ردیابی ژن‏ های مولد انتروتوکسین در ایزوله‏ های استافیلوکوکوس اورئوس جدا شده از ناگت مرغ در استان اصفهان به روش PCR

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 دانشجوی کارشناسی ارشد مهندسی علوم و صنایع غذایی، دانشگاه آزاد اسلامی واحد شهرکرد، ایران.

2 دانشیار بهداشت مواد غذایی، دانشگاه آزاد اسلامی واحد شهرکرد، ایران.

3 دانشیار بهداشت و ایمنی غذا، دانشگاه علوم پزشکی اصفهان، ایران.

چکیده

مقدمه: استافیلوکوکوس اورئوسمولد انتروتوکسین به عنوان رایج‏ترین عامل مسمومیت غذایی استافیلوکوکی و به دنبال آن وقوع گاستروانتریت، اسهال و استفراغ شناخته شده است که وجود ژن‏های مولد انتروتوکسین در این باکتری می‏تواند علت اصلی بروز این علایم باشد. این مطالعه با هدف بررسی شیوع و فراوانی ژن‏های مولد انتروتوکسین در ایزوله‏هایاستافیلوکوکوس اورئوس جدا‏شده از ناگت مرغ و غذای آماده مصرف در استان اصفهان به روش PCR انجام شده است‏‏.
مواد و روش‏‏ها: در تابستان 1391، 420 نمونه انواع ناگت مرغ از مراکز فروش استان اصفهان به شکل تصادفی جمع‏آوری شد. تمام نمونه‏ها از نظر حضور استافیلوکوکوس اورئوس به روش کشت میکروبی آزمایش شدند. سپس، به منظور بررسی فراوانی ژن‏های مولد انتروتوکسین، سویه‏های استافیلوکوکوس اورئوس جدا‏شده آزمون PCR شدند.
نتایج: در این مطالعه، از 420 نمونه ناگت مرغ 24 نمونه (7/5 درصد) از نظر حضور استافیلوکوکوس اورئوس، مثبت بودند. از 24 ایزوله جداسازی ‏شده، 23 ایزوله (83/95 درصد) حامل حداقل یک ژن مولد انتروتوکسین بودند. اصلی‏ترین ژن‏های ردیابی‏شده در بین استافیلوکوکوس اورئوس‏های مورد مطالعه sea (25 درصد)، sec (5/12 درصد)، sed +sej (16/4 درصد)، sed + seg (16/4 درصد)، seg + sei (16/4 درصد)، sea + seg (33/8 درصد)، seb + sej + sei (16/4 درصد)، sea + sed (5/12 درصد) و sea + sec + sej (5/12 درصد) بودند که شایع‏ترین ژن مولد انتروتوکسین ردیابی شده ژن seaو پس از آن ژن sec گزارش شد.
بحث و نتیجه‏ گیری: استافیلوکوکوس اورئوس می‏تواند به‏راحتی از طریق آلوده کردن ناگت مرغ سبب شیوع مسمومیت غذایی استافیلوکوکی شود. بنابراین، می‏توان با اجرای استاندارد‏های کنترل کیفیت و امنیت مواد غذایی در حین فرآیند تولید، از حضور و رشد این باکتری در مواد غذایی جلوگیری کرد. از طرف دیگر به علت افزایش تمایل مردم به سرو غذاهای آماده مصرف و اهمیت سلامت عمومی جامعه، بررسی شیوع و فراوانی ژن‏های مولد انتروتوکسین در ایزوله‏های استافیلوکوکوس اورئوس در ناگت مرغ ضروری به نظر می‏رسد.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Detection of enterotoxin genes of staphylococcus aureus isolates from chicken nugget in Esfahan province by PCR technique

نویسندگان [English]

  • Hajar Madahi 1
  • Ebrahim Rahimi 2
  • Mohammad Jalali 3
1 M.Sc Student of Food Science and Technology, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran.
2 Associated Professor of Food Hygiene, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran.
3 Associated Professor of Infectious Disease and Tropical Medicine, Isfahan University of Medical Sciences, Iran.
چکیده [English]

Introduction:The enterotoxigenic Staphylococcus aureus is considered as one of the most common agents of food poisoning, gastroenteritis, diarrhea and vomiting that the presence of bacterial virulence genes can be as the most important cause of this foodborn illness. The present study was conducted to determine the presence of S. aureus and its virulence factors in chicken nugget and ready to eat foods in Iran.
Materials and methods: In summer 2012 a total of 420 samples chicken nuggets were collected from randomly selected retail stores in Isfahan provinces, Iran. Samples were cultured and the positive results were studied using PCR for detection of sea-sej virulence genes.
Results: Results showed that 24 of 420 samples (5.7 %) were found to be contaminated with S. aureus. Also 23 of 24 isolated S. aureus were positive for one or more entrotoxin genes. The most detected genes were sea (25 %), sec (12.5 %), sed + sej (4.16 %), sed + seg (4.16 %), seg + sei (4.16 %), sea + seg (8.33 %), seb + sej + sei (4.16 %), sea + sed (12.5 %), sea + sec + sej (12.5 %). The most commonly detected genes were sea and sec.
Discussion and conclusion: The chicken nugget can be easily contaminated by the S. aureus and usually this contamination causes Staphylococcal food poisoning. Therefore, some food safety and quality standards need to be applied and performed in most of food units to control prevalence of S. aureus and its virulence factors. Nowadays, consumption of fast foods like chicken nuggets is very popular. Therefore, it is important to study the prevalence of enterotoxigenic S. aureus and its virulence genes in chicken nugget that this shows the important public health issue.

