ردیابی شایع ‏ترین ژن‏ های مقاومت آنتی ‏بیوتیکی در ایزوله ‏های اسینتوباکتر بومانی جدا شده از عفونت‏ های بیمارستانی و بررسی الگوی مقاومت آنتی‏ بیوتیکی در آن ‏ها

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 کارشناس ارشد میکروبیولوژی، دانشگاه آزاد اسلامی واحد اشکذر، اشکذر، ایران

2 دانشیار میکروبیولوژی، دانشگاه آزاد اسلامی واحد شهرکرد، شهرکرد، ایران

چکیده

مقدمه: اسینتو باکتر بومانی یک کوکوباسیل گرم منفی است که در طبیعت انتشار وسیعی داشته و به عنوان یکی از عوامل مهم عفونت‏های بیمارستانی محسوب می‏شود. به واسطه ایجاد مقاومت‏های آنتی‏بیوتیکی در این باکتری، مشکلات فراوانی در درمان موفقیت آمیز بیماران و در پی آن مرگ و میر آن‏ها ایجاد شده است. مطالعه حاضر با هدف ردیابی شایع‏ترین ژن‏های کد کننده مقاومت آنتی‏بیوتیکی در ایزوله‏های اسینتو باکتر بومانی جدا شده از عفونت‏های بیمارستانی انجام شده است‏‏. ‏‏‏
مواد و روش‏‏ها: این مطالعه توصیفی در دو بیمارستان شهر تهران بر روی 121 ایزوله اسینتوباکتر بومانی جدا شده از عفونت‏های بالینی انجام شد. پس از شناسایی ایزوله‏ها با استفاده از روش‏های بیوشیمیایی، الگوی مقاومت آنتی‏بیوتیکی ایزوله‏ها به دو روش انتشار دیسک و روش مولکولی (برای ردیابی ژن‏های کد کننده مقاومت آنتی‏بیوتیکی) تعیین شد.
‏‏‏نتایج: از تعداد 121 ایزوله اسینتوباکتر بومانی جدا شده از نمونه‏های عفونی، بیش‏ترین مقاومت به آنتی‏بیوتیک تتراسایکلین با فراوانی 90/90 درصد و بیش‏ترین حساسیت به آنتی‏بیوتیک‏های کلرامفنیکل، نیتروفورانتوئین و مروپنم با فراوانی 65/1 درصد مشاهده شد. فراوانی حضور ژن‏های dfrA1، tet (A)، aac (3) - IV، sul1، tet (B)، aadA1، qnr، CITM، blaSHV، sim، vim، Oxa-58-like، Oxa-24-like، imp، Oxa-51-like، Oxa-23-like، cat1، cmlAبه ترتیب 79 (28/65 درصد)، 71 (67/58 درصد)، 68 (19/56 درصد)، 67 (37/55 درصد)، 44 (36/36 درصد)، 41 (88/33 درصد)، 29 (96/23 درصد)، 28 (14/23 درصد)، 24 (83/19 درصد)، 17 (04/14 درصد)، 16 (22/13 درصد)، 14 (57/11 درصد)، 12 (91/9 درصد)، 10 (26/8 درصد)، 9 (43/7 درصد)، 8 (61/6 درصد)، 5 (13/4 درصد) و 3 (47/2 درصد) بود. ‏‏‏
بحث و نتیجه ‏گیری: وجود مقاومت آنتی‏بیوتیکی چندگانه در ایزوله‏های مورد مطالعه، استفاده از روش‏های مولکولی در کنار آزمون آنتی بیوگرام برای انتخاب مؤثرترین آنتی‏بیوتیک در درمان عفونت و لزوم برقراری نظام مراقبت آنتی‏بیوتیکی به منظور موفقیت در‏ برنامه کنترل عفونت را در آینده نشان می‏دهد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Detection of the most prevalent antibiotic resistance genes in Acinetobacter baumannii strains isolated from hospital infections and determination of their antibiotic resistance pattern

نویسندگان [English]

  • Marziyeh Tavakol 1
  • Hassan Momtaz 2
1 M.Sc. of Microbiology, Ashkzar Branch, Islamic Azad University, Ashkzar -Iran
2 Associated Professor of Microbiology, Shahrekord Branch, Islamic Azad University, Shahrekord-Iran
چکیده [English]

Introduction:Acinetobacter baumannii is a gram-negative coccobacill that has a great distribution in the nature and is considered as one of the important causes of hospital infections. Due to the antibiotic resistances in this bacterium several problems in the successful treatment of patients and subsequently their mortality have been occurred. The present study was carried out in order to detect the most prevalent antibiotic resistance genes in Acinetobacter baumannii strains isolated from the hospital infections.
Materials and methods: This descriptive study was carried out on 121 strains ofAcinetobacter baumannii isolated from clinical samples of two hospitals of Tehran city. After identifying isolates using the biochemical tests, the antibiotic resistance pattern of them was done using the disk diffusion and molecular (in order to identify the antibiotic resistance genes) methods.
Results: Of 121 strains of Acinetobacter baumannii isolated from infectious samples, the most commonly detected antibiotic resistance was against tetracycline and the most sensitivity was achieved against chloramphenicol, nitrofurantoin and meropenem by distribution of 1.65 %. The distribution of dfrA1, tet(A), aac(3)-IV, sul1, tet(B), aadA1, qnr, CITM, blaSHV, sim, vim, oxa-58-like. Oxa-24-like, imp, oxa-51-like, oxa-23-like, cat1 and cmlA were 79 (65.27 %),
71 (58.67 %), 68 (56.19 %), 67 (55.37 %), 44 (36.36 %), 41 (33.88 %), 29 (23.96 %), 28 (23.14%), 24 (19.83 %), 17 (14.04 %), 16 (13.22 %), 14 (11.57 %), 12 (9.91 %), 10 (8.26 %), 9 (7.43 %), 8 (6.61 %), 5 (4.13 %) and 3 (2.47 %), respectively
.
Discussion and conclusion: Multiple antibiotic resistance in studied isolates the use of molecular techniques in the antibiogram test to select the most effective antibiotic treatment of infections and the importance of continued antibiotic surveillance that will provide succession in the efforts of infection control programs for the future.

