جداسازی و شناسایی باکتری‏ های مولد بیوپلیمر پلی‏ هیدروکسی‏ آلکانوآت از خاک‏ های آلوده به نفت منطقه مسجد سلیمان و بهینه‏ سازی شرایط تولید

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 دانشیار زیست شناسی، دانشگاه آزاد اسلامی، واحد جهرم، جهرم، ایران

2 کارشناس ارشد میکروبیولوژی، دانشگاه آزاد اسلامی، واحد جهرم، جهرم، ایران

3 دانشیار میکروبیولوژی، دانشگاه شهید چمران، اهواز، ایران

چکیده

مقدمه: پلی هیدروکسی‏آلکانوآت (PHA)از جمله پلیمرهای زیست تخریب پذیر است که توسط باکتری‏ها تولید می‏شود و کاربرد آن به‏جای پلاستیک‏های پتروشیمیایی می‏تواند موجب کاهش آلودگی محیط زیست شود. هدف از پژوهش حاضر، جداسازی و شناسایی باکتری‏های مولد PHA از ناحیه نفتی مسجدسلیمان، تعیین درصد PHA تولیدی توسط این باکتری‏ها، تعیین شرایط بهینه دما، اسیدیته، غلظت و نوع منابع کربن و نیتروژن بر میزان سنتز PHA و امکان استفاده از پسماندهای نفتی به عنوان بستر ارزان قیمت کربن برای سنتز PHA توسط باکتری‏های جداشده است‏‏.
مواد و روش‏‏ها: در ابتدا 9 نمونه خاک از چهار ناحیه آلوده به نفت مسجدسلیمان برداشت شد و غربال‏گری اولیه با استفاده از محیط MSM در دمای 28 درجه سانتی‏گراد انجام گرفت. جدایه‏ها از نظر تولید PHA با استفاده از رنگ آمیزی سودان سیاه تایید و با استفاده از آزمون‏‏های فنوتیپی و تعیین توالی 16SrRNA تعیین هویت شدند. بهینه‏سازی ‏دما، اسیدیته، منابع کربن و نیتروژن برای رشد باکتری‏ها نیز انجام شد.
نتایج: در این پژوهش، 11 جدایه مولد PHA شناسایی شد که از بین آن‏ها جدایه MIS-1 با 522/58 درصد وزن خشک سلولی بیش‏ترین میزان PHA را تولید می‏کرد. این جدایه بر اساس ویژگی‏های فنوتیپی و بررسی توالی
16S rRNA با 95 درصد شباهت متعلق به گونه Pseudomonasaeruginosaتشخیص داده شد. به‏علاوه نتایج آزمون‏‏های بهینه‏سازی نشان داد که این جدایه در دمای 37 درجه سانتی‏گراد، اسیدیته 7، گلوکز به عنوان منبع کربن، سولفات آمونیوم به عنوان منبع نیتروژن و در نهایت، غلظت 10 گرم بر لیتر منبع کربن و غلظت 5/0 گرم بر لیتر منبع نیتروژن بالاترین میزان PHA را سنتز می‏کند.
بحث و نتیجه‏ گیری: نتایج این پژوهش نشان می‏دهد که خاک های آلوده به نفت منطقه مسجدسلیمان به علت آلودگی طولانی مدت و میزان کربن بالا، زیستگاه مناسبی برای غربال‏گری باکتری‏های مفید از جمله مولد PHA هستند.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Isolation and identification of PHA producing bacteria from oil contaminanted soils in Masjed Soleiman and optimization of producing conditions

نویسندگان [English]

  • Farshid Kafilzadeh 1
  • Armaghan Parto 2
  • Hossein Motamedi 3
1 Associate Professor of Biology, Jahrom Branch, Islamic Azad University, Jahrom, Iran
2 M.Sc. of Microbiology, Jahrom Branch, Islamic Azad University, Jahrom, Iran
3 Associate Professor of Microbiology, Shahid Chamran University, Ahvaz, Iran
چکیده [English]

Introduction:Polyhydroxyalkanoate (PHA) is counted biodegradable polymer, produced by bacteria, which is employed instead of petrochemical plastics, to reduce environment pollution. The purpose of this study is the isolation and identification of the PHA producing bacteria in Masjed-Soleiman oil fields, determination of PHA produced by the bacteria, determine the optimal conditions of temperature, pH, concentration and type of carbon and nitrogen sources on the level of PHA synthesis and the use of waste oil as a cheap substrate of carbon for the synthesis of PHA by isolated bacteria.
Materials and methods: At first 9 samples of soil contaminated with crude oil, from 9 points at 4 well sites in Masjed-Soleiman oil field were taken. The initial screening was done by MSM at the temperature of 28 °C. Isolates from the view point of producing PHA, were confirmed, by using Sudan black stain and were identified by using phenotypical tests and 16S rRNA sequence determination. Also, optimization of temperature, pH, carbon and nitrogen sources were made for bacteria growth.
Results: In this study eleven isolates were identified as PHA producers and among them the highest range belongs to MIS-1 strain by the range of 58.522 percent of the cellular dry waight, wich produces the maximum PHA. This isolate is recognized as the species of pseudomonas aeroginosa according to the phenotypic tests and sequence analysis of 16S rRNA with 95 % similarity. In addition, the results of optimization tests showed that, the isolates in the temperature of 37 °C, pH7, glucose as the source of carbon and ammonium sulphate as the source of nitrogen and finally, concentration of 10 g/lit of the carbon source and 0.5 g/lit of nitrogen source, the highest range of PHA was synthesized.
Discussion and conclusion: The results of this research show that the soil polluted with crude oil of Masjed- Soleiman oil field, in long term and also due to high rate of carbon, provides a suitable environment for screening of beneficial bacteria such as PHA producing bacteria.