کلیدواژه‌ها [English]

  • Staphylococcus aureus
  • Virulence genes
  • Chicken nugget
  • PCR

مقدمه

امروزه با وجود پیشرفت‏های زیادی که در علم بشر ایجاد شده است، بیماری‏های قابل انتقال از طریق غذا، سالانه خسارات اقتصادی قابل ملاحظه‏ای را به جامعه تحمیل می‏کنند. به طور معمول، مسمومیت غذایی در انسان در اثر مصرف سم تولید شده توسط باکتری‏هایی مانند استافیلوکوکوس اورئوس[1] در مواد غذایی به وجود می‏آید (1 و 2). استافیلوکوکوس اورئوس یک کوکسی گرم مثبت بوده که به شکل یک باکتری کلونیزه شده بر روی پوست و غشاهای مخاطی انسان و حیوانات یافت می‏شود. این باکتری عامل بروز مسمومیت غذایی، پنومونی، عفونت پوستی، عفونت سپتی سمی و سندرم شوک توکسیک (TSS[2])، در انسان است (3). همچنین، این باکتری در حیوانات عامل ایجاد بیماری ورم پستان، التهاب موضعی استخوان‏ها و عفونت دستگاه ادراری است (4). باکتری استافیلوکوکوس اورئوس به راحتی می‏تواند درصد بالای نمک و حتی دامنه وسیعی از اسیدیته و دما راتحمل کند (1). این باکتری در گزارش‏های فراوانی از فرآورد‏ه‏های لبنی، فرآورد‏ه‏های گوشتی، جوجه، ماهی، غذاهای نمکی و تخمیری، آبمیوه‏ها، سبزیجات و حتی غذاهای پخته و نیمه پز، جداسازی شده است (1). هوانگ و همکاران[3] در سال 2007 (5) و کوون و همکاران[4] در سال 2006 (6)، باکتری استافیلوکوکوس اورئوس را از موارد فساد گوشت طیور و محصولات آن، جداسازی کرده‏اند. بنابراین، ارزیابی حضور این باکتری در گوشت طیور و محصولات آن، ضروری به نظر می‏رسد.

عامل اصلی عفونت و مسمومیت استافیلوکوکی وجود ژن‏های مولد توکسین در استافیلوکوکوس اورئوس است (7). تاکنون 9 انتروتوکسین (sea-see و seg-sej) و 9 توکسین مشابه انتروتوکسین (selk-selr و selu) در استافیلوکوکوس اورئوس‏های مولد مسمومیت‏های غذایی، شناخته شده است (7، 3 و8). بررسی پیشین نشان می‏دهد که انتروتوکسین‏های نوع A و B استافیلوکوکی به عنوان عامل اصلی مسمومیت‏های غذایی استافیلوکوکی در دنیا شناخته شده‏اند (9).

ناگت مرغ به عنوان غذای سرخ شده محتوی مواد مغذی شامل چربی، پروتئین، ویتامین و مواد معدنی بوده که تمایل افراد به مصرف آن نه تنها در ایران بلکه در بیشتر کشورها در حال افزایش است (10). اما تاکنون مطالعه ثبت شده‏ای از وضعیت آلودگی این فرآورد‏ه غذایی به استافیلوکوکوس اورئوس، در ایران انجام نشده است. پژوهش حاضر به منظور ردیابی باکتری استافیلوکوکوس اورئوس مولد انتروتوکسین در نمونه‏های ناگت مرغ عرضه شده در استان اصفهان انجام شده است.

 

.مواد و روش‏ها

جمع‏آوری نمونه‏ها: در تابستان 1391 در مجموع 420 نمونه انواع ناگت مرغ تولید شده در 9 شرکت مختلف از مراکز فروش در استان اصفهان جمع‏آوری، در کنار یخ به آزمایشگاه کنترل کیفی مواد غذایی دانشگاه آزاد اسلامی واحد شهرکرد منتقل و پس از نمونه‏گیری از نظر حضور استافیلوکوکوس اورئوس و فراوانی ژن‏های مولد انتروتوکسین‏های کلاسیک آزمایش شدند. در این مطالعه تجربی نمونه‏ها به طور تصادفی ساده از سطح استان اصفهان انتخاب شدند.

