microbiology 1994; 32 (10): 1354- 6.

(11)           Wilson IG. Inhibition and facilitation of nucleic acid amplification. Applied and Environmental Microbiology 1997; 63(10): 3741- 51.

(12)           Brightwell G., Pearce M., Leslie D. Development of internal controls for PCR detection of Bacillus anthracis. Molecular and Cellular Probes 1998; 12 (353): 367- 77.

(13)           Osaki M., Adachin H., Gomyo Y., Yoshida H., Ito H. Detection of mycobacterial DNA in formalin-fixed, paraffin-embedded tissue specimens by duplex polymerase chain reaction: Application to histopathologic diagnosis. Modern Pathology 1997. 10 (51): 78- 83.

(14)           Picard FJ., Gagnon M., Bernier MR., Parham NJ., Bastien M., Boissinot M., et al. Internal control for nucleic acid testing based on the use of purified Bacillus atrophaeus sub sp. Globigii spors. Journal of Clinical Microbiology 2009; 47 (2): 751- 7.

(15)           Levitz S. M. The ecology of Cryptococcus neoformans and the epidemiology of Cryptococcosis. Review of Infectious Diseases 1991; 13 (6): 1163- 9.

(16)           Kwon-Chung KJ., Edman JC., Wickes BL. Genetic association of mating types and virulence in Cryptococcus neoformans. Infection and Immunity 1992; 60 (6): 602- 5.

(17)           Chen J., Varma A., Diaz MR., Litvintseva AP., Wollenberg KK., Kwon-Chung KJ. Cryptococcus neoformans Strains and Infection in Apparently Immunocompetent Patients, China. Emerging Infectious Diseases 2008; 14 (5): 755- 62.

(18)           Kwon- Chung KJ., Varma A. Do major species concepts support one, two or more species within Cryptococcus neoformans? FEMS Yeast Research  2006; 6 (6): 574- 87.

(19)           Pawlotsky JM., Bastiec A., He´zodec Ch., Lonjon I., Darthuy F., Re´mire´ J., et al. Routine detection and quantification of hepatitis B virus DNA in clinical laboratories: performance of three commercial assays. Journal of Virological Methods 2000; 85 (34): 11- 21.

(20)           Weber B., Berge A. Molecular detection of hepatitis B virus: recent developments. Journal of Laboratory Medicine 2005; 29 (1): 33- 43.

(21)           Moslemi E., Shahhosseiny MH., Javadi G., Parivar K., Sattari TN., Keyvani-Amini H. Loop mediated isothermal amplification (LAMP) for rapid detection of HBV in Iran. African Journal of Microbiol Research 2009; 3 (8): 439- 45.

(22)           Bahrami A., Shahhosseiny M.H., Azadmanesh K., Moslemi E., Noormohamadi Z., Jadali F. Optimization of Loop- Mediated Isothermal Amplification (LAMP) method for detection of herpes simplex virus type 1 and 2. Scientific Journal of Kurdestan University of Medical Sciences 2011; 16 (59): 56- 63.

(23)           Greenaway C., Menzies D., Fanning A., Grewal R., Yuan L., FitzGerald JM. Canadian Collaborative Group in nosocomial Transmission of Tuberculosis. Delay in diagnosis among hospitalized patients with active tuberculosis predictors and outcomes. American Journal of Respiratory Critical Care Medicine 2002; (165): 927- 33.

(24)           Aryan E., Makvandi M., Farajzadeh A., Huygen K., Bifani P., Mousavi SL., et al. A novel and more sensitive loop-mediated isothermal amplification assay targeting IS6110 for detection of Mycobacterium tuberculosis complex. Microbiology Research 2010; 165 (5): 211- 20.

(25)           Su WJ. Recent advances in the molecular diagnosis of tuberculosis. Journal of Microbiology and Immunology Infection 2002; 35 (4): 209- 14.

(26)           Green C., Huggett JF. Talbot E., Mwaba P., Reither K., Zumla AI. Rapid diagnosis of tuberculosis through the detection of mycobacterial DNA in urine by nucleic acid amplification. Lancet Infectious Diseases 2009; 9 (3): 505- 11.