کلیدواژه‌ها [English]

  • Polyhydroxyalkanoate (PHA)
  • Mineral salt medium )MSM(
  • Pseudomonas aeruginosa
  • Masjed Soleiman

مقدمه

امروزه مصرف پلاستیک‏های پتروشیمیایی به ‏علت دوام طولانی مدت‏ و اثرات مضرشان در محیط زیست سبب ایجاد نگرانی‏های عمومی شده‏اند. به همین علت تمایل به استفاده از مواد تجزیه پذیر زیستی برای ساخت پلاستیک‏های تجزیه‏پذیر زیستی افزایش یافته است. از بین مواد تجزیه‏پذیر نام‏برده پلی‏هیدروکسی‏آلکانوآت[1]
(PHA) کاربرد بیشتری دارد (1). PHA توسط میکروارگانیسم‏های مختلف تحت شرایط کاهش عناصر غذایی ضروری مانند‏: نیتروژن‏، فسفر، گوگرد، اکسیژن مولکولی و یا منیزیم در حضور مقادیر در خور توجهی از کربن ساخته می‏شود و به شکل گرانول‏هایی در سیتوپلاسم سلول باکتریایی ذخیره می‏شود (2).

در حدود 300 گونه باکتری مختلف این پلیمر تخریب پذیر زیستی و سازگار با محیط زیست با وزن مولکولی 105×2 و106×3 دالتون را تولید می‏کنند (3). PHA یکی از مهم‏ترین انواع پلیمرهای زیستی است که نخستین بار در Bacillus megaterium کشف شد و تا کنون بیش از 150 جزو مونومری متفاوت از آن یافت شده است (4). میزان سنتز PHA به نوع باکتری، شرایط رشد آن، بستر مناسب، منبع کربن مناسب و نسبت بالای کربن به نیتروژن بستگی دارد. باکتری‏هایی که در خاک مناطق آلوده وجود دارند به علت افزایش آلودگی در این محیط‏ها از آلاینده‏ها به عنوان غذا بهره برده و میزان زیادی PHA تولید می‏کنند (3). PHA تولیدی باکتری‏ها در صنایع، فارماکولوژی، پزشکی و تولید زیست سوخت‏ها کاربرد دارد. هزینه بالای تولید PHA که مربوط به بستر و منبع کربن آن است موجب شده که تولید PHA با پیشرفت کندی همراه باشد. بنابراین، نخستین قدم برای تولید میزان مناسب PHA استفاده از محیط کشت ارزان قیمت و فرآیندهای تخمیری مناسب است. به‏همین علت از منابع ارزان قیمت کربن نظیر پساب‏ها، روغن‏های گیاهی، اسیدهای چرب، آلکان‏ها، کربوهیدرات‏ها و مواد زاید کشاورزی، شیره نیشکر، ملاس چغندر، زباله‏های کشاورزی و صنعتی، روغن‏ها، پسماند روغن‏های سرخ کردنی و روغن‏های نباتی تصفیه نشده استفاده می‏شود (5). منطقه مسجدسلیمان نخستین منطقه نفت خیز کشور است که با توجه به سابقه طولانی کشف و استخراج نفت از آن دارای آلودگی طولانی مدت است. بنابراین، باکتری‏های ساکن این منطقه گزینه‏های مناسبی برای تولید PHA به نظر می‏رسند. هدف از پژوهش حاضر جداسازی و شناسایی باکتری‏های مولد PHA از خاک منطقه نفتی مسجد سلیمان، بهینه‏سازی شرایط تولید بهترین جدایه‏ و امکان استفاده از پسماندهای نفتی به‏عنوان بستر ارزان قیمت کربن برای سنتز PHA توسط باکتری‏های جداشده است. از سوی دیگر تاکنون پژوهشی پیرامون این موضوع بر روی خاک آلوده به نفت در مسجدسلیمان انجام نشده است.

 

.مواد و روش‏ها

نمونه برداری: به منظور نمونه‏برداری از خاک آلوده به نفت، سه محل مربوط به چاه نفت مهار شده و یک محل در واحد بهره برداری برای نمونه‏برداری به شرح زیر انتخاب شد:

محل اول به نام چاه سی برنچ، شامل دو ایستگاه؛ محل دوم به نام چاه شماره‏ 132، شامل دو ایستگاه؛ محل سوم به نام چاه شماره 127، شامل دو ایستگاه و محل چهارم به نام واحد شماره‏ی 9 شامل سه ایستگاه است (در مجموع 9 نمونه خاک). در تمامی ایستگاه‏های یاد شده نمونه‏برداری از یک سانتی‏متری سطح رویی خاک انجام شد و هر یک از نمونه‏ها به شکل جداگانه در ظروف استریل مخصوص نمونه‏برداری به آزمایشگاه منتقل شدند.

غربال‏گری باکتری‏های مولد PHA: برای جداسازی باکتری‏های تولید کننده PHA ازمحیط پایه نمکی[2] استفاده شد (6) و به منظور تشخیص تولید PHA از رنگ‏آمیزی سودان سیاه استفاده شد (7).

