کنترل‏ زیستی‏ علف‏ هرز‏ پیچک‏ صحرایی Convolvulus arvensis با‏ استفاده‏ از پروتئین‏ نوترکیب‏ Nep1‏ حاصل‏ از Fusarium oxysporum‏

نوع مقاله: پژوهشی- فارسی

نویسندگان

1 دانشیار‏ میکروبیولوژی، مرکز‏ پژوهشی‏ فن‏آوری‏ و‏ فرآورده ‏های‏ میکروبی، دانشگاه‏ تهران، ایران.

2 استادیار‏ میکروبیولوژی، مرکز‏ پژوهشی‏ فن‏آوری‏ و‏ فرآورده‏ های‏ میکروبی، دانشگاه‏ تهران، ایران.

3 کارشناس‏ ارشد‏ میکروبیولوژی، دانشگاه‏ آزاد‏ اسلامی، واحد‏ علوم‏ دارویی، تهران، ایران.

4 استادیار‏ میکروبیولوژی، مرکز‏ تحقیقات‏ بیوتکنولوژی‏ کاربردی، دانشگاه‏ علوم‏ پزشکی‏ بقیه‏ الله‏ (عج)، تهران، ایران.

5 دانشیار‏ بیوتکنولوژی‏ دارویی، دانشکده‏ داروسازی، دانشگاه‏ علوم‏ پزشکی‏ تهران، ایران.

چکیده

مقدمه:‏ پروتئین‏ Nep1‏ یک‏ علف‏کش‏ زیستی‏ است‏ که‏ به‏ طور‏ مؤثر‏‏‏‏ی‏ باعث‏ از‏ بین‏ رفتن‏ تعداد‏ زیادی‏ از‏ گیاهان‏ دولپه‏‏ای‏ و‏ از‏ جمله‏ طیف‏ وسیعی‏ از‏ علف‏های‏ هرز‏ می‏‏شود. این‏ پروتئین‏ برای‏ نخستین‏ بار‏ در‏ سال‏ 1995‏ از‏ مایع‏ تخمیر‏ قارچ‏ Fusarium oxysporum‏‏ خالص ‏سازی‏ ‏‏شد‏‏.
مواد‏ و‏ روش‏‏ ها:‏ در‏ این‏ پژوهش،‏ ژن‏ nep1‏ از‏F. oxysporumجداسازی‏ و پس ‏‏از‏ حذف‏ سیگنال‏ نشانه‏ از‏ ابتدای‏ ژن، ساختار‏ نهایی‏ در‏ حامل‏ pET16b‏ کلون‏ و‏ به‏ باکتری (DE3) BL21 E. coli انتقال‏ داده‏ شد. پروتئین‏ نوترکیب‏ پس‏ از‏ تولید‏ در‏ باکتری، خالص‏سازی‏ ‏‏و‏ رقت‏های‏ ‏‏مناسب‏ از‏ آن‏ برای‏ سنجش‏ زیستی‏ روی‏ گیاه‏ هرز‏ تهیه‏ شد.
نتایج:‏ دو‏ میلی ‏‏‏‏لیتر‏ از‏ پروتئین‏ نوترکیب‏ تولید‏ شده‏ با‏ غلظت‏ 60 میکروگرم‏ در‏ میلی‏‏‏‏ لیتر‏ به‏ گیاه‏ بالغ‏ پیچک‏ صحرایی‏ اسپری‏ شد. نتایج‏ به‏ دست‏ آمده‏ نشان‏ داد‏ که‏ برگ‌های‏ گیاه پس ‏‏از‏ حدود‏ 2‏ روز‏ شروع‏ به‏ زرد‏ شدن‏ و‏ نکروز‏ وسیع‏ کردند. نکروز‏ کامل‏ و‏ مرگ‏ گیاه‏ هرز،‏ 5‏ روز‏ پس‏ از‏ اسپری‏ مشاهده‏ شد. از‏ اسپری‏ بافر‏ بدون‏ پروتئین‏ نوترکیب‏ و‏ همچنین،‏ پروتئین‏ Nep1‏ نوترکیب‏ تقلیب‏ شده‏ از‏ طریق‏ 15‏ دقیقه‏ تیمار‏ حرارتی‏ در‏ 100‏ درجه‏ سانتی‏گراد‏ به‏ عنوان‏ شاهد‏ استفاده‏ شد‏ که پس ‏‏از‏ گذشت‏ 5‏ روز‏ هیچگونه‏ علامتی‏ روی‏ برگ‏های‏ ‏‏گلدان‏های‏ ‏‏شاهد،‏ مشاهده‏ نشد.
بحث‏ و‏ نتیجه‏ گیری:‏ نتایج‏ به‏ دست‏ آمده‏ در‏ این‏ پژوهش‏ نشان‏ داد‏ که‏ می‏‏توان‏ از‏ پروتئین‏ نوترکیب‏ Nep1‏ به‏ عنوان‏ یک‏ عامل‏ زیستی‏ توانمند‏ در‏ کنترل‏ گیاه‏ هرز‏ C. arvensis‏ استفاده‏ کرد. 