کلیدواژه‌ها [English]

  • Acinetobacter baumannii
  • Hospital infections
  • Antibiotic resistance pattern
  • Antibiotic resistance genes

. مقدمه

اسینتوباکترها کوکوباسیل‏های گرم منفی و هوازی اجباری هستند که زندگی در محیط‏های مرطوب را ترجیح می‏دهند (1). مهم‏ترین گونه از این جنس اسینتوباکتر بومانی است که عامل بیماری‏های مختلفی از قبیل پنومونی، سپتی سمی، عفونت‏های دستگاه ادراری، عفونت‏های پوستی و زخم، مننژیت و اندوکاردیت می‏باشد (2 و 3). میزان کلونیزاسیون اسینتوباکتر بومانی در افراد بستری شده در بیمارستان به ویژه در آن‏هایی که مدت بستری شدنشان به درازا کشیده و یا درمان آنتی‏بیوتیکی وسیع و یا درمان ضد سرطان دریافت داشته‏اند، در حال افزایش است (4 و 5). یکی از مشکلات موجود در مورد اسینتوباکتر بومانی ظهور سویه‏هایی با مقاومت چند دارویی است که به کلاس‏های مختلف آنتی‏بیوتیک‏ها نظیر بتالاکتام‏ها، آمینوگلیکوزیدها و فلوروکینولون‏ها مقاوم‏اند (3). این مقاومت‏ها بیشتر‏ با واسطه ژن‏هایی انجام می‏شود که بر روی عناصر ژنتیکی متحرک مثل ترانسپوزون‏ها و اینتگرون‏ها قرار داشته و به سادگی در میان باکتری‏ها انتشار می‏یابند (6). مقاومت به آمینوگلیکوزیدها توسط ژن‏های aacC1(استیل ترانسفرازی را کد می‏کند که باعث مقاومت به جنتامایسین می‏شود)، ژن aadA1 (آدنیل ترانسفرازی را کد می‏کند که باعث مقاومت به استرپتومایسین و اسپکتینومایسین می‏شود)، ژن aadB (آدنیل ترانسفرازی را کد می‏کند که باعث مقاومت به جنتامایسین، توبرامایسین و کانامایسین می‏شود) و ژن aphA6 (فسفوترانسفرازی را کد می‏کند که باعث مقاومت به جنتامایسین، آمیکاسین، کانامایسین و نئومایسین می‏شود). مقاومت به پنی سیلین‏ها و سفالوسپورین‏ها از طریق آنزیم بتالاکتامازی است که توسط ژن ADC7 و یا ژن OXAset کد می‏شود (7). به نظر می‏رسد عوامل ضد میکروبی جدیدی که بتواند در مقابل این باکتری فعالیت مؤثر داشته باشند در آینده نزدیک در دسترس نباشد که این موضوع اهمیت فعالیت عوامل ضد میکروبی رایج را بیشتر می‏کند. مطالعه حاضر با هدف ردیابی شایع‏ترین ژن‏های کدکننده مقاومت آنتی‏بیوتیکی در ایزوله‏های اسینتو باکتر بومانی جدا شده از بیماران بستری در دو بیمارستان بزرگ شهر تهران و تعیین الگوی حساسیت آنتی‏بیوتیکی این ایزوله‏ها انجام گرفت.

 

‏‏. مواد و روش‏ها

ایزوله‏های باکتریایی: در این مطالعه توصیفی- مقطعی، 500 نمونه بالینی شامل خون (98 نمونه)، خلط (141 نمونه)، ادرار (92 نمونه)، چرک (134 نمونه) و مایع مغزی نخاعی (35 نمونه) از بیماران بستری در بیمارستان‏های پیامبران و بقیة اله (عج) تهران طی مدت 6 ماه (اسفند91 تا شهریور 92) جداسازی و به آزمایشگاه انتقال داده شد. در آزمایشگاه هر نمونه روی محیط‏های مک کانکی آگار و بلاد آگار کشت داده و به مدت 24 ساعت در 37 درجه سانتی‏گراد انکوبه شد. پس از 24 ساعت، با آزمایش مستقیم (رنگ آمیزی گرم) وجود کوکوباسیل‏های گرم منفی اسینتوباکتر به روش میکروسکوپی تایید شد. سپس، برای تشخیص گونه‏های مختلف اسینتو باکتر تست‏های بیوشیمیایی IMVIC، اوره آز، TSI، OF، MRVP، SIM، کاتالاز و اکسیداز و رشد در 37 و 42 درجه سانتی‏گراد انجام شد. ایزوله‏هایی که دارای واکنش لاکتوز منفی، غیر متحرک، اکسیداز منفی، کاتالاز مثبت، اندول منفی، پیگمان منفی، اوره آز مثبت، سیترات مثبت، H2S منفی، MR منفی وVP منفی بودند به عنوان اسینتو باکتر بومانی جداسازی شد و در منفی70 درجه سانتی‏گراد در محیط پپتون واتر که حاوی 30 درصد گلیسرول، نگه داری شد.

به منظور تایید قطعی اسینتو باکتر بومانی در ایزوله‏های مورد مطالعه، از آزمایش PCR در حضور زوج پرایمرهای نشان داده شده در جدول 1 (با ردیابی ژن 16S-23S ribosomal DNA) استفاده شد. واکنش PCR در حجم 25 میکرولیتر واجد 5/2 میکرولیتر بافر با غلظت 10 برابر[1]، 5/1 میلی‏مولکلرید منیزیم[2]، 100 میکرومول dNTP mix، 1 واحد آنزیم پلی مراز[3] (فرمنتاس- لیتوانی)، 1 میکرومول از زوج پرایمرهای F و R و 2 میکرولیتر از DNA مربوط به هر ایزوله تنظیم شد. برنامه حرارتی مورد استفاده در این مرحله شامل یک سیکل 94 درجه سانتی‏گراد به مدت 3 دقیقه، 30 سیکل تکراری 95 درجه سانتی‏گراد به مدت 40 ثانیه، 59 درجه سانتی‏گراد به مدت 55 ثانیه، 72 درجه سانتی‏گراد به مدت 60 ثانیه و سیکل انتهایی 72 درجه سانتی‏گراد به مدت 6 دقیقه بود. وجود قطعه 208جفت بازی تکثیر یافته در این واکنش نشانگر وجود اسینتو باکتر بومانی در کلونی‏های مورد مطالعه بود (8).