تعیین میزان درصد PHA تولیدی: برای آماده کردن بیومس سلولی، ابتدا محیط کشت باکتری در دور
rpm 4000 سانتریفیوژ و رسوب حاصل از این عمل در دمای 160 درجه سانتی‏گراد خشک و وزن آن با استفاده از ترازو محاسبه شد (8). سپس، استخراج PHA با استفاده از روش سدیم هیپوکلریت و کلروفرم انجام، وزن آن توسط ترازو سنجیده و درصد PHA تولیدی توسط هر جدایه با استفاده از فرمول زیر محاسبه شد (9):

درصد  PHAتولیدی = (جرم PHA برحسب گرم × 100) / جرم بیومس بر حسب گرم

شناسایی باکتری‏های تولید کننده PHA: جدایه‏های تولید کننده PHA ابتدا بر اساس ویژگی‏های فنوتیپی شامل رنگ آمیزی، آزمون‏‏های آنزیمی و آزمون‏‏های بیوشیمیایی در حد جنس شناسایی شد. سپس، با استفاده از روش مولکولی توسط کیت استخراج شرکت سیناژن DNA آن‏ها استخراج و به منظور بررسی کیفیت و غلظت DNA استخراج شده، 3 میکرولیتر از ژنوم مورد نظر بر روی ژل آگاروز یک درصد با ولتاژ 85 ولت به مدت 45 دقیقه ژل الکتروفورز شد. عکس ژل پس از الکتروفورز توسط دستگاه ژل داک تهیه شد. واکنش‏های PCR با استفاده از پرایمرهایFD1 و RP1 انجام شد (جدول‏های 1 و 2) و با بردن بخشی از مخلوط واکنشی تکثیر شده بر روی ژل آگاروز در ولتاژ 85 ولت به مدت 45 دقیقه بررسی شد. سرانجام محصول PCR توسط شرکت تگ کوپن هاگن[3] (دانمارک) تعیین توالی شد و توالی به‏دست‏آمده با مقایسه با داده‏های موجود در بانک ژن مرکز NCBI شناسایی شد.

 

 

جدول 1- توالی پرایمرهای عمومی 16S rRNA

´3                              توالی                            ´5

پرایمرها

CCGAATTCGTCGACAACAGAGTTTGATCCTGGC

FD1

CCCGGGATCCAAGCTTACGGTTACCTTGTTACG

RP1

 

جدول 2- مراحل انجام PCR

چرخه

مراحل

دما

(درجه سانتی‏گراد)

مدت زمان

تعداد چرخه‏ها

اول

واسرشتگی ابتدایی ژنوم

94

3 دقیقه

1

دوم

واسرشتگی ژنوم

94

1 دقیقه

30

اتصال

64

30 ثانیه

گسترش

72

2 دقیقه

سوم

گسترش نهایی

72

20 دقیقه

1

 


 

 

 

 

.طراحی آزمایش و بهینه‏سازی فرآیند سنتز PHA: براساس بازده تولیدPHA، بهترین جدایه انتخاب شد و شرایط بهینه به منظور تولید PHA برای آن بررسی شد. برای این منظور شرایط بهینه رشد جدایه‏ منتخب از نظر اسیدیته (4، 7، 10 و 11) و دمای انکوباسیون (25، 37 و 42 درجه سانتی‏گراد) بررسی شد (12) و منحنی رشد باکتری در این شرایط به منظور بررسی میزان سنتز PHA در فازهای مختلف رشد در مدت زمان 11 ساعت در طول موج 650 نانومتر ترسیم شد. سپس از پساب نفتی و آمونیاک به ترتیب به عنوان منابع کربن و نیتروژن استفاده شد و غلظت بهینه این ترکیب برای رشد سویه برتر به‏دست آمد. به‏منظور پی‏بردن به غلظت بهینه منابع کربن و نیتروژن غلظت‏های 9، 10 و 5/10 گرم بر لیتر گلوکز و 2/0، 5/0 و 7/0 گرم بر لیتر سولفات آمونیوم استفاده شد (13 و 14). بدین صورت که با ثابت نگه داشتن یک عامل، غلظت‏های مختلف عامل دوم بررسی و سپس اثر متقابل غلظت دو منبع نیتروژن و کربن بر رشد باکتری سنجیده شد. در این شرایط رشد جدایه MIS-1 به مدت 11 ساعت بررسی شده و منحنی آن ترسیم شد.

تحلیل آماری: با استفاده از آزمون‏های آماری تجزیه واریانس (ANOVA) و دانکن (Duncan) اختلاف میانگین‏ها از نظر معنا‏دار بودن یا نبودن بررسی شد.

 

.نتایج

جداسازی و رنگ آمیزی باکتری‏ها: در غربال‏گری اولیه و کشت نمونه‏ها در محیط پایه MSM، 16 جدایه باکتریایی رشد کرد. این جدایه‏ها تحت رنگ آمیزی سودان سیاه قرار گرفتند و از بین آن‏ها 11 جدایه تولید کننده PHA تشخیص داده شد. شکل‏های 1 و 2 نتایج رنگ‏آمیزی گرم و سودان سیاه جدایه MIS-1 را نشان می‏دهند.

تعیین میزان درصد تولید PHA: درصد PHA تولید شده توسط جدایه‏ها با روش سدیم هیپوکلریت و کلروفرم مطابق با جدول 3 تعیین شد.