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Recombinant Nep1 From Fusarium oxysporum as a biological agent for control of Convolvulus arvensis

نویسندگان [English]

  • Javad Hamedi 1
  • Hamid Moghimi 2
  • Elham Reza zadeh 3
  • Ali Mohammad Latifi 4
  • Zargham Sepehri zadeh 5
1 Associate Professor of Microbiology, University of Tehran, Iran.
2 Assistant Professor of Microbiology, University of Tehran, Iran.
3 M.Sc. in Microbiology, Islamic Azad University, Pharmaceutical Sciences Branch, Tehran, Iran.
4 Assistant Professor of Microbiology, Bagiatallah University of Medical Science, Tehran, Iran.
5 Associate Professor of Pharmaceutical Biotechnology, Tehran University of Medical Science, Iran.
چکیده [English]

Introduction:Nep1 is a natural bio-herbicide protein which has an effective necrosis stimulant in dicotyledonous weeds. This protein was first purified in 1995 form fermentation broth of Fusarium oxysporum.
Materials and methods: In this study, the nep1gene was isolated form F. oxysporum, after removal of signal peptide from the beginning of the gene; final pET16b-nep1 construct was cloned and transformed into E. coli BL21 (DE3). The recombinant Nep1 was produced in
E. coli. Recombinant protein was purified, diluted and prepared for biological assay on weed.
Results: Two ml of recombinant Nep1 with 60 µg/ ml final concentrations was sprayed on Convolvulus arvensis. Our results showed necrosis and chlorosis symptoms were started on the plant leaves after 2 days, also significant necrosis on the leaves of C. arvensis was seen after
5 days.  No necrosis lesion was seen in the negative control plants that sprayed only with buffer and denatured recombinant Nep1 in 100 ºC for 15 min.
Discussion and conclusion: Our results introduced recombinant Nep1 as a biological potent agent for biocontrol of C. arvensis.

کلیدواژه‌ها [English]

  • Recombinant protein
  • Convolvulus arvensis
  • Weed
  • Biocontrol
  • Nep1

مقدمه

‏باتوجه‏ به‏ افزایش‏ روز‏ افزون‏ جمعیت‏ جهان، نیاز‏ به‏ محصولات‏ غذایی‏ بیش‏ از‏ پیش‏ احساس‏ می‏‏شود. با‏ وجود‏ پیشرفت‏های‏ ‏‏صنعتی‏ بسیاری‏ که‏ از‏ سال1940‏ تاکنون‏ حاصل‏ شده‏ است، آفت‏‏ها شامل‏ علف‏های‏ هرز، حشرات‏ و‏ میکروارگانیسم‏های‏ ‏‏بیماری‏‏زای‏ گیاهی) همچنان‏ مشکل‏ اصلی‏، کاهش‏ تولید‏ در‏ زمین‏های‏ ‏‏کشاورزی‏ به‏ شمار‏ می‏‏روند (1). کنترل‏ علف‏های‏ ‏‏هرز‏ یکی‏ از‏ مسایل‏ اصلی‏ تولید‏ محصولات‏ زراعی‏ در‏ سرتاسر‏ جهان‏ است. روش‏های‏ ‏‏کنترل‏ علف‏های‏ ‏‏هرز‏ شامل‏ روش‏های‏ ‏‏جلوگیری‏ کننده‏‏ از‏ رشد‏ علف‏های‏ ‏‏هرز، روش‏های‏ مکانیکی‏ کنترل‏ شامل‏ رقابت‏ و‏ مدیریت‏ کشت، روش‏های‏ ‏‏کنترل‏ شیمیایی‏ و‏ زیستی‏ است (2). در‏ این‏ میان‏ روش‏ کنترل‏ با‏ کمک‏ علف‏کش‏های‏ ‏‏شیمیایی‏ بیشتر‏ استفاده‏ شده است. با‏ توجه‏ به‏ مقاومت‏ بسیاری‏ از‏ آفت‏‏ها و‏ علف‏های‏ ‏‏هرز‏ به‏ آفت‏کش‏های‏ ‏‏شیمیایی‏ و‏ همچنین،‏ آثار‏‏‏ مضر‏ شدید‏ این‏ آفت‏کش‏‏ها بر‏ سلامت‏ محیط‏ زیست‏ و‏ انسان (3)، استفاده‏ از‏ روش‏های‏ ‏‏جایگزین‏ بسیار‏ مورد‏ توجه‏ قرار‏ گرفته‏ است‏ که‏ در‏ این‏ میان‏ روش‏های‏ ‏‏زیستی‏ و‏ استفاده‏ از‏ عوامل‏ زیستی‏ با‏ توجه‏ به‏ عدم‏ آلودگی‏ محیط‏ زیست‏ و‏ آثار‏‏‏ اختصاصی‏تر‏ مورد‏ توجه‏ زیادی‏ هستند (3).

علف‏کش‏های‏ ‏‏زیستی‏ شامل‏ میکروارگانیسم‏های‏ ‏‏بیماری‏زای‏ گیاهی‏ یا‏ ترکیبات‏ میکروبی‏ حاصل‏ از‏ میکروارگانیسم‏های‏ ‏‏بیماری‏زا‏ ‏‏و‏ غیر‏ بیماری‏زا‏ ‏‏با‏ عنوان‏ فیتوتوکسین‏‏ها هستند‏ که‏ برای‏ کنترل‏ علف‏های‏ ‏‏هرز‏ به‏کار‏ می‏‏روند (2).