.آزمون تعیین حساسیت و مقاومت ایزوله‏ها نسبت به آنتی‏بیوتیک‏ها: مقاومت نسبت به آنتی‏بیوتیک‏ها با استفاده از دیسک‏های آنتی‏بیوتیکی ساخت شرکت پادتن طب، ایران، بر اساس دستورالعمل 2010 [4]CLSI  و مطالعات مشابه و با استفاده از روش انتشار دیسک در محیط مولر هینتون آگار ارزیابی شد (7، 9، 10 و 11). شایان ذکر است از سویه استاندارد اشریشیا کلی ATCC 25922 به عنوان کنترل منفی کیفیت آنتی بیوگرام و سویه استاندارد اسینتوباکتر بومانی ATCC 19606 به عنوان کنترل مثبت کیفیت آنتی بیوگرام استفاده شد. آنتی‏بیوتیک‏های آزمون شده شامل: تتراسایکلین (30 میکروگرم/ دیسک)، سفتازیدیم (30 میکروگرم/ دیسک)، سیپروفلوکساسین (30 میکروگرم/ دیسک)، کوتریموکسازول (25/1/ 75/23 میکروگرم/ دیسک)، توبرامایسین (10 میکروگرم/ دیسک)، کلرامفنیکل (30 میکروگرم/ دیسک)، نورفلوکساسین (10 میکروگرم/ دیسک)، آمیکاسین (30 میکروگرم/ دیسک)، جنتامایسین (10 میکروگرم/ دیسک)، ریفامپین (5 میکروگرم/ دیسک)، سفالوتین (30 میکروگرم/ دیسک)، استرپتومایسین (10 میکروگرم/ دیسک)، تری متوپریم (5 میکروگرم/ دیسک)، لووفلوکساسین (5 میکروگرم/ دیسک)، ایمی پنم (10 میکروگرم/ دیسک)، مروپنم (10 میکروگرم/ دیسک)، نیتروفورانتوئین (300 میکروگرم/ دیسک)، آزیترومایسین (15 میکروگرم/ دیسک) و اریترومایسین (15 میکروگرم/ دیسک) بودند. در این روش سوسپانسیون باکتری با کدورت معادل 5/0 مک فارلند بر روی محیط مولر هینتون آگار تلقیح شد. پس از گذاشتن دیسک‏ها در محیط کشت و 24 ساعت انکوباسیون در دمای 37 درجه سانتی‏گراد، قطر هاله عدم رشد برای هر آنتی‏بیوتیک مطابق با دستورالعمل مربوطه به عنوان حساس و مقاوم ثبت شد.

.ردیابی ژن‏های کدکننده مقاومت آنتی‏بیوتیکی: برای ردیابی شایع‏ترین ژن‏های کدکننده مقاومت آنتی‏بیوتیکی شامل ژن‏های aadA1(کدکننده مقاومت به استرپتومایسین)، aac (3) -IV(کدکننده مقاومت به جنتامایسین) ، sul1(کدکننده مقاومت به سولفونامید)، blaSHV و CITM(کدکننده مقاومت به بتالاکتام)، cat1 و cmlA(کدکننده مقاومت به کلرامفنیکل)، tet (A) وtet (B) (کدکننده مقاومت به تتراسایکلین) ، dfrA1(کدکننده مقاومت به تری متوپریم)، qnr(کدکننده مقاومت به کوئینولون)، impو vimوsim (کدکننده مقاومت به کربنی سیلین)، Oxa-51-like، Oxa-23-like Oxa-24-like، Oxa-58-like (کدکننده مقاومت به اگزاسیلین)، از زوج پرایمرهای نشان داده شده در جدول 1 به روش PCR استفاده شد. برای این منظور ابتدا DNA ژنومی از ایزوله‏های اسینتو باکتر بومانی جدا شده در مرحله قبل با استفاده از کیت استخراج [5] DNA ساخت شرکت فرمنتاس- لیتوانی[6] استخراج و بسته به اندازه قطعات ژنی مورد مطالعه در چند مرحله به روش DNA چندگانه‏ای آزمایش شد:

برای ردیابی ژن‏های aadA1، aac (3) -IV، sul1، blaSHV، CITM، cat1، cmlA، tet (A)، tet (B) ، dfrA1 وqnr واکنش PCR چندگانه ای[7] در حجم 50 میکرولیتر واجد 5 میکرولیتر بافر با غلظت 10 برابر، 2 میلی‏مول کلرید منیزیم، 150 میکرومول dNTP mix، 5/0 میکرومول از زوج پرایمرهایF و R (مربوط به هر ژن)، 5/1 واحد آنزیم پلی مراز و 2 میکرولیتر از DNA مربوط به هر نمونه تنظیم شد. برنامه حرارتی مورد استفاده برای تکثیر قطعات ژنی فوق شامل یک سیکل 94 درجه سانتی‏گراد به مدت 6 دقیقه، 33 سیکل تکراری 95 درجه سانتی‏گراد به مدت 70 ثانیه، 55 درجه سانتی‏گراد به مدت 65 ثانیه، 72 درجه سانتی‏گراد به مدت 90 ثانیه و یک سیکل انتهایی 72 درجه سانتی‏گراد به مدت 8 دقیقه بود (12- 15).

ردیابی سه ژن imp، vim و sim در یک واکنش PCR چندگانه ای به حجم 50 میکرولیتر واجد 5 میکرولیتر بافر با غلظت 10 برابر، 5/1 میلی‏مول کلرید منیزیم، 100 میکرومول dNTP mix، 1 میکرومول از زوج پرایمرهای F و R مربوط به هر ژن، 1 واحد آنزیم پلی مراز و 5/2 میکرولیتر از DNA مربوط به هر نمونه با برنامه حرارتی زیر انجام شد:

 یک سیکل 95 درجه سانتی‏گراد به مدت 4 دقیقه، 30 سیکل تکراری 94 درجه سانتی‏گراد به مدت 45 ثانیه، 58 درجه سانتی‏گراد به مدت 60 ثانیه، 72 درجه سانتی‏گراد به مدت 40 ثانیه و یک سیکل انتهایی 72 درجه سانتی‏گراد به مدت 5 دقیقه (16). به منظور ردیابی ژن‏های کدکننده مقاومت به اگزااسیلین
(ژن‏های Oxa-51-like، Oxa-23-like، Oxa-24-like، Oxa-58-like)، از یک واکنشPCR چندگانه‏ای با حجم 50 میکرولیتر شامل 5 میکرولیتر بافر با غلظت 10 برابر، 5/2 میلی‏مول کلرید منیزیم، 200 میکرومول dNTP mix، 5/0 میکرومول از زوج پرایمرهای F و R مربوط به هر ژن، 5/1 واحد آنزیم پلی مراز و 2 میکرولیتر ازDNA مربوط به هر ایزوله استفاده شد. برنامه حرارتی مورد استفاده در این مرحله عبارت بود از: یک سیکل 94 درجه سانتی‏گراد به مدت 5 دقیقه، 32 سیکل تکراری 95 درجه سانتی‏گراد به مدت 50 ثانیه، 60 درجه سانتی‏گراد به مدت 60 ثانیه، 72 درجه سانتی‏گراد به مدت 70 ثانیه و یک سیکل انتهایی 72 درجه سانتی‏گراد به مدت 10 دقیقه (17).