 

 

 

شکل1- رنگ آمیزی گرم جدایهMIS-1                          شکل2- رنگ آمیزی سودان سیاه جدایه MIS-1

 

 

جدول 3- میانگین PHA تولید شده (گرم/جرم بیومس) توسط جدایه‏های باکتریایی

سویه

MIS-1

MIS-2

MIS-3

MIS-4

MIS-5

MIS-6

MIS-7

MIS-8

MIS-9

MIS-10

MIS-11

میزان درصد PHA تولید شده

522/58

891/57

553/41

701/49

612/49

650/50

332/56

086/52

733/52

016/40

703/53

 

با توجه به جدول بالا سویه MIS-1 با تولید PHA معادل 522/58 درصد وزن خشک سلولی بالاترین بازده تولید PHA را دارد. میانگین تولید PHA توسط این سویه اختلاف معنا‏داری را در سطح 5 درصد آزمون دانکن با سایر سویه‏ها نشان داد.

نتایج آزمون‏‏های فنوتیپی و بیوشیمیایی: آزمون‏‏های فنوتیپی، معرف باکتری با کلونی شیری رنگ، سطح صاف، حاشیه کامل، محدب و گرد، کاتالاز مثبت، اکسیداز مثبت، متحرک، ایندول منفی، مانیتول منفی و اکسیداتیو بود که نشان دهنده‏ گونه‏ای از جنس Pseudomonasاست.

نتایج آزمون‏‏های مولکولی: نتایج تحلیل BLASTn با مقایسه توالی DNA جدایه مورد بررسی (جدول 4) با توالی‏های موجود در بانک ژنی جهانی، این جدایه را با 95 درصد شباهت سویه‏ای از گونه Pseudomonas aeruginosaتشخیص داد و سویه MIS-1نام گرفت (جدول 5). شکل 3 فرآورده 1500bp حاصل از تکثیر این ژن را نشان می‏دهد.

منحنی رشد جدایه MIS-1 (شکل 4) در طول موج 650 نانومتر نشان داد که این باکتری با فاز تاخیری 4 ساعته شروع به رشد کرده و طی ساعت های 4 تا 8 از منحنی رشد به حد اکثر رشد خود رسیده است و سپس، تا ساعت دهم وارد فاز سکون شد و در این فاز باقی می‏ماند. این منحنی رشد مربوط به دمای 37 درجه سانتی‏گراد، اسیدیته 7، 10 گرم بر لیتر گلوکز به عنوان منبع کربن و 5/0 گرم بر لیتر سولفات آمونیوم به عنوان منبع نیتروژن است که همان شرایط بهینه است.

 

 

جدول 4- توالی ژنی جدایه مورد بررسی

CTCACCTGATCACCCTGGTCATCAAGCAGCAGAGCGACGCTCAGGCACGCCAACTCATGGACCAGGAAGTT

 

جدول 5- نتیجه بلاست ژنوم 16S rRNA تکثیر یافته جدایه MIS-1 پس از تعیین توالی

Max ident

E value

Query converting

Total score

Max score

Description

Accession

95%

0/0

92

106

106

Pseudomonas aeruginosa strain MTB-1

CP-006853. 1

 

 

 

شکل 3- الکتروفورز محصول PCR جدایه MIS-1

1: مارکر (وزن مولکولی kb 1) 2: فرآورده حاصل از تکثیر ناحیه 16S rRNA

 

 

 

شکل 4- منحنی رشد جدایه MIS-1 در مدت 11 ساعت

 

نتایج بهینه‏سازی دما و اسیدیته (جدول 6) و به‏علاوه نوع منابع کربن و نیتروژن (جدول 7) و غلظت این منابع (جدول‏های 8 و 9) نشان داد که Pseudomonas aeruginosaسویه MIS-1 در دمای 37 درجه سانتی‏گراد و اسیدیته 7، غلظت بالای منبع کربن و غلظت پایین منبع نیتروژن و استفاده از گلوکز و سولفات آمونیوم به ترتیب به عنوان منابع کربن و نیتروژن، مطابق با محیط MSM (یعنی 10 گرم بر لیتر گلوکز و 5/0 گرم بر لیتر سولفات آمونیوم)، بالاترین میزان PHA خود را که معادل 522/58 درصد وزن خشک سلولی است (نسبت به سایر متغیرها) سنتز می‏کند. بررسی منحنی رشد این باکتری در این دو محدوده‏ دمایی و اسیدیته نشان داد که باکتری در شرایط یاد شده مدت زمان بیشتری در فاز ایستا در مقایسه با دمای 25 و 42 درجه سانتی‏گراد و اسیدیته 4 و 10 باقی ماند (شکل 5). به‏علاوه در تمام موارد یاد شده آزمون دانکن اختلاف معنا‏داری را در سطح 5 درصد بین میانگین‏ها نشان داد.