پیچک‏ صحرایی‏ با‏ نام‏ علمی‏ Convolvulus arvensis گیاهی‏ دو‏ لپه، چند‏ ساله، خزنده، دارای‏ سطح‏ صاف‏ و‏ بدون‏ کرک‏ بوده‏ و‏ رشد‏ رویشی‏ آن‏ از‏ ابتدای‏ بهار‏ تا‏ شروع‏ سرمای سبک‏ پاییز‏ است. C. arvensisیکی‏ از‏ 10‏ گیاه‏ هرز‏ مهم‏ و‏ مسأله‏‏‏ساز‏ دنیا‏ست‏ و‏ از‏ گیاهان‏ هرز‏ مضر‏ در‏ باغات، مزارع‏ گندم‏ و‏ محصولات‏ تابستانه‏ به‏ شمار‏ می‏‏آید (4‏ و‏ 5). این‏ گیاه،‏ بومی‏ اروپا‏ و‏ غرب‏ آسیا‏ بوده‏ و‏ در‏ مناطق‏ گرمسیری‏ و‏ معتدل‏ توسعه‏ یافته‏ است (5). گیاه C. arvensisبا‏ پیچیدن‏ به‏ دور‏ غلات‏ دانه‏ ریز‏ سبب‏ ایجاد‏ مشکل‏ در‏ امر‏ برداشت‏ آن‏ها‏ می‏‏شود. همچنین، این‏ گیاه ‏به‏ سرما‏ و‏ یخبندان‏ مقاوم‏ بوده‏ و آثار‏‏‏ آسیبی‏ شدیدی‏ بر روی ذرت‏ و‏ نیشکر‏ دارد (4‏ و‏ 5).

استفاده‏ از‏ علف‏کش‏های‏ ‏‏شیمیایی‏ مهم‏ترین‏ راهکار‏ مقابله‏ با‏ این‏ علف‏ هرز‏ است. از‏ جمله‏ مهم‏‏ترین‏ علف‏کش‏های‏ ‏‏شیمیایی‏ مورد‏ استفاده‏ برای‏ کنترل‏ این‏ گیاه‏ می‏‏توان‏ به‏ علف‏ کش [1]‏2,4- D از‏ گروه‏ فنوکسی‏ استیک‏اسید‏ و‏ همچنین،‏ علف‏کش‏ شیمیایی‏ خطرناک‏ [2]MCPA‏ اشاره‏ کرد (4). آثار‏‏‏ تخریبی‏ بالا‏ روی‏ محیط‏ زیست‏ و‏ مقاوم‏ شدن‏ علف‏های‏ ‏‏هرز‏ از‏ جمله‏ پیچک‏ به‏ این‏ علف‏کش‏‏ها از‏ جمله‏ مهم‏ترین‏ مشکلات‏ این‏ آفت‏کش‏های‏ ‏‏شیمیایی‏ است. در‏ روزهای‏ گرم‏ سال‏ اسپری‏ کردن‏ این‏ سموم، سبب‏ تغییر‏ فرمولاسیون‏ آن‏ها‏ و‏ به‏ شدت‏ برای‏ انسان‏ها‏ سمی‏ خواهد شد. همچنین،‏ جذب‏ پوستی‏ این‏ سموم‏ عوارض‏ جبران‏ ناپذیری‏ را‏ به‏ همراه‏ دارد‏ (5). سمیت‏ بالای‏ علف‏کش‏های‏ ‏‏شیمیایی‏ مورد‏ استفاده‏ برای‏ کنترل‏ C. arvensisبرای‏ انسان‏ و‏ محیط‏ زیست‏ و‏ مقاوم‏ شدن‏ این‏ علف‏ هرز‏ به‏ این‏ آفت‏کش‏ ها، لزوم‏ توجه‏ به‏ استفاده‏ از‏ عوامل‏ جایگزین‏ با‏ کارایی‏ بالا‏ و‏ سمیت‏ کمتر‏ را‏ روشن‏ می‏کند.

پروتئین‏ Nep1[3]‏ یک‏ علف‏کش‏ زیستی‏ است‏ که‏ اولین‏ بار‏ در‏ سال‏ 1995توسط‏ بیلی[4]‏ از‏ عصاره‏ کشت‏ قارچ‏ Fusarium oxysporum‏‏کشف‏ و‏ خالص‏سازی‏ ‏‏شد (6). این‏ پروتئین‏ باعث‏ تحریک‏ تولید‏ اتیلن‏ و‏ بافت‏ مردگی‏ در‏ گیاهان‏ دولپه‏‏ای‏ می‏‏شود. طیف‏ میزبانی‏ این‏ پروتئین‏ دامنه‏ وسیعی‏ از‏ گیاهان‏ دولپه‏ است، اما‏ در‏ تک‏ لپه‏ای‏‏ها فاقد‏ خاصیت‏ تخریب‏پذیری‏ است. این‏ پروتئین‏ نقش‏ مهمی‏ در‏ توسعه‏ بیماری‏ توسط ‏F. oxysporum‏‏ داشته (7‏ و‏ 8) و‏ به‏ عنوان‏ یک‏ نامزد‏ مناسب‏ از‏ علف‏‏کش‏های‏ زیستی‏ در‏ مزارع‏ تک‏ لپه‏‏ای‏ به‏ ویژه‏ مزارع‏ غلات‏ مثل‏ گندم، برنج، جو، ذرت‏ و‏... معرفی‏ شده‏ است‏ (7‏ و‏ 9).