جداسازی استافیلوکوکوس اورئوس: به منظور جداسازی باکتری استافیلوکوکوس اورئوس، ابتدا 10 گرم از هر نمونه با 90 میلی‏لیتر از محلول استریل بافر نمک فسفات مخلوط وسپس، به شکل هموژن درآورده شد. برای شمارش کلونی‏های باکتریایی از محیط برد پارکر آگار[5] (ساخت شرکت دیفکو[6]، آمریکا) مطابق با دستورالعمل شرکت سازنده استفاده شد. رقت‏هایی از سوسپانسیون حاوی نمونه‏ها بر روی سطح پلیت برد پارکر آگار به طور سطحی کشت داده شد و به مدت 24 تا 48 ساعت در دمای 37 درجه سلسیوس گرمخانه‏گذاری شدند. پرگنه‏های مشکوک رشد کرده در محیط برد پارکر بر روی سطح پلیت آگار خون[7] (ساخت شرکت دیفکو، آمریکا) کشت داده و به مدت 24 ساعت در دمای 37 درجه سلسیوس گرمخانه‏گذاری شدند. در نهایت، کلونی‏ها از نظر ریخت‏شناسی بررسی شدند. برای تایید تشخیص استافیلوکوکوس اورئوس آزمون‏های گرم، کاتالاز، تخمیر مانیتول، کوآگولاز و آزمون وگس-پروسکاور [8] (VP) بر روی پرگنه‏های مشکوک انجام گرفت (11).

.ردیابی ژن‏های کدکننده انتروتوکسین‏های
 sea, seb, sec, sed, see, seg, seh, sei, sejبه روش واکنش زنجیره‏ای پلی‏مراز (PCR): استخراج DNA از ایزوله‏های استافیلوکوکوس اورئوس‏ جداشده از نمونه‏های مورد مطالعه با استفاده از کیت استخراج DNA (ساخت شرکت فرمنتاز[9]، لیتوانی) مطابق دستورالعمل شرکت سازنده انجام گرفت و حجم DNA استخراجی، در دانسیته نوری 260 نانومتر بر اساس روش شرح داده شده توسط سامبروکوروسل[10] اندازه‏گیری شد (12). بعد از تخلیص DNA، تکثیر ژن‏های انتروتوکسین انتخابی (sea, seb, sec, sed, see, seg, seh, sei and sej) با استفاده از 9 جفت پرایمر انجام شد. توالی پرایمرها و دماهای مورد استفاده برای تکثیر ژن در جدول 1 ارایه شده است.

 

جدول 1- پرایمرها ودماهای مورد استفاده برای ردیابی ژن‏های مولد انتروتوکسین در استافیلوکوکوس اورئوس

منبع

 

ژن

توالی نوکلئوتیدی پرایمر

سایز محصول (bp)

دمای اتصال پرایمر (C)

15

Sea

SEA-1

Ttggaaacggttaaaacgaa

120

50

 

SEA-2

Gaaccttcccatcaaaaaca

15

Seb

SEB-1

Tcgcatcaaactgacaaacg

478

50

 

SEB-2

Gcaggtactctataagtgcc

15

Sec

SEC-1

Gacataaaagctaggaattt

257

50

 

SEC-2

Aaatcggattaacattatcc

15

Sed

SED-1

Ctagtttggtaatatctcct

317

50

 

SED-2

Taatgctatatcttataggg

16

See

SEE-1

Aggttttttcacaggtcatcc

209

50

 

SEE-2

Cttttttttcttcggtcaatc

17

Seg

SEG-1

Aagtagacatttttggcgttcc

287

55

 

SEG-2

Agaaccatcaaactcgtatagc

17

Seh

SEH-1

Gtctatatggaggtacaacact

213

4/46

 

SEH-2

Gacctttacttatttcgctgtc

17

Sei

SEI-1

Ggtgatattggtgtaggtaac

454

50

 

SEI-2

atccatattctttgcctttaccag

18

Sej

SEJ-1

Catcagaactgttgttccgctag

142

50

SEJ-2

Ctgattttaccatcaaaggtac

 

 

آزمون PCR[11] برای تشخیص ژن‏های کدکننده انتروتوکسین در استافیلوکوکوس اورئوس مطابق روش ارائه شده توسط رال[12]و همکاران انجام شد (13). به طور خلاصه فرآیند تکثیر ژن در 25 میکرولیتر مخلوط شامل 1 واحد آنزیم TaqDNAPolymerase (فرمنتاز، لیتوانی)، 200 میکرومول dNTP (فرمنتاز، لیتوانی)، 5/2 میکرولیتر محلول بافرx10 (فرمنتاز، لیتوانی)، 1 میکرومول کلریدمنگنز (فرمنتاز، لیتوانی)، 10 پیکومول پرایمر، 3 میکرولیتر DNA الگو و 3/17 میکرولیتر آب مقطر استریل انجام شد (14).

فرآیند تکثیر با استفاده از دستگاه ترموسایکلر گرادیانت (ساخت شرکت اپندروف[13] آلمان) طی 4 برنامه مختلف به شکل ارایه شده در جدول 2 انجام شد.

محصولات واکنش زنجیره‏ای پلیمراز در ولتاژ ثابت 90 ولت به مدت 20 تا 60 دقیقه الکتروفورز و با استفاده از رنگاتیدیوم بروماید رنگ‏آمیزی شدند. در نهایت، محصول حاصل از الکتروفورز بر روی ژل 5/1 درصد آگاروز تحت اشعه UV بررسی شد. از استافیلوکوکوس اورئوس سویه استاندارد ATCC 25923، به عنوان کنترل مثبت و از DNase بدون آب به عنوان کنترل منفی استفاده شد.