 

جدول 6- بهینه‏سازی ‏اسیدیته و دما برای جدایه MIS-1 از نظر درصد تولید PHA

 

دمای25

دمای37

دمای42

اسیدیته 4

اسیدیته 7

اسیدیته 10

درصد PHA تولیدی

903/44

522/58

120/41

812/36

522/58

006/41


جدول 7- نتایج بهینه‏سازی ‏منابع کربن و نیتروژن به روش تک عاملی برای سنتزPHA توسط جدایه MIS-1

متغیرها

نوع منبع

درصد PHA سنتز شده

منبع کربن و نیتروژن (محیطMSM)

گلوکز و سولفات آمونیوم

522/58

منبع کربن

پساب نفتی و سولفات آمونیوم

035/57

منبع نیتروژن

آمونیاک و گلوکز

103/36

منبع کربن و نیتروژن

پساب نفتی و آمونیاک

730/50

 

جدول 8- نتایج بهینه‏سازی ‏غلظت منابع کربن و نیتروژن برای سنتزPHA توسط جدایه 1MIS-

منبع کربن

غلظت منابع (گرم بر لیتر)

میزان PHAسنتز شده (درصد)

گلوکز

9

556/46

10

522/58

5/10

013/63

منبع نیتروژن

سولفات آمونیوم

2/0

417/57

5/0

522/58

7/0

061/53

 

جدول 9- نتایج بهینه‏سازی ‏غلظت منابع کربن و نیتروژن به روش دو عاملی برای سنتز PHA توسط جدایه MIS-1

نوع منبع

غلظت

درصدPHAسنتز شده

گلوکز

9

12/36

سولفات آمونیوم

7/0

گلوکز

5/10

40/48

سولفات آمونیوم

2/0

گلوکز

9

10/25

سولفات آمونیوم

2/0

گلوکز

5/10

95/41

سولفات آمونیوم

7/0

 

 

 

شکل 5- منحنی رشد جدایه MIS-1 در شرایط بهینه‏سازی ‏دما و اسیدیته به مدت 11 ساعت

 


.بحث و نتیجه ‏‏گیری

مسجدسلیمان واقع در شمال شرقی خوزستان، نخستین منطقه نفتی ایران است و دارای چاه‏های مهار شده بسیاری است. آلودگی‏های نفتی بسیاری در خاک اطراف و در مجاورت این مکان‏ها مشاهده می‏شود. به‏همین علت در این پژوهش، از خاک چهار ناحیه آلوده به نفت مسجدسلیمان نمونه‏برداری شد.

در نتیجه غربال‏گری خاک‏های آلوده به نفت منطقه مسجدسلیمان سویه‏های تولید‏کننده PHA که تولیدکنندگان مناسبی بودند جداسازی شد. به‏علت این‏که آلودگی نفتی از مدت‏ها قبل در این ناحیه وجود داشته و نسبت کربن به نیتروژن در خاک این منطقه افزایش بیش از حدی داشته است (6)، زمینه رشد باکتری‏ها فراهم نشده و در نتیجه سویه‏های انتخاب شده توانایی استفاده از کربن و ذخیره‏سازی ‏آن به فرم PHA را دارند. مطالعات دیگر پژوهشگران نیز نشان می‏دهد که نواحی آلوده به نفت از مکان‏های مناسبی برای کلونیزه‏شدن و تکثیر باکتری‏های مولد PHA هستند. چی[iv] و همکاران با بررسی خاک‏های آلوده نفتی حاشیه ریل راه‏آهن دریافتند که باکتری‏های موجود در این خاک‏ها قادر به سنتز PHA هستند و سودوموناس را در زمره این باکتری‏ها نام بردند (15). نیرو اندا[v] نیز بستر نفتی را به عنوان بستر مناسب برای سنتز PHA توسط باکتری معرفی کردند (11). دانشی[vi] و همکاران پی‏بردند که باکتریCupriavidus necatorدر محیط ارزان قیمت عصاره ذرت قادر به سنتز PHA است (16). ماتسوموتو[vii] و همکاران طی بررسی توانایی تولید PHA توسط 2-4 Cupriavidus sp. USMAAدر بسترهای ارزان قیمت پی بردند این باکتری در محیط حاوی روغن نخل خرما می‏تواند PHA را سنتز کند (17). به‏علاوه تیرومالا و ردی[viii] طی استفاده از لجن فعال به عنوان محیط کشت ارزان قیمت نشان دادند
Bacillus sp در این محیط قادر به سنتز PHA خواهد بود (18).

در پژوهش جاری بر اساس رنگ آمیزی سودان سیاه و آزمون‏ تعیین درصد PHA تولیدی توسط روش سدیم هیپوکلریت و کلروفرم، جدایه MIS-1 با تولید 522/58 درصد PHA، بالاترین درصد را در بین سایر سویه‏ها دارا بود. چن[ix] و همکاران نیز از روش یاد شده استفاده و 32 جدایه را شناسایی کردند که قادر به سنتز PHA بودند. بالاترین میزان سنتز PHA در بین این جدایه‏ها 63/74 درصد وزن خشک سلول به‏دست آمد (19). کاست[x] با بهره گیری از لجن فعال، زباله‏های تخمیری و روغن‏های سرخ کردنی نشان داد که سودوموناس آئروژینوزا در این بستر‏ها قادر است 571/53 درصد PHA سنتز کند (20).

مطالعه حاضر نخستین مطالعه در منطقه آلوده به نفت مسجدسلیمان است که به جداسازی باکتری‏های مولد PHA پرداخته و سودوموناس آئروژینوزا سویه MIS-1 نخستین جدایه تولیدکننده قوی PHA گزارش‏شده از این منطقه است.