هدف‏ از‏ انجام‏ این‏ پژوهش‏ که‏ برای‏ نخستین‏ بار‏ انجام‏ می‌شود‏، تولید‏ پروتئین‏ نوترکیب‏ Nep1‏ به‏ عنوان‏ یک‏ عامل‏ زیستی‏ توانمند‏ برای‏ کنترل‏ علف‌های‏ هرز‏ دو‏ لپه‌ای‏ در‏ مزارع‏ غلات‏ تک‏ لپه‌ای‏ است. در‏ این‏ میان‏ از‏ علف‏ هرز‏C. arvensisبه‏ عنوان‏ یک‏ علف‏ هرز‏ مقاوم‏ و‏ رایج‏ در‏ مزارع‏ غلات‏ تک‏ لپه‌ای‏ مثل‏ گندم‏ و‏ جو‏ برای‏ ارزیابی‏ فعالیت‏ پروتئین‏ نوترکیب‏ تولید‏ شده‏ استفاده‏ شد.

 

.مواد‏ و‏ روش‏ها

.کشت‏ قارچ‏ و‏ استخراج‏ RNA: به‏ منظور‏ کشت‏ قارچ‏ از‏ Fusarium oxysporum‏‏‏ f. sp. lycopersici UTMC01733‏ ‏(تهیه‏ شده‏ از‏ کلکسیون‏ میکروارگانیسم‏های‏ ‏‏دانشگاه‏ تهران[5]) در‏ محیط‏ زاپکس‏ داکس‏ برات[6]‏ همراه‏ با‏ یک درصد کازو‏ آمینواسید‏ به‏ مدت‏ 4‏ روز،‏ در‏ دمای‏ 30‏ درجه‏ سانتی‏گراد‏ و‏ 200‏ دور‏ در‏ دقیقه‏ استفاده‏ شد. در‏ روز‏ چهارم‏ مقدار‏ 200‏ میلی‏‏‏‏گرم‏ از‏ میسلیوم‏ قارچی‏ در‏ هاون‏ سرد‏ شستشو‏ داده،‏ با‏ اتانول‏ ریخته‏ شد‏ و‏ به‏ آن‏ گوانیدین‏ ایزوتیوسیانات‏ 4/5‏ مولار‏ با‏ اسیدیته 5/6‏ به‏ همراه‏ نیتروژن‏ مایع‏ اضافه‏ و تا‏ رسیدن‏ به‏ یک‏ پودر‏ نرم‏ به‏ خوبی‏ خرد‏ شد. به‏ منظور‏ استخراج‏ RNA، محلول‏ سلول‏های‏ خرد‏ شده‏ به‏دست‏ آمده‏ از‏ مرحله‏ قبل پس ‏‏از‏ هوموژن‏ کردن‏ در‏ 75000‏ دور‏ در‏ دقیقه‏ با‏ هموژنایز‏ (هایدولف- آلمان‏ مدل‏ سایلنت‏ کروشر- اس[7]‏) با‏ کیت‏ استخراج‏ RNA‏ با‏ خلوص‏ بالا[8]‏ شرکت روشه‏ آلمان[9]‏ استخراج‏ شد.

.ساخت‏ cDNA‏ و‏ انجام‏ RT- PCR: مقدار دو‏ میکرولیتر‏ از‏ RNA‏ استخراج‏ شده‏ به‏ منظور‏ ساختن‏ cDNA‏ تک‏ رشته‏ توسط‏ کیت‏ اکسپند‏ ریورس‏ ترانس‏ کریپتاز[10]‏ شرکت‏ روش‏ آلمان‏ استفاده شد. cDNA‏ ساخته‏ شده‏ در‏ ادامه‏ برای‏ تکثیر‏ ژن‏ nep1‏ با‏ استفاده‏ از‏ پرایمر‏های‏ ‏‏اختصاصی‏ ژن‏ استفاده شد. برای‏ انجام‏ PCR‏ از‏ پرایمر‏ اختصاصی‏ ژن‏ رفت:

.5´CATATGGCCGTAGTTAACCAT3´.

با‏ جایگاه‏ برش‏ آنزیمی‏ NdeI‏ و‏ پرایمر‏ اختصاصی‏ ژن‏ برگشت:‏

.5´GGATCCTCAGGACCAGGCCTT3´‏.