برای تکثیر قطعات ژنی مورد مطالعه از دستگاه ترموسایکلر [8] استفاده شد. به منظور ردیابی قطعه ژنی تکثیر یافته در PCR از الکتروفورز محصول PCR روی ژل آگاروز استفاده شد. در این مرحله 15 میکرولیتر از محصول PCR مربوط به هر مرحله از آزمایش در حضور مارکر 100 جفت بازی DNA (فرمنتاس- لیتوانی) روی ژل 5/1 درصد آگاروز واجد اتیدیوم بروماید در ولتاژ ثابت 90 ولت به مدت در حدود 45 دقیقه الکتروفورز و پس از مشاهده ژل به دست آمده با دستگاه ترانس لومیناتور UV (UVitech)، انگلستان، تصویر به دست آمده روی کاغذ حرارتی ثبت شد.

.تجزیه و تحلیل آماری نتایج: داده‏های حاصل از نتایج به دست آمده در این مطالعه با نرم افزار آماری SPSS ver.16 و مدل‏های آماری مربع کای و دقیق فیشر در سطح اطمینان 95 درصد تحلیل شد.

 

 

جدول 1- توالی پرایمرهای مورد استفاده جهت ردیابی شایع‏ترین ژن‏های کدکننده مقاومت آنتی‏بیوتیکی در ایزوله‏های اسینتو باکتر بومانی

مقاومت آنتی‏بیوتیکی

نام ژن

توالی پرایمر

(5’-3’)

اندازه محصول (جفت باز)

منبع

Streptomycin

aadA1

(F) TATCCAGCTAAGCGCGAACT

(R) ATTTGCCGACTACCTTGGTC

447

12

Gentamicin

aac (3) -IV

(F) CTTCAGGATGGCAAGTTGGT

(R) TCATCTCGTTCTCCGCTCAT

286

12

Sulfonamide

sul1

(F) TTCGGCATTCTGAATCTCAC

(R) ATGATCTAACCCTCGGTCTC

822

12

Beta-lactams

blaSHV

(F) TCGCCTGTGTATTATCTCCC

(R) CGCAGATAAATCACCACAATG

768

12

Beta-lactams

CITM

(F) TGGCCAGAACTGACAGGCAAA

(R) TTTCTCCTGAACGTGGCTGGC

462

12

Chloramphenicol

cat1

(F) AGTTGCTCAATGTACCTATAACC

(R) TTGTAATTCATTAAGCATTCTGCC

547

12

Chloramphenicol

cmlA

(F) CCGCCACGGTGTTGTTGTTATC

(R) CACCTTGCCTGCCCATCATTAG

698

12

Tetracycline

tet (A)

(F) GGTTCACTCGAACGACGTCA

(R) CTGTCCGACAAGTTGCATGA

577

13

Tetracycline

tet (B)

(F) CCTCAGCTTCTCAACGCGTG

(R) GCACCTTGCTGATGACTCTT

634

13

Trimethoprim

dfrA1

(F) GGAGTGCCAAAGGTGAACAGC

(R) GAGGCGAAGTCTTGGGTAAAAAC

367

14

Quinolones

qnr

(F) GGGTATGGATATTATTGATAAAG

(R) CTAATCCGGCAGCACTATTTA

670

15

Carbiniciline

imp

(F) GAATAGAATGGTTAACTCTC

(R) CCAAACCACTAGGTTATC

188

16

Carbiniciline

vim

(F) GTTTGGTCGCATATCGCAAC

(R) AATGCGCAGCACCAGGATAG

382

16

Carbiniciline

sim

(F) GTACAAGGGATTCGGCATCG

(R) GTACAAGGGATTCGGCATCG

569

16

Oxacillinases

Oxa-51-like

(F) TAATGCTTTGATCGGCCTTG

(R) TGGATTGCACTTCATCTTGG

353

17

Oxacillinases

Oxa-23-like

(F) GATCGGATTGGAGAACCAGA

(R) ATTTCTGACCGCATTTCCAT

501

17

Oxacillinases

Oxa-24-like

(F) GGTTAGTTGGCCCCCTTAAA

(R) AGTTGAGCGAAAAGGGGATT

246

17

Oxacillinases

Oxa-58-like

(F) AAGTATTGGGGCTTGTGCTG

(R) CCCCTCTGCGCTCTACATAC

599

17

A. baumannii

detection

16S-23S ribosomal

DNA

(F) CATTATCACGGTAATTAGTG

(R) AGAGCACTGTGCACTTAAG

208

8

 


. نتایج

همان‏گونه که در جدول 2 مشهود است از مجموع 500 نمونه اخذ شده از انواع عفونت‏های بیمارستانی تعداد 121 نمونه (20/24 درصد)، آلوده به اسینتو باکتر بومانی بودند که در این میان بیش‏ترین میزان آلودگی مربوط به نمونه‏های اخذ شده از خون (موارد باکتریمی) با 87/43 درصد و کم‏ترین میزان مربوط به نمونه‏های اخذ شده از چرک‏ها و آبسه‏های سطحی با 94/11 درصد آلودگی برآورد شد. تجزیه و تحلیل آماری نتایج نشانگر وجود اختلاف آماری معنا‏داری
(023/0P value = ) بین میزان آلودگی نمونه‏های خون با نمونه‏های اخذ شده از عفونت‏های چرکی و مایع مغزی نخاعی[9] بود. تمام 121 ایزوله اسینتو باکتر بومانی جدا شده به منظور تعیین الگوی حساسیت آنتی‏بیوتیکی در حضور شایع‏ترین آنتی‏بیوتیک‏های مورد استفاده در درمان بیماری‏های عفونی در انسان به روش انتشار دیسکی ساده مطالعه شدند، که نتایج آن در جدول 3 نشان داده شده است. بر اساس اطلاعات این جدول 90/90 درصد از ایزوله‏ها نسبت به آنتی‏بیوتیک تتراسایکلین مقاوم بودند اما مقاومت به آنتی‏بیوتیک کلرامفنیکل، نیتروفورانتوئین و مروپنم با فراوانی 65/1 درصد کم‏ترین مقدار بود.

تجزیه و تحلیل آماری اطلاعات مربوط به جدول بالا نشانگر وجود اختلاف آماری معنادار بین مقاومت آنتی‏بیوتیکی ایزوله‏های اسینتو باکتر بومانی به تتراسایکلین با سه آنتی‏بیوتیک کلرامفنیکل، نیتروفورانتوئین و مروپنم (012/0P value = )، بین مقاومت به تتراسایکلین و مقاومت به ایمی پنم و لووفلوکساسین (146/0P value = ) و نیز بین مقاومت به تری متوپریم با پنج آنتی‏بیوتیک کلرامفنیکل، نیتروفورانتوئین، مروپنم، ایمی پنم و لووفلوکساسین (321/0P value = ) بود.