یافته‏های به‏دست آمده از آزمایش به منظور تحلیل به نرم افزار Excel انتقال داده شد. این اطلاعات با استفاده از نرم افزارSPSS/18، آزمون‏های ضریب همبستگی و مربع کای در سطح P value

 

 

جدول 2- فرآیند تکثیر ردیابی ژن‏های مولد انتروتوکسین در استافیلوکوکوس اورئوس

اهداف

دناتوراسیون[14]

اتصال پرایمرها[15]

تکثیر پرایمر[16]

تکرار

تشخیص ژن‏های sea, seb, sec and sed مولد انتروتوکسین استافیلوکوکوس اورئوس

94 درجه سلسیوس

2 دقیقه

55 درجه سلسیوس

2 دقیقه

72 درجه سلسیوس

60 ثانیه

30 مرحله

تشخیص ژن see مولد اتنروتوکسین استافیلوکوکوساورئوس

94 درجه سلسیوس

2 دقیقه

57 درجه سلسیوس

2 دقیقه

72 درجه سلسیوس

60 ثانیه

35 مرحله

تشخیص ژن‏های seg, seh and sei مولد اتنروتوکسین استافیلوکوکوس اورئوس

94 درجه سلسیوس

30 ثانیه

55 درجه سلسیوس

30 ثانیه

72 درجه سلسیوس

60 ثانیه

30 مرحله

تشخیص ژن sej مولد انتروتوکسین استافیلوکوکوس اورئوس

94 درجه سلسیوس

60 ثانیه

62 درجه سلسیوس

60 ثانیه

72 درجه سلسیوس

60 ثانیه

30 مرحله

 


.نتایج

وضعیت آلودگی نمونه‏های ناگت مرغ به استافیلوکوکوس اورئوسدر جدول 3 آورده شده است. از مجموع 420 نمونه ناگت مرغ، 24 نمونه آلوده به استافیلوکوکوس اورئوس بودند (7/5 درصد). بالاترین میزان آلودگی در نمونه‏های شرکتC  (10 درصد) و کم‏ترین میزان آلودگی در نمونه‏های شرکتF  (2/2 درصد) مشاهده شد. هیچ‏یک از 45 نمونه شرکت H و 40 نمونه شرکت I مورد مطالعه از نظر آلودگی به این پاتوژن مثبت نبودند. هیچ گونه اختلاف معنا‏داری بین میزان شیوع باکتری در نمونه‏های ناگت در شرکت‏های مختلف تولیدکننده این محصول مشاهده نشد.

فراوانی ژن‏های مولد انتروتوکسین در بین24 ایزوله استافیلوکوکوس اورئوس جداشده از نمونه‏های ناگت مرغ جمع‏آوری‏شده از استان اصفهان در جدول 4 آمده است. از بین 24 سوش استافیلوکوکوس اورئوس جدا شده از نمونه‏های ناگت مرغ 23 سوش حامل یک ژن مولد انتروتوکسین، 8 سوش حامل دو ژن مولد انتروتوکسین و 4 سوش حامل سه ژن مولد انتروتوکسین بودند. همچنین، 23 ایزوله (83/95 درصد) حامل حداقل یک ژن مولد انتروتوکسین بودند. در 24 سوش استافیلوکوکوس اورئوس جداشده از نمونه‏های ناگت مرغ 9 ژنوتیپ متفاوت مشاهده شد. بیش‏ترین ژن‏های ردیابی شده در بین استافیلوکوکوس اورئوس‏های مورد مطالعه sea (25 درصد)، sec (5/12 درصد)،
sed +sej (16/4 درصد)، sed + seg (16/4 درصد)، seg + sei (16/4 درصد)، sea + seg (33/8 درصد)، seb + sej + sei (16/4 درصد)، sea + sed (5/12 درصد) و sea + sec + sej (5/12 درصد) بودند.

بررسی‏های آماری نشان دهنده اختلاف معنادار آماری (P value< 0.05) بین میزان شیوع انتروتوکسین A و سایر انتروتوکسین‏ها بود. هیچ گونه اختلاف آماری معناداری بین میزان شیوع انتروتوکسین‏ها در برند‏های مختلف ناگت مرغ دیده نشد. همچنین، هیچ گونه اختلاف معناداری بین میزان شیوع انتروتوکسین‏های ترکیبی مختلف دیده نشد.