با‏ جایگاه‏ برش‏ آنزیم‏ BamHI‏ استفاده‏ شد. چرخه‏‏های‏ PCR‏ انجام‏ شده‏ برای‏ تکثیر‏ ژن‏ nep1شامل‏ مرحله‏ واشرست‏ در‏ دمای‏ 94‏ درجه‏ سانتی‏گراد‏ به‏ مدت‏ 30‏ ثانیه، دمای‏ اتصال‏ پرایمر‏ 60‏ درجه‏ سانتی‏گراد‏ به‏ مدت‏ 30‏ ثانیه‏ و‏ دمای‏ پلیمریزاسیون‏ 72‏ درجه‏ سانتی‏گراد‏ به‏ مدت‏ 90‏ ثانیه‏ و‏ به‏ شکل‏ 30‏ چرخه‏ انجام‏ شد. محصول‏ PCR‏ به‏ منظور‏ تایید‏ ژن‏ جداسازی‏ شده‏ توسط‏ شرکت‏ ماکروژن‏ (کره‏ جنوبی) تعیین‏ توالی‏ شد‏ (10).

.کلونینگ‏ ژن‏ nep1:محصول‏ PCR‏ به‏ دست‏ آمده‏ به‏ شکل انتهای‏ صاف‏ در‏ ابتدا‏ درون‏ حامل‏ pUC19‏ کلون‏‏ و‏ با‏ روش‏ شوک‏ حرارتی‏ و‏ تیمار‏ با‏ CaCl2به‏ داخل‏ سلول‏های‏ ‏‏شایسته‏ E. coli نوا- بلو[11]‏ انتقال‏ داده‏ شد. پلاسمید‏ نوترکیب‏ از‏ کلونی‏های‏ سفید‏ استخراج‏ شده‏ و‏ با‏ آنزیم‏های‏ ‏‏NdeI‏ و‏ BamHI‏ شرکت‏ فرمنتاس‏ بریده‏ شد. ژن‏ nep1بریده‏ شده‏ از‏ روی‏ ژل‏ خالص‏سازی‏ ‏‏شد. برای‏ تولید‏ کلون‏های‏ ‏‏نهایی‏ واکنش‏ اتصال‏ بین‏ حامل‏ بیانی‏ pET16b‏ بریده‏ شده‏ با‏ آنزیم‏های‏ ‏‏NdeI‏ و‏ BamHI‏ با‏ قطعه‏ nep1با‏ انتهای‏ چسبنده‏ مرحله‏ قبل‏ انجام‏ شد. برای‏ انتقال‏ به‏ میزبان‏ نهایی‏ از‏ روش‏ شوک‏ حرارتی‏ و‏ تیمار‏ با‏ CaCl2استفاده‏ شد‏ و‏ محصول‏ واکنش‏ لیگاسیون‏ به‏ میزبان‏ بیانی‏ (DE3) BL21 E. coli انتقال‏ داده‏ شد. از‏ کلون‏های‏ ‏‏نوترکیب،‏ پلاسمید‏ استخراج‏ و‏ برای‏ تایید‏ نهایی‏ انجام‏ صحیح‏ فرایند‏ کلونینگ‏ به‏ شرکت‏ ماکروژن‏ (کره‏ جنوبی) ارسال‏ شد‏ (10).

.تولید‏ پروتئین‏ Nep1‏ نوترکیب‏ و‏ خالص‏سازی‏ ‏‏آن: در‏ ابتدا‏ باکتری‏ نوترکیب‏ داخل‏ محیط‏ کشت‏ LB‏ همراه‏ با‏ 100‏ میکروگرم‏ در‏ میلی‏‏‏‏لیتر‏ از‏ آمپی‏سیلین‏، دمای‏ 37‏ درجه‏ سانتی‏گراد‏ و‏ دور‏ همزن‏ 200‏ دور‏ در‏ دقیقه‏ کشت‏ داده‏ شد‏ و‏ پس‏ از‏ اینکه‏ میزان‏ جذب‏ در‏ طول‏ موج‏ 600‏ نانومتر‏ به‏ حدود‏ 5/0‏ رسید،‏ یک‏ میلی‏‏‏‏مولار‏ از‏ محلول‏ IPTG[12]‏ برای‏ القای‏ بیان‏ ژن‏ به‏ آن‏ افزوده‏ شد. پس‏ از‏ القای‏ باکتری‏‏ها به‏ مدت‏ 5‏ ساعت‏ در‏ همان‏ دور‏ و‏ دما، روی‏ شیکر‏ قرار‏ داده‏ شدند. باکتری‌های‏ آماده‏ شده‏ در‏ ادامه‏ به‏ مدت‏ 10‏ دقیقه‏ در‏ 4000‏ دور‏ در‏ دقیقه‏ سانتریفیوژ‏ و‏ رسوب‏ سلولی‏ دو‏ بار‏ با‏ محلول‏ سرم‏ فیزیولوژی‏ شستشو‏ داده‏ شدند. برای‏ لیز‏ سلول‏‏ها به‏ رسوب‏ سلولی‏ 100‏ میکروگرم‏ در‏ میلی‏‏‏‏لیتر‏ از‏ پودر‏ لیزوزیم‏ به‏ همراه‏ مهار‏ کننده‏ پروتئاز‏ [13]PMSF‏ با‏ غلظت‏ 1/0‏ میلی‏‏‏‏مولار‏ اضافه‏ و‏ 30‏ دقیقه‏ در‏ دمای‏ 37‏ درجه‏ سانتی‏گراد‏ نگهداری‏ شد. با‏ توجه‏ به‏ بیان‏ برچسب‏ هیستیدینی‏ در‏ ابتدای‏ پروتئین‏ نوترکیب‏ برای‏ خالص‏سازی‏ ‏‏پروتئین‏ از‏ ستون‏های‏ ‏‏کروماتوگرافی
NI- NTI[14]‏ و‏ کیت‏ استخراج‏ پروتئین‏ شرکت‏ کیاژن[15] استفاده‏ شد. از‏ روش‏ SDS- PAGE‏ به‏ منظور‏ بررسی‏ تولید‏ و‏ خالص‏سازی‏ ‏‏پروتئین‏ نوترکیب‏ تولید‏ شده‏ استفاده‏ شد‏ (10).