حضور شایع‏ترین ژن‏های کدکننده مقاومت به آنتی‏بیوتیک‏های معمول در درمان عفونت‏های بیمارستانی در انسان به روش PCR چندگانه ای بررسی شدند. همان گونه که در جدول 4 آورده شده است، فراوانی حضور ژن‏های کدکننده مقاومت به تتراسایکلین (03/95 درصد) بیش‏ترین و ژن‏های کدکننده مقاومت به کلرامفنیکل (6/6 درصد) کم‏ترین مقدار بود. در این میان ژن‏های کدکننده مقاومت به کربنی سیلین‏ها و اگزاسیلین‏ها با 73/29 و 52/35 درصد از ایزوله‏های اسینتو باکتر بومانی جدا شده ردیابی شدند.

تحلیل آماری اطلاعات جدول بالا نشانگر وجود اختلاف آماری معنا دار بین فراوانی حضور ژن‏های‏ tetA و tetB با سایر ژن‏های مورد مطالعه
(241/0P value = ) بود.

تصاویر مربوط به الکتروفورز محصول PCR مربوط به تعدادی از ژن‏های مورد مطالعه در شکل 1 نشان داده شده است:

 

شکل 1- ژل حاصل از الکتروفورز محصول PCR مربوط به ژن‏های dfrA1 (قطعه 367 جفت بازی)، tetB (قطعه 634 جفت بازی)، aadA1 (قطعه 447 جفت بازی) و aac (3) -IV (قطعه 286 جفت بازی)، ستون M= مارکر 100 جفت بازی DNA، ستون 1= کنترل منفی

 

جدول 2- فراوانی ایزوله‏های اسینتوباکتر بومانی برحسب نوع نمونه بالینی

نوع نمونه

تعداد نمونه اخذ شده

تعداد ایزوله اسینتو باکتر بومانی

درصد

خون

98

43

87/43

خلط

141

34

11/24

ادرار

92

22

91/23

چرک

134

16

94/11

مایع مغزی نخاعی (CSF)

35

6

14/17

تعداد کل

500

121

20/24

 

 

جدول 3- الگوی مقاومت آنتی‏بیوتیکی در ایزوله‏های اسینتو باکتر بومانی جدا شده از عفونت‏های بیمارستانی

نمونه

استرپتومایسین

جنتامایسین

آمیکاسین

توبرامایسین

کوتریموکسازول

سفالوتین

سفتازیدیم

تتراسایکلین

تری متوپریم

خون (43)

11

19

8

7

29

12

8

41

28

خلط (34)

7

10

3

2

17

9

2

30

26

ادرار (22)

6

7

4

3

11

2

7

20

12

چرک (16)

12

2

0

0

4

0

3

15

9

مایع مغزی نخاعی (6)

2

0

0

0

1

2

0

4

0

کل (121)

38

(40/31 %)

38

(40/31 %)

15

(39/12 %)

12

 (91/9 %)

62

(23/51 %)

25

 (66/20 %)

20

(52/16 %)

110

(90/90 %)

75

(98/61 %)

نمونه

سیپروفلوکساسین

لووفلوکساسین

ایمی پنم

مروپنم

کلرامفنیکل

نیتروفورانتوئین

آزیترومایسین

ریفامپین

اریترومایسین

خون (43)

5

0

1

1

0

0

4

2

4

خلط (34)

4

3

2

0

0

0

2

4

3

ادرار (22)

1

2

1

1

1

2

3

4

3

چرک (16)

0

2

2

0

1

0

1

0

7

مایع مغزی نخاعی (6)

2

1

1

0

0

0

0

0

0

کل (121)

12

(91/9 %)

8

(61/6 %)

7

(5/78 %)

2

(65/1 %)

2

(65/1 %)

2

(65/1 %)

10

 (26/8 %)

10

(26/8 %)

17

(04/14 %)

 

جدول 4- توزیع ژن‏های کدکننده مقاومت به آنتی‏بیوتیک‏ها در ایزوله‏های اسینتو باکتر بومانی جدا شده از عفونت‏های بیمارستانی

qnr

dfrA1

tetB

tetA

CITM

blaSHV

sul1

aac (3) -IV

aadA1

نمونه

16

28

11

31

12

8

30

34

12

خون (43)

7

27

12

20

10

8

18

13

8

خلط (34)

3

12

7

14

2

5

12

14

7

ادرار (22)

0

10

9

6

1

3

5

7

12

چرک (16)

3

2

5

0

3

0

2

0

2

مایع مفزی نخاعی (6)

29

(96/23%)

79

(28/65%)

44

(36/36%)

71

(67/58%)

28

(14/23%)

24

(83/19%)

67

(37/55%)

68

(19/56 %)

41

(88/33 %)

کل (121)

imp

cmlA

cat1

Oxa-58-like

Oxa-24-like

Oxa-23-like

Oxa-51-like

sim

vim

نمونه

2

0

0

0

1

0

3

7

4

خون (43)

4

0

0

3

8

4

3

0

2

خلط (34)

2

1

4

6

2

3

2

5

7

ادرار (22)

2

2

1

2

0

1

0

5

3

چرک (16)

0

0

0

3

1

0

1

0

0

مایع مفزی نخاعی (6)

10

(26/8%)

3

(47/2%)

5

(13/4%)

14

(57/11%)

12

(91/9%)

8

(61/6%)

9

(43/7%)

17

(04/14%)

16

(22/13%)

کل (121)

 

 