 

جدول 3- میزان شیوع استافیلوکوکوس اورئوس‏های مولد انتروتوکسین‏های کلاسیک در نمونه‏های ناگت مرغ در استان اصفهان

نمونه‏های مثبت استافیلوکوکوس اورئوس (درصد)

تعداد نمونه

برند مورد مطالعه

 
 

4 (8)

50

A

 

4 (9/8)

45

B

 

5 (10)

50

C

 

3 (6)

50

D

 

3 (6)

50

E

 

1 (2/2)

45

F

 

4 (9/8)

45

G

 

0 (0)

45

H

 

0 (0)

40

I

 

24 (7/5)

420

مجموع

 

 

 

جدول 4- توزیع ژن‏های Sea- Sej در 24 ایزوله استافیلوکوکوس اورئوس‏های جدا شده از ناگت مرغ (Brand A- I)

ژنوتیپ

مجموع

نمونه‏های ناگت مرغ مثبت استافیلوکوکوس اورئوس (Brand A-I)

n=4

 A

 n=4

B

n=5

C

n=3

D

n=3

E

n=1

F

n=4

G

 n=0

H

 n=0

I

A

6

3

1

-

-

1

1

-

-

-

C

3

1

-

-

2

-

-

-

-

-

d + j

1

-

-

-

-

-

-

1

-

-

d + g

1

-

-

-

1

-

-

-

-

-

g + i

1

1

-

-

-

-

-

-

-

-

a + g

2

-

-

2

-

-

-

-

-

-

b + j + i

1

-

-

1

-

-

-

-

-

-

a +d

3

-

2

-

-

-

-

1

-

-

a + c + j

3

-

-

1

-

-

-

2

-

-

 

 


.بحث و نتیجه‏‏ گیری

مسمومیت استافیلوکوکی یک مسمومیت با منشأ غذایی است که در اثر انتروتوکسین مقاوم به حرارت تولید شده، به ویژه گروه A در مقادیر بسیار اندک (5/0 تا 75/0 نانوگرم در میلی‏لیتر) توسط استافیلوکوکوس اورئوس ایجاد می‏شود. این مسمومیت بیشتر مربوط به غذاهای آماده مصرفی است که پس از فرآیند آلوده شده‏اند از جمله انواع سالادها، ساندویچ‏ها، دسرها و غیره که این مسئله خطر بالقوه‏ای را برای سلامت جامعه به همراه دارد (1 و 2). به همین علت پژوهش‏های فراوانی در خصوص بررسی و تعیین شیوع سوش‏های توکسین‏زا و بررسی حضور ژن‏های مولد انتروتوکسین استافیلوکوکوس اورئوس در مواد غذایی در تمام نقاط دنیا انجام شده است که تمام این بررسی‏ها گویای آلودگی صفر تا 100درصدی موادغذایی به استافیلوکوکوس اورئوس است. در مطالعه حاضر، به طور کلی میزان شیوع استافیلوکوکوس اورئوس در نمونه‏های ناگت مرغ 7/5 درصد بود که این نتایج با نتایج بسیاری از مطالعات دیگر همخوانی دارد (1 و 19). در پژوهش انجام شده توسط نورمانو[xvii]و همکاران، با استفاده از روش‏های RPLA[xviii] و PCR به مدت 3 سال (2003 تا 2005) بر روی 1634 نمونه گوشت و شیر تولیدی در ایتالیا، آلودگی به استافیلوکوکوس اورئوس در حدود 8/12 درصد گزارش شد که به طور خاص، از 993 نمونه گوشت در حدود 10 درصد به باکتری استافیلوکوکوس اورئوس آلوده بودند (1). در پژوهش سوریانو[xix]و همکارانش میزان آلودگی به استافیلوکوکوس اورئوس در 342 نمونه غذای آماده مصرف، 5/3 و 6/7 درصد تعیین شد. همچنین آن‏ها در سال 2002 در اسپانیا با به‏کارگیری مبانی HACCP[xx] و GMP[xxi] درصد آلودگی یک نوع غذای آماده مصرف به استافیلوکوکوس اورئوس را به میزان 21درصد کاهش دادند (19). مطالعه بوئی[xxii] و همکاران در ویتنام گویای آن است که درصد شیوع استافیلوکوکوس اورئوس در 212 نمونه از غذاهای آماده مصرف 2/22 درصد است که این درصد‏ بالای آلودگی می‏تواند به علت عدم کنترل دقیق بهداشتی در حین تولید غذا، آلودگی ثانویه در حین انتقال و نگه‏داری، استفاده مجدد از ظروف آلوده و یا شستشوی نامناسب ظروف و تجهیزات و بسته بندی‏های اولیه نامناسب باشد (20). در مطالعه‏ جن‏سی[xxiii] 6/65 درصد گوشت گوساله، 55 درصد گوشت طیور، 9/73 درصد محصولات لبنی، 7/77 درصد غذاهای آماده مصرف و 7/77 درصد مواد اولیه غذاها از نظر آلودگی به استافیلوکوکوس اورئوس مثبت بودند که میزان آلودگی این پژوهش بیشتر از نتایج مطالعه حاضر بود (21). همچنین، در تایوان آلودگی لاشه مرغ به استافیلوکوکوس اورئوس را 8/7 درصد گزارش کردند که این نتایج با نتایج حاصل از مطالعه حاضر کمابیش مشابه است (22).

تاکنون مطالعاتی در ایران به منظور بررسی آلودگی گوشت طیور به استافیلوکوکوس اورئوس انجام شده است (23- 25). جوادی و صفرمشائی[xxiv] در مطالعه‏ای بر روی گوشت طیور نشان دادند که 65 درصد نمونه‏های گوشت طیور از نظر حضور استافیلوکوکوس اورئوس مثبت بوده است (23). در همین راستا نتایج حاصل از پژوهش فیضی[xxv] و همکاران آلودگی گوشت طیور را به استافیلوکوکوس اورئوس 75/81 درصد (24) و اشراقی[xxvi] و همکاران 5/3 درصد گزارش کرده‏اند (25).