.کشت‏ گیاه‏ و‏ سنجش‏ فعالیت‏ زیستی‏ پروتئین‏ نوترکیب‏ تولید‏ شده: بذر‏ گیاه‏ هرز‏ C. arvensisاز‏ شرکت‏ ورتا‏ صنعت‏ اصفهان‏ تهیه‏ شد‏ و‏ در‏ شرایط‏ گلخانه‏‏ای‏ درون‏ گلدان‏های‏ ‏‏10‏ سانتی‏ متر‏ کشت‏ داده‏ شد. گیاه‏ بالغ‏ 8 تا 10 هفته‏‏ای‏ به‏ منظور‏ ارزیابی‏ فعالیت‏ زیستی‏ پروتئین‏ نوترکیب‏ تولید‏ شده‏ استفاده شد. به‏ منظور‏ تعیین‏ غلظت‏ پروتئین‏ تولید‏ شده‏ از‏ روش‏ برادفورد‏ استفاده‏ شد. از‏ آلبومین‏ سرم‏ انسانی‏ به‏ منظور‏ رسم‏ منحنی‏ استاندارد‏ و‏ تعیین‏ غلظت‏ پروتئین‏ استفاده‏ شد. پروتئین‏ خالص‏سازی‏ ‏‏شده‏ در‏ محلول‏ Tris- HCl‏ با‏ غلظت‏ 1/0‏ میلی‏‏‏‏مولار‏ رقیق‏سازی‏ ‏‏شد‏ و‏ مقدار‏ 2‏ میلی‏‏‏‏لیتر‏ از‏ پروتئین‏ رقیق‏ شده‏ با‏ غلظت‏ نهایی‏ 60‏ میکروگرم‏ در‏ میلی‏‏‏‏لیتر‏ در‏ بین‏ ساعت‏های‏ ‏‏10 تا14‏ به‏ سطح‏ برگ‏های‏ ‏‏گیاه‏ بالغ‏ اسپری‏ شد. از‏ اسپری محلول‏ Tris- HCl‏ با‏ غلظت 1/0‏ میلی‏‏‏‏مولار‏ به‏ عنوان‏ شاهد‏ بر‏ سطح‏ گیاه‏ اسپری‏ شد. تمامی‏ سنجش‏های‏ ‏‏گیاهی‏ دو‏ بار‏ و‏ هر‏ بار‏ روی‏ سه‏ گیاه‏ مستقل‏ انجام‏ شد.

 

.نتایج

.جداسازی‏ ژن‏ nep1‏ از‏ قارچ‏ Fusarium oxysporum: ژن‏ nep1قارچی‏ دارای‏ یک‏ اینترون‏ 58‏ نوکلئوتیدی‏ است‏ که‏ در‏ میان‏ دو‏ اگزون‏ قرار‏ گرفته‏ است. به‏ همین‏ منظور‏ برای‏ جداسازی‏ ژن‏ از‏ واکنش‏ RT- PCR‏ استفاده‏ شد. پس‏ از‏ جداسازی‏ RNA‏ و‏ انجام‏ واکنش‏ RT- PCR‏ با‏ پرایمرهای‏ اختصاصی‏ ژن‏ nep1، یک‏ قطعه‏ حدود‏ 700‏ نوکلئوتیدی‏ جداسازی‏ شد‏ که‏ در‏ شکل‏ 1‏ مشاهده‏ می‏‏شود. قطعه‏ جداسازی‏ شده پس ‏‏از‏ خالص‏سازی‏ ‏‏تعیین توالی‏ شد‏ که‏ نتایج‏ انطباق‏ توالی‏ به‏ دست‏ آمده‏ با‏ توالی‏ ثبت‏ شده‏ در‏ بانک‏ ژنی[16]‏ 99‏ درصد‏ هومولوژی‏ بین‏ ژن‏ جداسازی‏ شده‏ با‏ ژن‏ nep1جداشده‏ از‏ F. oxysporum‏‏ با‏ شماره‏ دسترسی‏ AF036580‏ را‏ نشان‏ داد.