سیهان و ازدمیر[xi] نشان دادند که Enterobacter aerogenes Bi 12 در بستری از فاضلاب خانگی در بازه زمانی 18 ساعت، می‏تواند 66/16 تا 25/96 درصد PHA را سنتز کند (21). بررسی حاضر نشان می‏دهد که باکتری سودوموناس آئروژینوزا قادر به سنتز PHA در خاک آلوده به نفت بوده و می‏تواند در خاک آلوده به نفت مسجدسلیمان تا 522/58 درصد وزن خشک خود PHA سنتز کند. وانگ و نومورا[xii] بیان کردند که Pseudomonas putida KT2442وهمچنین، aeroginosa Pseudomonas دارای واحد تنظیمی خاصی هستند که آن‏ها را قادر به استفاده از گلیسرول به عنوان منبع کربن نموده و تا 80 درصد وزن خشک خودPHA تولید می‏کنند (22). منحنی رشد جدایه MIS-1 نشان داد که این جدایه سنتز PHA را در فاز لگاریتمی آغاز می‏کند و حداکثر فعالیت آن در فاز ایستا مشاهده می‏شود. این نتایج با نتایج بیشتر مطالعات مطابقت دارد. هوک[xiii] سویه‏های سنتزکننده PHA را جدا کرد که مشابه سویه MIS-1 در فاز ایستا حداکثر میزان PHA را سنتز می‏کرد (23). جیانگ[xiv] و همکاران با بررسی بر روی تولید مقادیر بالایی از PHA توسط Pseudomonas fluorescens سویه A2a5 از سوبسترای ارزان قیمت نظیر عصاره نیشکر، از دامنه دمایی 15 تا 30 درجه سانتی گراد استفاده کردند و دمای بین 20 تا25 درجه سانتی‏گراد را به‏عنوان دمای بهینه به‏کار بردند (24). وانگ و نومورا دریافتند دمای بهینه رشد برای Pseudomonas putida KT2440، 30 درجه سانتی‏گراد است (22). وانگ و همکاران با بررسی بر روی توانایی و میزان سنتز PHA توسط Pseudomonas putida KT2442به این نتیجه رسیدند که از بین سه دمای 25، 30 و 42 درجه سانتی‏گراد، این باکتری در دمای 30 درجه سانتی گراد حداکثر میزان PHA را تولید می‏کند و این دما را به‏عنوان دمای بهینه لحاظ کردند (25). نتایج پژوهش حاضر نشان داد دما و اسیدیته دو عامل مهم و تاثیرگذار در امر سنتز PHA در سویهMIS-1 است. در بهینه‏سازی دما و اسیدیته، دمای 37 درجه سانتی‏گراد و اسیدیته 7 بهترین شرایط برای رشد جدایه منتخب تشخیص داده شد. با تغییر این دو عامل نتایجی متفاوت با نتیجه آزمایش در شرایط بهینه حاصل شد که به مراتب تولید PHA کمتر بود. برای بهینه‏سازی ‏منابع کربن و نیتروژن، پساب نفتی به عنوان منبع کربن جایگزین گلوکز و آمونیاک به‏عنوان منبع نیتروژن جایگزین سولفات آمونیوم در تولید PHA شد. این بررسی به صورت یک عاملی و دو عاملی انجام شد که طی آن با تغییر هریک از متغیر‏ها میزان PHA سنتز شده سنجیده شد. نتایج نشان داد، زمانی‏که از پساب نفتی به عنوان منبع کربن استفاده شد بدون تغییر در منبع نیتروژن موجود در محیط کشت حداقل نمکی، سویه MIS-1 توانست حداکثر میزان PHA را سنتز کند. هنگامی‏که از آمونیاک به عنوان منبع نیتروژن استفاده شد، میزان PHA سنتز شده در این جدایه کاهش چشم‏گیری را نشان داد. به‏علاوه تغییر هم‏زمان این دو منبع نیز نشان داد که گلوکز و سولفات آمونیوم منابع کربن و نیتروژن مناسب برای تولید PHA توسط این باکتری هستند.

امیرلو[xv] و همکاران طی بررسی بر روی توانایی سنتز PHA توسط باکتری CupriavidusسویهUSMAA39-9 به این نتیجه رسیدند که از بین محیط‏هایی که بوتیرولاکتون به همراه 1و 4 بوتان دیول، اسید اولئیک به همراه 1– پنتانول، اسید اولئیک به همراه 1- پنتانول، 1 و 4 بوتان دیول به همراه 1- پنتانول هر کدام به عنوان منبع کربن استفاده کردند، بالاترین درصد PHA زمانی سنتز می‏شود که 1 و 4 بوتان دیول و
1- پنتانول تواما به عنوان منبع کربن استفاده شده باشند (26). افزون بر این، زو[xvi] و همکاران به منظور بهینه‏سازی ‏شرایط سنتز PHAتوسطBurkholderia sepacia ATCC17759 از منابع کربن گزیلوز، لاکتوز، گلوکز و گلیسرول استفاده کردند و در هر مرحله با درصد متفاوتی از PHA تولیدی مواجه شدند و در نهایت، به این نتیجه رسیدند که در محیطی که گلیسرول به عنوان منبع کربن استفاده شد این سویه باکتری توانست حداکثر میزان PHA را سنتز کند (27). یانگ[xvii] و همکاران به منظور بهینه‏سازی ‏منبع کربن از استات، پروپیونات و بوتیرات استفاده کردند و درصد PHA تولیدی در هر یک از محیط‏ها را سنجیدند و به این نتیجه رسیدند که در محیط حاوی بوتیرات حداکثر میزان PHA سنتز شد (1). بررسی حاضر نشان می‏دهد که بهینه‏سازی ‏منابع کربن و نیتروژن می‏تواند بر میزان سنتز PHA در باکتری‏های مختلف از جمله سودوموناس آئروژینوزا جدا شده از خاک آلوده به نفت اثر مستقیمی را بر جای بگذارد که در باکتری‏های مختلف بر اساس نوع منبع می‏تواند باعث کاهش و یا افزایش سنتز PHA شود. وانگ و همکاران طی پژوهش روی باکتری Pseudomonas putida و تولید PHA بر روی محیط حاوی هپتانوات به عنوان منبع کربن توسط این باکتری به این نتیجه رسیدند که هنگامی که مقدار هپتانوات 10 گرم بر لیتر باشد 53 درصد PHA و هنگامی که مقدار هپتانوات به کار رفته در محیط کشت باکتری 8/5 گرم بر لیتر باشد 37 درصد PHA سنتز خواهد شد که خود حاکی از تاثیر گذاری غلظت منبع کربن بر سنتز PHA است (25). کیم‏‏دو[xviii] و همکاران طی بررسی تاثیرگذاری غلظت گلوکز به عنوان منبع کربن در باکتری Pseudomonas putida KTMQ01، این منبع کربن را در دو غلظت 26/1 و 7/2 گرم به کار بردند و ثابت کردند هنگامی این باکتری قادر است مقدار بیشتری PHA را سنتز کند که غلظت بیشتری از گلوکز در محیط کشت آن موجود باشد (28). در بررسی حاضر با افزایش و کاهش دادن منابع کربن و نیتروژن بهینه، میزان PHA سنتزشده با میزان سنتز بهینه سنجیده شد. همان‏طور که انتظار می‏رفت، نتایج نشان داد که سویهMIS-1، با افزایش غلظت گلوکز و کاهش میزان سولفات آمونیوم به طور جداگانه و توام، میزان درصد PHA بالاتری را سنتز می‏کند. از این رو برای افزایش بازدهی PHA در این باکتری‏ها می‏توان غلظت منبع کربن را افزایش و غلظت منبع نیتروژن را تا حد معینی کاهش داد. اگر افزایش یا کاهش از حد معینی تجاوز کند انتظار می‏رود میزان سنتز PHA کاهش یابد.