علت اصلی اختلافی که در میزان شیوع باکتری استافیلوکوکوس اورئوس در مطالعات متفاوت مشاهده شد، نوع نمونه مورد بررسی، روش نمونه‏گیری، روش انجام آزمایش، منطقه جغرافیایی، شرایط آب و هوایی و سطح رعایت بهداشت است.

نتایج بررسی ما نشان دادند که از بین 24 سوش استافیلوکوکوس اورئوس جدا‏شده از نمونه‏های ناگت، 23 سوش (83/95 درصد) حامل حداقل یک ژن مولد انتروتوکسین بوده است. نتایج مشابهی در بررسی‏های پیشین، گزارش شده است (7، 8 و 26). بیش‏ترین مقدار ژن مولد انتروتوکسین (SE) در سال 2002 توسط اوموئه[xxvii]و همکاران گزارش شده است (100 درصد استافیلوکوکوس اورئوس‏های ایزوله شده) (17). آکیندون[xxviii] طی مطالعه‏ای نشان داد که 96/67 درصد از ایزوله‏های استافیلوکوکوس اورئوس جدا‏شده حامل یک یا تعداد بیش‏تری ژن sea، sec، sed، seg، sei و sej بودند که این داده‏ها بیش‏تر از نتایج حاضر بود (8). نتایج حاصل از این بررسی نشان داد که ژن‏های sea، seg، sec، sed و sej بیش‏ترین شیوع را در ناگت مرغ به خود اختصاص دادند. در بررسی‏های پیش از این، ژن‏های seg، seh، sei و sej بیش‏ترین شیوع (57 درصد) را نسبت به ژن‏های sea، seb، sec، sed و see نشان دادند (7). لیم[xxix] و همکاران طی مطالعه‏ای تعیین کردند که 28/22 درصد استافیلوکوکوس اورئوس‏های ایزوله شده حامل ژن seb, sea و sec بودند که در این بین انتروتوکسین (sea) a بیش‏ترین مقدار را به خود اختصاص داده بود (48/86 درصد) که این مطالعه با نتایج حاصل از پژوهش حاضر همخوانی دارد (26). گزارش پیشین نشان می‏دهد که تنها 9/2 درصد از 70 گونه استافیلوکوکوس اورئوس استخراجی از گوشت بوقلمون از نظر حضور ژن sea مثبت بودند در حالی‏که هیچ یک از ایزوله‏های جدا شده از نظر حضور ژن‏های see، seg و sej مثبت نبودند (21). چیانگ[xxx] و همکاران در پژوهش انجام شده بر روی عوامل مسمومیت غذایی در تایوان بیان کردند که از بین ژن‏های مولد انتروتوکسین‏های عامل مسمومیت، انواع sea، seb و sec به‏ترتیب با پراکندگی 2/29، 7/19 و 7/6 درصد نقش مؤثر داشتند (27). در پژوهش انجام شده توسط پریرا[xxxi] و همکاران در پرتغال به منظور بررسی ژن‏های مولد انتروتوکسین استافیلوکوکوس اورئوس در غذاهای آماده مصرف به روش PCR مشخص شد که 69 درصد از استافیلوکوکوس اورئوس‏های جدا شده از نمونه‏های گوشت حاوی ژن‏های مولد انتروتوکسین بودند ولی هیچ‏یک از استافیلوکوکوس اورئوس‏های جدا شده از مواد غذایی حامل ژن‏های مولد انتروتوکسین see و seb نبودند؛ همانند مطالعه حاضر هیچ یک از استافیلوکوکوس اورئوس جدا شده از نمونه‏های ناگت مرغ نیز قادر به تولید انتروتوکسین see نبودند (28).

در ایران نیز پژوهش‏های مشابهی در این زمینه انجام شده است. در پژوهشی که توسط اشراقی و همکاران در شهرستان تهران بر روی 458 نمونه از فرآورد‏ه‏های گوشتی خام و پخته انجام شد، 25 درصد سویه‏های ایزوله شده حامل ژن sec، 8 درصد حامل ژن sea و 9 درصد حامل ژن sea + sec بودند (25). سلطان دلال[xxxii] و همکاران در مطالعه‏ای نشان دادند از بین 100 سوش استافیلوکوکوس اورئوس جدا‏شده از 1047 نمونه غذایی 12 سوش حامل ژن مولد TSST[xxxiii] و 7/66 درصد از آن حامل ژن‏های مولد انتروتوکسین عامل مسمومیت انسانی بودند (29). علاوه ‏بر آن در بررسی دیگری بر روی 913 نمونه غذایی شایع‏ترین انتروتوکسین تولیدی در فرآورد‏ه‏های لبنی، انتروتوکسین D (20 درصد) و
C (16 درصد) و در فرآورد‏ه‏های گوشتی، انتروتوکسین D (6 درصد) و E (3 درصد) گزارش شد (30).