 

 

شکل1- ژل‏ الکتروفورز‏ آگاروز‏ واکنش‏ جداسازی‏ ژن‏ nep1‏ با‏ واکنش‏ RT- PCR‏. ردیف‏ 1‏ DNA‏ سایز‏ مارکر[17]‏ از‏ شرکت‏ فرمنتاس‏ و‏ ردیف‏ 2‏ باند‏ به‏ دست‏ آمده‏ از‏ واکنش‏ RT- PCR‏ با‏ طول‏ حدود‏ 700‏ نوکلئوتید‏ را‏ نشان‏ می‏‏دهد.

 

تولید‏ و‏ خالص‏سازی‏ ‏‏پروتئین: به‏ منظور‏ تولید‏ پروتئین‏ نوترکیب‏ و‏ خالص‏سازی‏ ‏‏آن‏ از‏ روش‏ SDS- PAGE‏ استفاده‏ شد. در‏ این‏ مرحله‏ به‏ منظور‏ بررسی‏ تولید‏ پروتئین‏ نوترکیب، سوپ‏ سلولی‏ تهیه‏ شده‏ از‏ سلول‏های‏ ‏‏القا‏ شده‏ نوترکیب‏ همراه‏ با‏ سلول‏ (DE3) BL21 E. coli حاوی‏ پلاسمید‏ pET16b، اما‏ بدون‏ ژن‏ nep1به‏ عنوان‏ شاهد‏ منفی‏ روی‏ SDS- PAGE‏ انتقال‏ داده‏ شد‏ که‏ نتایج‏ به‏ دست‏ آمده‏ در‏ شکل‏ 2‏ ردیف‏های‏ ‏‏2‏ و‏ 3‏ مشاهده‏ می‏‏شود. با‏ توجه‏ به‏ این‏ شکل‏ در‏ ردیف‏ شماره‏ 2‏ که‏ به‏ عنوان‏ شاهد‏ منفی‏ پروتئین‏های‏ ‏‏سوپ‏ سلولی‏ استفاده‏ شده‏ بیان‏ پروتئین‏ شاخصی‏ در‏ حدود‏ 25‏ کیلو‏ دالتون‏ مشاهده‏ نمی‏‏شود، در‏ مقابل‏ در‏ ردیف‏ 3‏ بین‏ باندهای‏ 20‏ تا‏ 27‏ کیلو‏ دالتون‏ بیان‏ یک‏ پروتئین‏ به‏ صورت‏ شاخص‏ افزایش‏ یافته‏ است. با‏ توجه‏ به‏ اینکه‏ NLPs‏ حدود‏ 22‏ تا‏ 28‏ کیلودالتون‏ وزن‏ دارند. این‏ باند‏ مورد‏ نظر‏ احتمالاً‏ مربوط‏ به‏ پروتئین‏ نوترکیب‏ تولید‏ شده‏ است.

 

 

شکل‏ 2-‏ تصویر‏ ژل‏ SDS- PAGE‏ مربوط‏ به‏ خالص‏سازی‏ ‏‏پروتئین‏ Nep1. ردیف‏ 1:‏ پروتئین‏ سایز‏ مارکر[18]‏ شرکت‏ فرمنتاس،
ردیف2:‏ سوپ‏ لیزشده‏ سلولی‏ از‏ باکتری‏ (DE3) BL21 E. coli حاوی‏ pET16b‏ و‏ بدون‏ ژن‏ nep1‏ به‏ عنوان‏ شاهد‏ منفی،

ردیف‏ 3‏:‏ سوپ‏ لیزشده‏ سلولی‏ از‏ باکتری (DE3)  BL21 E. coli حاوی‏ پلاسمید‏ نوترکیب‏ pET16b/nep1‏،

ردیف‏ 4:‏ پروتئین‏ خالص‏سازی‏ ‏‏شده‏ با‏ وزن‏ تقریبی‏ 25‏ کیلو‏ دالتون.

 

در‏ ردیف‏ چهارم‏ از‏ شکل‏ 2‏ تصویر‏ پروتئین‏ خالص‏سازی‏ ‏‏با‏ نیکل‏ مشاهده‏ می‏‏شود. حضور‏ این‏ باند‏ پروتئینی‏ حدود‏ 24‏ کیلو‏ دالتونی‏ نشان‏ می‏‏دهد‏ که‏ احتمالاً‏ پروتئین‏ تولید‏ شده‏ در‏ ردیف‏ 3‏ در‏ سوپ‏ لیز‏ شده‏ سلولی‏ همان‏ پروتئین‏ نوترکیب‏ Nep1‏ است.