با توجه به نتایج مطالعه حاضر می‏توان بیان کرد که خاک‏های آلوده به نفت به علت عدم توازن نسبت کربن به نیتروژن یک شرایط انتخابی برای غنی‏سازی باکتری‏های مولد PHA هستند. بنابراین، پژوهش در خصوص جداسازی باکتری‏های مولد PHA از این مناطق می‏تواند به نتایج ارزشمند و در خور توجهی بیانجامد. باکتری Pseudomonas aeruginosa MIS-1جداشدهدر این پژوهش با بازده 522/58 درصد تولید PHA توانست درحضور منابع کربن و نیتروژن ارزان قیمت و در دسترس یعنی گلوکز و سولفات آمونیوم، مقدار قابل توجهی از این پلیمر تجزیه‏پذیر زیستی را تولید کند. به این ترتیب می‏تواند موجب کاهش آلودگی محیط زیست و تبدیل آلاینده‏های نفتی به ترکیبات با ارزش افزوده و سازگار با محیط زیست شود.

.تشکر و قدردانی

از همکاری‏های اجرایی و مالی معاونت محترم پژوهشی دانشگاه آزاد اسلامی واحد جهرم تشکر و قدردانی می‏شود.



[1]- Polyhydroxyalkanoate

[2]- Mineral salt medium (MSM)

[3]- TAG copenhagen

[iv]- Chee

[v]- Nair and Anda

[vi]- Daneshi

[vii]- Matsumoto

[viii]- Thirumala and Reddy

[ix]- Chen

[x]- Coast

[xi]- Ceyhan and Ozdemir

[xii]- Wang and Nomura

[xiii]- Heok

[xiv]- Jiang

[xv]- Amirlu

[xvi]- Zhu

[xvii]- Yang

[xviii]- Kim do

(1)               Yang YH., Brigham CJ., Budde CF., Boccazzi P., Willis LB., Hassan MA., et al. Optimization of growth media components for polyhydroxyalkanoate (PHA) production from organic acids by Ralstonia eutropha. Applied Microbiology and Biotechnology 2010; 87 (6): 2037- 45.

(2)               Santhanan A., Sasidharam S. Microbial production of polyhydroxyalkanoates (PHA) from Alcaligenes app. and Pseudomonas oleovorans using different carbon sources. African Journal of Biotechnology 2010; 9 (21): 3144- 50.

(3)               Razzaq A., Jamil N., Naheed N., Hasnain S. Bacteria from contaminated urban and hilly areas as a source of polyhydroxyalkanoates production. African Journal of Biotechnology 2010; 9 (13): 1919- 25.

(4)               McCool GJ., Cannon MC. PhaC and PhaR are required for polyhydroxyalkanoic acid synthase activity in Bacillus megaterium. Journal of Bacteriology 2001; 183 (14): 4235- 43.

(5)               Liu HY., Hall PV., Darby J., Coats ER., Green PG., Thampson DE., et al. Production of polyhydroxyalkanoate during treatment of tomato cannery wastewater. Water Environment Research 2008; 80 (4): 367- 37.

(6)               Salam LB., Obayori OS., Akashoro OS., Okogie GO. Biodegradation of bonny light crude oil by bacteria isolated from contaminated soil. International Journal of Agriculture and Biology 2011; 13 (2): 245- 50.

(7)               Aslani MM. Staining methods in microbiology. Tehran: Noor-e- Danesh Press; 2004.