. بحث و نتیجه‏‏ گیری

امروزه گسترش ژن‏های مقاومت آنتی‏بیوتیکی با ایجاد مقاومت‏های آنتی‏بیوتیکی چندگانه به مشکل مهمی در درمان عفونت‏های حاصل از اسینتو باکترها تبدیل شده است (18). مطالعات مختلف نشان داده که اسینتو باکتر بومانی به بیشتر آنتی‏بیوتیک‏های بتالاکتام و کینولون‏ها مقاوم بوده و مقاومت آن به آمینوگلیکوزیدها نیز در حال افزایش است (19). مطالعه حاضر با هدف تعیین الگوی مقاومت آنتی‏بیوتیکی ایزوله‏های اسینتو باکتر بومانی جدا شده از عفونت‏های بیمارستانی با دو روش معمول آنتی بیوگرام و ردیابی ژن‏های کدکننده مقاومت آنتی‏بیوتیکی (به روش PCR) انجام گرفت و مشخص شد که تمام ایزوله‏های مورد بررسی دارای مقاومت آنتی‏بیوتیکی چندگانه بوده‏اند و به آنتی‏بیوتیک‏های استرپتومایسین، جنتامایسین، تتراسایکلین، تری متوپریم و کوتریموکسازول مقاوم هستند؛ اما تمام آن‏ها نسبت به سه آنتی‏بیوتیک کلرامفنیکل، نیتروفورانتوئین و مروپنم حساس بودند که در مطالعه انجام شده توسط کارولوسکی[x] و همکاران در فاصله سال‏های 1998 تا 2001 این امر به اثبات رسیده و آن‏ها نیز حساسیت ایزوله‏های اسینتو باکتر به مروپنم را 90 درصد گزارش کرده‏اند (20). در مطالعه‏ای که توسط آیان[xi] و همکاران در سال 2003 انجام گرفت مشخص شد که از 52 سویه مورد مطالعه، همه ایزوله‏ها به پیپراسیلین، تازوباکتام، تیکارسیلین-کلاولانیک اسید، سفپیم، سفوتاکسیم، سفتازیدیم، سفتریاکسون، جنتامایسین و آزترونام مقاوم بوده و مقاومت به توبرامایسین، سیپروفلوکساسین، آمپی سیلین- سولباکتام، کوتریموکسازول و آمیکاسین به ترتیب در 5، 8، 55، 66 و 74 درصد ایزوله‏ها مشاهده شد (21). مطالعه‏ای که توسط باسوستاگلو[xii] و همکاران در سال 2001 به منظور بررسی ویژگی‏های اپیدمیولوژیک سویه‏های اسینتو باکتر بومانی انجام گرفت نشان داد که از 32 ایزوله اسینتو باکتر بومانی مورد بررسی، همه ایزوله‏ها به ایمی پنم حساس بودند که با نتایج این پژوهش مطابقت دارد (22). در مطالعه‏ای که توسط اسمولیلکوو[xiii] و همکاران به منظور بررسی عفونت‏های ناشی از اسینتو باکتر بومانی با مقاومت دارویی چندگانه انجام گرفت مشخص شد که 93 درصد سویه‏ها به ایمی پنم و 100 درصد سویه‏ها به کلیستین و آمپی سیلین- سولباکتام حساس می‏باشند (23). در مطالعه وانگ[xiv] و همکاران در سال 2003 که بر روی اپیدمی‏های ناشی از اسینتو باکتر بومانی مقاوم به دارو در بخش ICU انجام گرفت، مشخص شد که تمام سویه‏ها به آزترونام، آمیکاسین، آمپی سیلین- سولباکتام، سفتازیدیم، سفپیم، سیپروفلوکساسین، جنتامایسین، ایمی پنم، مروپنم، پیپراسیلین- تازوباکتام و تیکارسیلین- کلاولانیک اسید مقاوم و به پلی میکسین حساس هستند (24). در مطالعه ما 6/87 درصد سویه‏ها به آمیکاسین حساس بودند که در این مورد نتایج پژوهش حاضر با نتایج پژوهش وانگ و همکاران مطابقت ندارد. همچنین برخلاف مطالعه اسمولیاکوو در مطالعه وانگ تمام سویه‏ها به ایمی پنم و آمپی سیلین -سولباکتام مقاوم بودند (23 و 24). میرنژاد[xv] و همکاران در مطالعه انجام شده در سال 1390 نشان دادند که مروپنم و توبرامایسین مؤثرترین آنتی‏بیوتیک در درمان عفونت‏های بیمارستانی ناشی از اسینتوباکتر بومانی بوده در حالی که ایزوله‏های مورد بررسی مقاومت بسیار بالایی در برابر سفپیم و آمیکاسین نشان دادند (25). در مطالعه‏ای که در سال 2008 در ترکیه انجام شد، میزان مقاومت نسبت به پییراسیلین، پیپراسیلین- تازوباکتام، سیپروفلوکساسین و سفتازیدیم به ترتیب 100، 4/92، 3/83 و 2/74 درصد بود و مقاومت بالایی نیز نسبت به سایر آنتی‏بیوتیک‏ها گزارش شد (26)، در حالی که در مطالعه کای[xvi] و همکاران در سال 2012 از مجموع 176 ایزوله اسینتو باکتر، 128 ایزوله MDR بوده اند که از میان آن‏ها 63/90 درصد به ایمی پنم و 31/95 درصد به مروپنم مقاوم بوده اند اما در عین حال تنها 63/15 درصد نسبت به سیپروفلوکساسین مقاومت داشتند (27). کرباسی زاده و حیدری [xvii] در بررسی الگوی مقاومت آنتی‏بیوتیکی 50 ایزوله اسینتوباکتر بومانی جدا شده از بخش مراقبت‏های ویژه در شهر اصفهان نشان دادند که 85 درصد ایزوله‏ها دارای مقاومت آنتی‏بیوتیکی چندگانه هستند (28). طالبی طاهر[xviii] و همکاران از 51 نمونه خلط مورد مطالعه 35 ایزوله اسینتوباکتر جدا کردند که درصد بالایی از ایزوله‏ها به ایمی پنم، پیپراسیلین، تازوباکتام، سفالوسپورین‏های نسل سوم و جنتامایسین مقاوم بوده و نتیجه گرفتند که مقاومت آنتی‏بیوتیکی در گونه‏های اسینتوباکتر رو به افزایش بوده و اقدامات پیشگیری کننده سریع انجام شود (29).

در بخش ردیابی ژن‏های کدکننده مقاومت آنتی‏بیوتیکی ژن‏های tetAوtetB با فراوانی 04/95 درصد شایع‏ترین ژن‏های ردیابی شده در ایزوله‏های مورد مطالعه بودند.