(27)           Kohan L., Shahhosseiny MH., Razavi MR., Parivar K., Moslemi E., Verngren J. Evaluation of loop mediated isothermal amplification for diagnosis of Mycobacterium tuberculosis complex in clinical samples. African Journal of Biotechnology 2011; 10 (26): 5096- 101.

(28)           Shahhosseiny MH., Mardani M., Hosseini Z., Khoramkhorshid HR., Rahimi AA., Vande-yusefi J. Comparison of PCR and culture tests for diagnosis of Mycoplasma pneumoniae respiratory tract infections. Journal of Zanjan University of Medical Sciences & Health Services 2006; 14 (56): 12- 23.

(29)           Shahhosseiny MH., Hosseini Z., Khoramkhorshid HR., Azari S., Shokrgozar MA. Rapid and sensitive detection of Mollicutes in cell culture by polymerase chain reaction. Journal of Basic Microbiology 2010; 50 (56): 171- 8.

(30)           Shahhosseiny MH., Gharibdust F., Allahyari E., Khoramkhorshid HR., Vande-Yusefi J. Detection of Mycoplasmal DNA in rheumatoid arthritis patients serum by PCR. Journal of Medical Council of Islamic Republic of IRAN 2007; 25 (2): 178- 91.

(31)           Soltani-Banavandi MJ., Shahhosseiny MH., Shahbazzadeh V., Karimi H., Mirzahosseiny F., Mahboudi D., et al. Selective amplification of prt., tyV and invA genes by multiplex PCR. Iranian Biomedical Journal 2005; 9 (3): 135- 8.

(32)           Mahboudi F., Abolhassan M., Yaran M., Mobtaker H., Azizi M. Identification and differentiation of Iranian Leishmania species by PCR amplification of kDNA. Scandinavian Journal of Infectious Diseases 2001; 33 (8): 596- 8.

(33)           Mahboudi F., Abolhassani M., Tehrani S.R., Azimi M., Asmar M. Differentiation of old and new world leishmania species at complex and species levels by PCR. Scandinavian Journal of Infectious Diseases 2002; 34 (10): 756- 8.

(34)           Burkardt H.J. Standardization and Quality control of PCR analyses. Clinical Chemistry Laboratory Medicine 2000; 38 (2): 87- 91.

 

(35)           Sachadyn P., Kur J. The construction and use of a PCR internal control. Molecular and Cellular Probes 1998; 12 (5): 259- 62.

(36)           Siebert P.D., W. Larrick J. Competitive PCR. Nature 1992; 359 (26): 557- 8.

(37)           Rosenstraus M., Wang Z., Chang S.Y., DeBonville D., Spadoro J.P. An internal control for routine diagnostic PCR: design, properties, and effect on clinical performance. Journal of clinical and Microbilogy1993; 36 (8): 191- 7.

(38)           Ra dstro¨m P., fstro¨m C. Lo., Venklev M., Knutsson R., Wolffs P. Strategies for overcoming PCR inhibition, In C. W. Diefenbach and G.S. Dveksler (ed.), PCR primer: a laboratory manual. Cold spring Harbor Laboratory Press, Cold spring Harbor, N. Y. 2003. P. 149- 61.

(39)           Lu¨beck P.S., Wolffs P., Ra dstro m P., Hoorfar J. Toward an international standard for PCR-based detection of food-borne thermotolerant campylobacters: assay development and analytical validation. Apply Environmental Microbiology 2003; 69 (2): 5664- 69.

(40)           Brightwell G., Pearce M., Leslie D. Development of internal controls for PCR detection of Bacillus anthracis. Molecular and Cellular Probes 1998; 12 (22): 367- 77.

(41)           Abdulmawjood A., Roth S., Bu lte M. Two methods for construction of internal amplification controls for the detection of Escherichia coliO157 by polymerase chain reaction. Molecular and Cellular Probes 2002; 16 (5): 335- 9.

(42)           Belotserkovskii B P., Johnston BH. Polypropylene tube surfaces may include denaturation and multimerisation of DNA. Science 2003; 271 (42): 222- 3.