با توجه به این که این مطالعه نخستین گزارش از شیوع استافیلوکوکوس اورئوس‏های انتروتوکسیژنیک در ناگت مرغ است و نتایج آن نشان می‏دهد با وجود حرارت اعمال شده در تهیه ناگت مرغ، محصول نهایی به استافیلوکوکوس اورئوس، هر چند ناچیز، آلوده بوده است. بنابراین روش Multiplex PCR می‏تواند به عنوان یک روش مناسب، ایمن و سریع برای تشخیص استافیلوکوکوس اورئوس‏ و عامل‏های حدت آن در نمونه‏های ناگت مرغ به کار گرفته شود. از طرف دیگر فرآیند تولید با شرایط غیر بهداشتی و رعایت نکردن بهداشت توسط کارکنان کشتارگاه طیور و کارخانه‏ها می‏تواند علت اصلی آلودگی گوشت و ناگت مرغ باشد. بنابراین، آموزش افراد شاغل در زمینه کنترل صحیح مسائل بهداشتی و نظارت در مرحله تهیه، حمل‏ و ‏نقل، نگهداری و عرضه با اجرای سیستم‏های [xxxiv]GAPs، GMPs و HACCP به منظور جلوگیری از انتقال آلودگی میکروبی ضروری به نظر می‏رسد.

تشکر و قدردانی

نویسندگان از همه کارکنان مرکز تحقیقات بیوتکنولوژی و مرکز کنترل کیفی بهداشت مواد غذایی دانشگاه آزاد اسلامی واحد شهرکرد تشکر و قدردانی می‏کنند.



[1]- Staphylococcus aureus

[2]- Toxic Shock Syndrome

[3]- Hwang

[4]- Kwon

[5]- Baird Parker Agar

[6]- Difco

[7]- Blood Agar

[8]- VogesProskaver

[9]- Fermentas

[10]- Sambrook and Russell

[11]- Polymerase Chain Reaction

[12]- Rall

[13]- Eppendrof

[14]- Denaturation

[15]- Annealing of primers

[16]- Primer extension

[xvii]- Normanno

[xviii]- Reverse Passive Latex Agglutination

[xix]- Soriano

[xx]- Hazard Analysis and Critical Control Point

[xxi]- Good Manufacturing Practices

[xxii]- Bui

[xxiii]- Gencay

[xxiv]- Javadi and Safarmashaei

[xxv]- Feizi

[xxvi]- Eshraghi

[xxvii]- Omoe

[xxviii]- Akinedon

[xxix]- Lim

[xxx]- Chiang

[xxxi]- Pereira

[xxxii]- SoltanDallal

[xxxiii]- Toxic Shock Syndrome Toxin

[xxxiv]- Good Agricultural Practices  

(1) Normanno TG., La Salandra G. Occurrence, characterization and antimicrobial resistance of enterotoxigenic Staphylococcus aureus isolated from meat and dairy products. International Journal of Food Microbiology2007; 115 (3): 290- 6.

(2) Redmond EC., Griffith CJ. Consumer food handling in the home: areview of foodsafety studies. Journal of Food Protection 2003; 66 (1): 130- 61.

(3) Hermans K., Devriese LA., Haesebrouck F. Staphylococcus aureus. In: Gyles CL., Prescott JF., Songer JG., Thoen CO., editors. Pathogenesis of Bacterial Infections in animals. USA: Wiley Black well Publication; 2010. P 75- 85.

(4) Witte W. Antibiotic resistance in gram-positive bacteria: epidemiological aspects. Journal of Antimicrobial Chemotherapy 1999; 44 (Suppl A): 1- 9.

(5) Hwang SY., Kim SY., Jang EJ., Kwon NH., Park YK., Koo HC., et al. Novel multiplex PCR for the detection of the Staphylococcus aureus superantigen and its application to raw meat isolates in Korea. International Journal of Food Microbiology 2007; 117 (1): 99- 105.

(6) Kwon NH., Park KT., Jung WK., Youn HY., Lee Y., Kim SH., et al. Characteristics of methicillin resistant Staphylococcus aureus isolated from chicken meat and hospitalized dogs in Korea and their epidemiological relatedness. Veterinary Microbiology 2006; 117 (1): 304- 12.

(7) Rosec JP., Gigaud O. Staphylococcalenterotoxin genes of classical and new typedetected by PCR in France. International Journal of Food Microbiology 2002; 77 (1- 2): 61- 70. 

(8) Akinedon O., Annemuller C., Hassan A., Lammler C., Wolter w., Zschock M. Toxin genes and other characteristics of Staphylococcus aureus isolates from milk of cows with mastitis. Clinical and Diagnostic Laboratory Immunology2001; 8 (5): 959- 64.

(9) Saadati M., Barati B., Shirazi M. Detection of sea, sec and seq genes in Staphylococcus aureus nasal sampling acquiring from healthy carrier. Iranian South Medical Journal 2008; 12 (8): 1- 16.

(10)            Mallikarjunan PK., Ngadi MO., Chinnan MS. Breaded fried food. New York: Taylor and Francis group; CRC Press; 2010.