 ژن‏های کدکننده مقاومت به کربنی سیلین‏ها (vim، sim وimp) و اکساسیلین‏ها (، Oxa-51-lik، Oxa-23-lik، Oxa-24-likوOxa-58-lik) در 53/35 و 36/36 درصد از ایزوله‏های اسینتو باکتر بومانی جدا شده حضور داشتند. در مطالعه انجام شده توسط هوجر[xix] و همکاران فراوانی حضور ژن‏های blaADCو blaOXA-like، 99 و 97 درصد بود که در مقایسه با این پژوهش بیش‏تر بود. در این مطالعه ژن‏های‏aacC1، apha6، aadB و aadA1در 56، 71، 48 و 39 درصد از ایزوله‏ها ردیابی شد (6). در حالی که در مطالعه حاضر ژن aadA1 در 33/88 وaac (3) -IV در 56/19 درصد از ایزوله‏های مورد مطالعه حضور داشت. نمک[xx] و همکاران با ردیابی ژن‏های کدکننده مقاومت به آمینوگلیکوزیدها در 101 ایزوله اسینتو باکتر بومانی نشان دادند که ژن‏های aacC1 و aadA1 در 68 ایزوله، ژن apha6 در 55 ایزوله و ژن aadB در 31 ایزوله وجود دارند (30). فراهانی خلت آبادی[xxi] و همکاران (1387) الگوی مقاومت آنتی‏بیوتیکی وتوزیع ژن های کدکننده مقاومت آنتی‏بیوتیکی در گونه‏های اسینتوباکتر جدا شده از بیمارستان شهید بهشتی کاشان را مطالعه کردند. در این بررسی 48 ایزوله اسینتوباکتر بومانی، 6 ایزوله اسینتوباکتر لوفی و 6 ایزوله از سایر گونه‏های اسینتوباکتر از بیماران جدا شد. گونه های اسینتوباکتر به ترتیب بیش‏ترین مقاومت را به آمیکاسین، توبرامایسین، سفتازیدیم، سیپروفلوکساسین، پیپراسیلین-تازوباکتام، داکسی سیکلین، تریمتوپریم/ سولفامتوکسازول، مینوسیکلین، لووفلوکساسین، ایمی پنم و سولباکتام/ آمپی سیلین نشان دادند. مقاومت به چند آنتی‏بیوتیک در 7/66 درصد ایزوله‏ها دیده شد. میزان حضور ژن های، aphA6، aacC1، ADC-7، OXA SET C، aadA1 و aadB، به ترتیب 39 (65 درصد)، 38 (2/63 درصد)، 34 (7/56 درصد)، 32 (3/53 درصد)، 25 (7/41 درصد) و 2 (3/3 درصد) گزارش شد (31). علت اختلاف در الگوی مقاومت آنتی‏بیوتیکی تعیین شده در این مطالعه با مطالعات مشابه انجام شده در ایران و خارج از ایران می‏تواند مربوط به تفاوت در نوع نمونه بالینی اخذ شده، تعداد نمونه‏های مورد مطالعه، روش نمونه گیری، نوع مطالعه طراحی شده، منطقه جغرافیایی و شرایط آب و هوایی منطقه، اولویت در تجویز آنتی‏بیوتیک‏های مختلف توسط پزشکان منطقه و در دسترس بودن آنتی‏بیوتیک‏های مختلف باشد.

 در پایان به این موضوع باید اشاره کرد که آنچه در بیشتر مطالعات به چشم می‏خورد، این است که بیش‏تر ایزوله‏های اسینتو باکتر به سفالوسپورین‏های نسل سوم، تیکارسیلین- آزترونام و تیکارسیلین- کلاولانیک اسید مقاوم و به کلیستین حساس هستند. با توجه به این که در کشور ما مطالعات کمی در رابطه با ویژگی‏های اپیدمیولوژیک و الگوی مقاومت دارویی ایزوله‏های اسینتو باکتر بومانی انجام گرفته است، توجه به نقش این باکتری به عنوان یک عامل بالقوه خطرناک در عفونت‏های بیمارستانی ضروری به نظر می‏رسد.

تشکر و قدردانی

نویسندگان مقاله از زحمات مدیریت محترم بخش عفونی بیمارستان‏های مورد مطالعه و کارشناس محترم آزمایشگاه میکروب‏شناسی دانشگاه آزاد اسلامی واحد شهرکرد جناب آقای مهندس منوچهر مومنی تشکر و قدردانی می‏کنند.



[1]- PCR buffer 10X

[2]- MgCl2

[3]- Taq DNA Polymerase

[4]- Clinical and Laboratory Standards Institute

[5] - DNA Genomic Purification Kit

[6] - Fermentas-Lithuania

[7]- Multiplex PCR

[8]- Thermo Cycler (Eppendorf, Mastercycler ® 5330, Eppendorf- Netheler- Hinz GmbH, Hamburg, Germany)

[9]- Cerebral Spinal Fluid (CSF)

[x]- Karlowsky

[xi]- Ayan

[xii]- Basustaoglu

[xiii]- Smolyakov

[xiv]- Wang

[xv]- Mirnejad

[xvi]- Cai

[xvii]- Karbasizade and Heidary

[xviii]- Talebi-Taher

[xix] -Hujer

[xx]- Nemec

[xxi] -Farahani Kheltabadi

(1)               Wang H., Guo P., Sun H., Wang H., Yang Q., Chen M., et al. Molecular epidemiology of clinical isolates of carbapenem-resistant Acinetobacter spp. from Chinese hospitals. Antimicrobial Agents and Chemotherapy 2007; 51 (11): 4022- 8.

(2)               Gordon NC., Wareham DW. Multidrug-resistant Acinetobacter baumannii: mechanisms of virulence and resistance. International Journal of Antimicrobial Agents 2010; 35 (3): 219- 26.

(3)                Bou G., Cerveró G., Domínguez MA., Quereda C., Martínez-Beltrán J. Characterization of a nosocomial outbreak caused by a multiresistant Acinetobacter baumannii strain with a carbapenem-hydrolyzing enzyme: high-level carbapenem resistance in A. baumannii is not due solely to the presence of beta-lactamases. Journal of Clinical Microbiology2000; 38 (9): 3299- 305.

(4)                Bergogne-Bérézin E., Towner KJ. Acinetobacter spp. as nosocomial pathogens: microbiological, clinical, and epidemiological features. Clinical Microbiology Reviews 1996; 9 (2): 148- 65.

(5)               Coelho J., Woodford N., Turton J., Livermore DM. Multiresistant acinetobacter in the UK: how big a threat? Journal of Hosptal Infection 2004; 58 (3): 167- 9.

(6)               Jin H., Xu XM., Mi ZH., Mou Y., Liu P. Drug-resistant gene based genotyping for Acinetobacter baumannii in tracing epidemiological events and for clinical treatment within nosocomial settings.  Chinese Medical Journal 2009; 122 (3): 301- 6.

(7)               Hujer KM., Hujer AM., Hulten EA., Bajaksouzian S., Adams JM., Donskey CJ., et al. Analysis of antibiotic resistance genes in multidrug-resistant Acinetobacter sp. isolates from military and civilian patients treated at the Walter Reed Army Medical Center. Antimicrobal Agents and Chemotherapy2006; 50 (12): 4114- 23.

(8)               Chiang MC., Kuo SC., Chen YC., Lee YT., Chen TL., Fung CP. Polymerase chain reaction assay for the detection of Acinetobacter baumannii in endotracheal aspirates from patients in the intensive care unit. Journal of Microbiology, Immunology and Infection 2011; 44 (2): 106- 10.