(8)               Salmiati UZ., Salim MR., Olsson G. Recovery of polyhydroxyalkanoates (PHAs) from mixed microbial cultures by simple digestion and saponification. In: Proceedings of the 3rd International Water Association (IWA) -ASPIRE Conference and Exhibition, Taiwan; 2009.

(9)               Arshad MU., Jamil N., Naheed N., Hasnain S. Analysis of bacterial strains from contaminated and non-contaminated sites for the production of biopolymers. African Journal of Biotechnology 2007; 6 (9): 1115- 21.

(10)           Dalton DA., Ma C., Shrestha S., Kitin P., Strauss SH. Trade-offs between biomass growth and inducible biosynthesis of polyhydroxybutyrate in transgenic poplar. Plant Biotechnology Journal 2011; 9 (7): 759- 67.

(11)           Nair J., Anda M. Biodegradability of Bebak bag An alternative to non degradable Green bags. Report for Eerthbags Australia Pty Ltd. 2010, 1- 19.

(12)           Yakimov MM., Timmis KN., Golyshin PN. Obligate oil-degrading marine bacteria. Current Opinion in Biotechnology 2007; 18 (3): 257- 66.

(13)           da Silva GP., Mack M., Contiero J. Glycerol: a promising and abundant carbon source for industrial microbiology. Biotechnology Advances 2009; 27 (1): 30- 9.

(14)           Shukla P., Patel N., Rao RM., Shukla J., Verma S., Jha S., et al. Isolation and characterization of polyhydroxyalkanoate and exopolysaccharide producing Bacillus sp. PS1 isolated from sugarcane field in Bhilai, India. Journal of Microbial and Biochemical Technology 2011; 3 (2): 33- 5.

(15)           Chee JY., Yoga SS., Lau NS., Ling SC., Abed RMM., Sudesh K. Bacterially produced Polyhydroxyalkanoate (PHA): converting renewable resources into bioplastics. Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology 2010; 2: 1395- 1404.

(16)           Daneshi A., Younesi H., Ghasempouri SM., Sharifzadeh M. Production of poly-3-hydroxybutyrate by Cupriavidus necator from corn syrup: statistical modeling and optimization of biomass yield and volumetric productivity. Journal of Chemical Technology and Biotechnology 2010; 85 (11): 1528- 39.

(17)           Matsumoto K., Morimoto K., Gohda A., Shimada H., Taguchi S. Improved polyhydroxybutyrate (PHB) production in transgenic tobacco by enhancing translation efficiency of bacterial PHB biosynthetic genes. Journal of Bioscience and Bioengineering 2011: 111 (4): 485- 8

(18)           Thirumala M., Reddy SV. Production of polyhydroxybutyrate using cane molasses as a sole carbon substrate by Bacillus sp. 112A. The IUP Journal of Biotechnology 2012; 6 (1): 25- 33.

(19)           Chen J., Zhang L., Chen J., Chen G. Biosynthesis and Characterization of Polyhydroxyalkanoate Copolyesters in Ralstonia eutropha PHB-4 Harboring a Low-Substrate-Specificity PHA Synthase PhaC2Ps from Pseudomonas stutzeri 1317. Chinese Journal of Chemical Engineering 2007; 15 (3): 391- 6.

(20)           Coats ER., Loge FJ., Wolcott MP., Englund K., McDonald AG. Synthesis of polyhydroxyalkanoates in municipal wastewater treatment. Water Environment Research 2007; 79 (12): 2396- 403.

(21)           Ceyhan N., Ozdemir G. Pol-β-yhydroxybutyrate (PHB) production from domestic wastewater using Enterobacter aerogenes 12Bi strain. African Journal of Microbiology Research 2011; 5 (6): 690- 702.

(22)           Wang Q., Nomura CT. Monitoring differences in gene expression levels and polyhydroxyalkanoate (PHA) production in Pseudomonas putida KT2440 grown on different carbon sources. Journal of Bioscience and Bioengineering 2010; 110 (6): 653- 59.

(23)           Heok YK. Biosynthesis and characterization of polyhydroxyalkanoates by a locally isolated Chromobacterium sp. USM2 [Dissertation]. Malaysia: University Sains Malaysia. ; 2009.

(24)           Jiang Y., Song X., Gong L., Li P., Dai C., Shao W. High poly (β-hydroxybutyrate) production by Pseudomonas fluorescens A2a5 from inexpensive substrates. Enzyme and Microbial Technology 2008; 42 (2): 167- 72

(25)           Wang PP., Li XT., Chen GQ. Production and characterization of homopolymer polyhydroxyheptanoate (P3HHp) by a fadBA knockout mutant Pseudomonas putida KTOY06 derived from P. putida KT2442. Process Biochemistry 2009; 44: 106- 11

(26)           Amirlu A., Syairah SN., Yahya ARM., Azizan MNM., Majid MIA. Synthesis of biodegradable polyesters by Gram negative bacterium isolated from Malaysian environment. World Journal of Microbiology and Biotechnology 2008; 24: 1327- 32.

(27)           Zhu C., Nomura CT., Perrotta JA., Stipanovic AJ., Nakas JP. Production and characterization of Poly-3-hydroxybutyrate from biodiesel-glycerol by Burkholderia cepacia ATCC 17759. Biotechnology Progress 2010; 26 (2): 424- 30.

(28)           Kim do Y., Kim HW., Chung MG., Rhee YH. Biosynthesis, modification, and biodegradation of bacterial medium-chain-length polyhydroxyalkanoates. Journal of Microbiology 2007; 45 (2): 87- 97.