(11)            Kiedrowski MR., Kavanaugh JS., Malone CL., Mootz JM., Voyich JM., Smeltzer MS., et al. Nuclease Modulates Biofilm Formation in CommunityAssociatedMethicillin-Resistant Staphylococcus aureus. Plose One 2011; 6 (11): 1- 16.

(12)            Sambrook J., Russell DW. Standard methods for DNA manipulations. MolecularCloningALaboratory Manual. New York: Cold Spring Harbor Laboratory; 2001.

(13)            Rall VL., Vieira FP., Rall R., Vieitis RL., Fernandes AJR., Candeias JM., et al. PCR detection of staphylococcal enterotoxin genes in Staphylococcus aureus strains isolated from raw and pasteurized milk. Veterinary Microbiology 2008; 132 (3- 4): 408- 13.

(14)            Zouharova M., Rysanek D. Multiplex PCR and RPLA identification of Staphylococcus aureus enterotoxigenics trains from bulk tank milk. Zoonoses Public Health 2008; 55 (6): 279- 330.

(15)            Johnson WM., Tyler SD., Ewan FE., Ashton FR., Pollard DR., Rozee KR. Detection of genesfor enterotoxins, exfo-liative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by the polymerase chain reaction. Journal of Clinical Microbiology 1991; 29 (3): 426- 30.

(16)            Mehrotra M., Wang G., Johnson WM. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. Journal of Clinical Microbiology 2000; 38 (3): 1032- 5.

(17)            Omoe K., Ishikawa M., Shimoda Y., Hu D., Ueda S., Shinagawa K. Detection of seg, seh, and seigenes in Staphylococcus aureus isolates and determination of enterotoxin productivities of S. aureus isolates harboring seg, seh, or seigenes. Journal of Clinical Microbiology 2002; 40 (3): 857- 62.

(18)            Nashev D., Toshkova K., Isrina S., Salaisa S., Hassan AA., La¨mmler C., et al. Distribution of virulence genes of Staphylococcus aureus isolated from stable nasal carriers. FEMS Microbiology Letters2004; 233 (1): 45- 52.

(19)             Soriano JM., Rico H., Molto JC., Mares J. Effect of introduction of HACCP on the microbiological quality of some restaurant meals. Food Control 2002; 13: 253- 61.

(20)            Bui TMH., Zahid HM., Sucharit BN., Afework K., Nguyen VN., Alizadeh M., et al. Toxigenicity and genetic diversity of Staphylococcus aures isolated from Vietnamese ready-to-eat foods. Food Control 2010; 21 (2): 166- 71.

(21)            Gencay YE., Ayaz ND., Kasimoglu Dogru A. Enterotoxin Gene Profiles of Staphylococcus aureus and Other Staphylococcal Isolates from Various Foods and Food Ingredients. Erciyes Üniversitesi Veteriner Fakültesi 2010; 7 (2): 75- 80.

(22)            Lin J., Yeh KS., Liu HT., Lin JH. Staphylococcus aureus isolated from pork and chicken carcasses in Taiwan: prevalence and antimicrobial susceptibility. Journal of Food Protection 2009; 72 (3): 608- 11.

(23)            Javadi A., Safarmashaei S. Microbial profile of marketed broiler meat. Middle-East Journal of Scientific Research 2011; 9 (3): 652- 6.

(24)            Feizi A., Nazeri M., Pilevar A. Isolation of Staphylococcus spp. genera from broiler breeder flocks in East Azerbaijan Province of Iran: Prevalence and antimicrobial susceptibility. African Journal of Microbiology Research 2012; 6 (1): 5819- 23.

(25)            Eshraghi S., Salehipur Z. Detection of tst, sec, sea and sec + sea in staphylococcus aureus isolated from different food sampling. Tehran Medical University Journal 2008; 67 (7): 470- 6.

(26)            Lim S., Joo Y., Moon J., Lee A., Nam H., Wee S., et al. Molecular typing of enterotoxigenic Staphylococcus aureus isolated from bovine mastitis in Korea. Journal of Veteterinary Medical Science 2004; 66 (5): 581- 4.

(27)            Chiang YC., Liao WW., Fan CM., Pai WY., Chiou CS., Tsen HY. PCR detection of Staphylococcal enterotoxins (SEs) N, O, P, Q, R, U, and survey of SEtypes in Staphylococcu saureus isolates from food-poisoning cases in Taiwan. International Journal of Food Microbiology2008; 121 (1): 66- 73.

(28)            Pereira V., Lopes. Characterization for enterotoxin production, virulence factors and antibiotic susceptibility of Staphylococcus aureus isolates from various foods in Portugal. Food Microbiology 2009; 26 (3): 278- 82.

(29)            SoltanDallal MM., Salehipour Z., Eshraghi S., FallahMehrabadi J., Bakhtiari R. Occurrence and molecular characterization of Staphylococcus aureus strains isolated from meat and dairy products by PCR- RFLP. Annals Microbiology 2010; 60 (2):189- 96.

(30)            SoltanDallal MM., Salehipour Z., Mehrabadi ZF. Molecular pidemiology of Staphylococcus aureus in food samples based on the protein A gene polymorphic region DNA sequence. Canadian Journal of Microbiology 2010; 56 (1): 18- 21.