(9)                    Clinical and Laboratory Standards Institute. Performance standards for antimicrobial disk susceptibility testing; 20th informational supplement. CLSI/ NCCLS M100-S20. Clinical and Laboratory Standards Institute, Wayne, Pa, 2010.

 

 

(10)           Najafipour S., Jafari S., Kargar M., Abdollahy A., Mardaneh J., Fasihy Ramandy M., et al. Phenotypical Evaluation of Multi-Drug Resistant Acinetobacter Baumannii: Original Article. Journal of Fasa University of Medical Sciences 2012; 2 (4): 254- 8.

(11)           Moosavian M., Shoja S., Peymani A., Tabatabaiefar MA., Rostami S., Ebrahimi N. Genotyping of carbapenem resistant Acinetobacter baumannii isolated from tracheal tube discharge of hospitalized patients in intensive care units, Ahvaz, Iran. Iranian Journal of Medical Microbiology 2013; 5 (4): 315-22.

(12)           Van TT., Chin J., Chapman T., Tran LT., Coloe PJ. Safety of raw meat and shellfish in Vietnam: an analysis of Escherichiacoli isolations for antibiotic resistance and virulence genes. International Journal of Food Microbiology2008; 124 (3): 217- 23.

(13)           Randall LP., Cooles SW., Osborn MK., Piddock LJ., Woodward MJ. Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonellaenterica isolated from humans and animals in the UK. Journal of Antimicrobal Chemotherapy 2004; 53 (2): 208- 16.

(14)           Toro CS., Farfán M., Contreras I., Flores O., Navarro N., Mora GC., et al. Genetic analysis of antibiotic-resistance determinants in multidrug-resistant Shigella strains isolated from Chilean children. Epidemiology & Infection 2005; 133 (1): 81- 6.

(15)           Mammeri H., Van De Loo M., Poirel L., Martinez-Martinez L., Nordmann P. Emergence of plasmid-mediated quinolone resistance in Escherichia coli in Europe. Antimicrobal Agents and Chemotherapy 2005; 49 (1): 71- 6.

(16)           Mendes RE., Kiyota KA., Monteiro J., Castanheira M., Andrade SS., Gales AC., et al. Rapid detection and identification of metallo-beta-lactamase-encoding genes by multiplex real-time PCR assay and melt curve analysis. Journal of Clinical Microbiology2007; 45 (2): 544- 7.

(17)           Woodford N., Ellington MJ., Coelho JM., Turton JF., Ward ME., Brown S., et al. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. International Journal of Antimicrobial Agents 2006; 27 (4): 351- 3.

(18)           Garnacho-Montero J., Amaya-Villar R. Multiresistant Acinetobacter baumannii infections: epidemiology and management. Current Opinionin Infectious Diseases 2010; 23 (4): 332- 9.

(19)           Van Looveren M., Goossens H.; ARPAC Steering Group. Antimicrobial resistance of Acinetobacter spp. in Europe. Clinical Microbiology and Infectious 2004; 10 (8): 684- 704.

(20)           Karlowsky JA., Draghi DC., Jones ME., Thornsberry C., Friedland IR., Sahm DF. Surveillance for antimicrobial susceptibility among clinical isolates of Pseudomonas aeruginosa and Acinetobacter baumannii from hospitalized patients in the United States, 1998 to 2001. Antimicrobal Agents and Chemotherapy 2003; 47 (5): 1681- 8.

(21)           Ayan M., Durmaz R., Aktas E., Durmaz B. Bacteriological, clinical and epidemiological characteristics of hospital-acquired Acinetobacterbaumanniiinfection in a teaching hospital. Journal of Hosptal Infection 2003; 54 (1): 39- 45.

(22)           Basustaoglu AC., Kisa O., Sacilik SC., Ozyurt M., Yildiran ST. Epidemiological characterization of hospital-acquired Acinetobacterbaumannii isolates from a 1500-bed teaching hospital by phenotypic and genotypic methods. Journal of Hosptal Infection2001; 47 (3): 246- 7.

(23)           Smolyakov R., Borer A., Riesenberg K., Schlaeffer F., Alkan M., Porath A., et al. Nosocomial multi-drug resistant Acinetobacterbaumannii bloodstream infection: risk factors and outcome with ampicillin-sulbactam treatment. Journal of Hosptal Infection 2003; 54 (1): 32- 8.

(24)           Wang SH., Sheng WH., Chang YY., Wang LH., Lin HC., Chen ML., et al. Healthcare-associated outbreak due to pan-drug resistant Acinetobacter baumannii in a surgical intensive care unit. Journal of Hosptal Infection 2003; 53 (2): 97- 102.

(25)           Mirnejad R., Mostafavi S., Masjedian F. Role of Class 2 Integron in Antibiotic Susceptibility Pattern of Acinetobacter baumannii Strains Isolated from Hospitals in Tehran. Scientific Journal of Hamadan University of Medical Sciences 2012; 18 (4): 22- 9.

(26)           Baran G., Erbay A., Bodur H., Ongürü P., Akinci E., Balaban N., et al. Risk factors for nosocomial imipenem-resistant Acinetobacterbaumannii infections. International Journal of Infectious Diseases2008; 12 (1): 16- 21.

(27)           Cai Y., Chai D., Wang R., Liang B., Bai N. Colistin resistance of Acinetobacter baumannii: clinical reports, mechanisms and antimicrobial strategies. Journal ofAntimicrobial Chemotherapy2012; 67 (7): 1607- 15.

(28)           Karbasizade V., Heidari L. Antimicrobial Resistance of Acinetobacter Baumannii Isolated from Intensive Care Units of Isfahan Hospitals, Iran. Journal of Isfahan Medical School 2012; 30 (191): 759- 63.

(29)           Talebi-Taher M., Latifnia M., Javad-Moosavai SA., Adabi M., Rastgar Lari A., Abdizadeh MF., et al. Risk factors and antimicrobial susceptibility in ventilator associated pneumonia: a brief report. Tehran University Medical Journal2012; 70 (9): 577- 82.

(30)           Nemec A., Dolzani L., Brisse S., van den Broek P., Dijkshoorn L. Diversity of aminoglycoside-resistance genes and their association with class 1 integrons among strains of pan-European Acinetobacterbaumannii clones. Journal of Medical Microbiology 2004; 53 (Pt 12): 1233- 40.

(31)           Farahani Kheltabadi R., Moniri R., Shajari GR., Nazem Shirazi MH., Musavi SGA., Ghasemi A., et al. Antimicrobial Susceptibility patterns and the distribution of resistance genes among Acinetobacter species isolated from patients in shahid Beheshti hospital, Kashan. Feyz Journal of Kashan University of Medical Sciences 2009; 12 (4): 61- 7.