.بررسی‏ فعالیت‏ زیستی‏ پروتئین‏ تولید‏ شده‏ روی‏ گیاه C. arvensis: به‏ دنبال‏ تولید‏ پروتئین‏ نوترکیب‏ Nep1‏ و‏ تعیین‏ غلظت‏ آن‏ با‏ روش‏ براد‏ فورد، میزان 2‏ میلی‏‏‏‏لیتر‏ از‏ پروتئین‏ با‏ غلظت60‏ میکروگرم‏ در‏ میلی‏‏‏‏لیتر‏ بر‏ سطح‏ برگ‏های‏ ‏‏گیاه‏ بالغ‏ پیچک‏ صحرایی‏ اسپری‏ شد. نتایج‏ بررسی‏ فعالیت‏ زیستی‏ پروتئین‏ تولید‏ شده‏ در‏ شکل‏ 3‏ مشاهده‏ می‏‏شود. براساس نتایج به دست آمده، پس ‏‏از‏ اسپری‏ پروتئین‏ به‏ سطح‏ گیاه پس ‏‏از‏ گذشت‏ 2‏ روز‏ نشانه‌های‏ کلروز‏ و‏ زردی‏ و‏ به‏ دنبال‏ آن‏ نکروز‏ بر‏ روی‏ گیاه‏ ظاهر‏ شد‏ و پس ‏‏از‏ 5‏ روز‏ نکروز‏ کامل‏ و‏ مرگ‏ گیاه‏ مشاهده‏ شد. در‏ مورد‏ آزمایش‏ شاهد، یک‏ گیاه‏ تنها‏ با‏ بافر‏ و‏ بدون‏ پروتئین‏ نوترکیب‏ به‏ عنوان‏ شاهد‏ منفی‏ تیمار‏ شده‏ بود‏ و‏ یک‏ گیاه‏ دیگر‏ با‏ 2‏ میلی‏‏‏‏لیتر‏ از‏ پروتئین‏ با‏ غلظت‏ 60 میکروگرم‏ در‏ میلی‏‏‏‏لیتر‏ که‏ قبل‏ از‏ تیمار‏ محلول‏ پروتئینی‏ به‏ مدت‏ 15‏ دقیقه‏ تیمار‏ حرارتی‏ در‏ 100‏ درجه‏ سانتی‏گراد‏ انجام‏ شد. در‏ مورد‏ هر‏ دو‏ گیاه‏ شاهد پس ‏‏از‏ گذشت‏ 5‏ روز‏ هیچگونه‏ علامتی‏ از‏ نکروز‏ و‏ مرگ‏ گیاه‏ مشاهده‏ نشد.

همان‏گونه‏ که‏ در‏ شکل‏ 3‏ مشاهده‏ می‌شود‏ گیاه‏ تیمار‏ شده‏ با‏ پروتئین‏ نوترکیب‏ Nep1‏ دچار‏ آسیب‏ جدی‏ شده‏ و‏ تیمار‏ گیاه‏ هرز‏ با‏ این‏ عامل‏ زیستی پس ‏‏از‏ 5‏ روز‏ باعث‏ مرگ‏ کامل‏ آن‏ شده‌است.

 

 

 

 

شکل3-‏ در‏ شکل‏ الف- 1‏ گیاه‏ شاهد‏ که‏ فقط‏ با‏ بافر‏ اسپری‏ شده‏ است‏ مشاهده‏ می‏‏شود. در‏ شکل‏ الف- 2‏ تصویر‏ گیاه‏ مورد‏ آزمایش‏ دو‏ روز پس ‏‏از‏ تیمار‏ با‏ پروتئین‏ نوترکیب‏ Nep1‏ مشاهده‏ می‏‏شود. در‏ شکل‏ ب- 1‏ گیاه‏ شاهد‏ و‏ در‏ شکل‏ ب- 2‏ گیاه‏ مورد‏ آزمایش‏ در‏ روز‏ پنجم‏ مشاهده‏ می‏‏شود. ج-‏ تصویر‏ شروع‏ نکروز‏ در‏ برگ‏ گیاه‏ پیچک‏ صحرایی‏ 24‏ ساعت پس ‏‏از‏ اسپری‏ پروتئین‏ نوترکیب‏ Nep1. در‏ شکل‏ د- 1‏ برگ‏ جدا‏ شده‏ گیاه‏ شاهد‏ پیچک‏ و‏ در‏ شکل‏ د- 2‏ برگ‏ گیاه‏ تیمار‏ شده‏ با‏ Nep1‏ نوترکیب‏ در‏ روز‏ چهارم‏ مشاهده‏ می‏‏شود. در‏ شکل‏ ﻫ- 1 و‏ ﻫ- 2‏ گیاه‏ شاهد‏ اسپری‏ شده‏ با‏ پروتیئن‏ Npe1‏ نوترکیب‏ تقلیب‏ شده‏ با‏ حرارت‏ به‏ ترتیب‏ در‏ روز‏ اول‏ و‏ پنجم‏ مشاهده‏ می‏‏شود.

 

بحث‏ و‏ نتیجه‏‏ گیری.

پروتئین‏ Nep1‏ یک‏ پروتئین‏ ترشحی‏ قارچی‏ با‏ وزن‏ حدود‏ 25‏ کیلودالتون‏ و‏ دارای‏ یک‏ سیگنال‏ نشانه‏ 31‏ اسیدآمینه‏ در‏ انتهای‏ آمینی‏ و‏ یک‏ اینترون‏ به‏ طول‏ 58‏ نوکلئوتید‏ است‏ (8‏ و 11). در‏ این‏ پژوهش،‏ با‏ طراحی‏ پرایمر‏ اختصاصی‏ و‏ انجام‏ واکنش‏ RT-PCR‏ توالی‏ اینترون‏ و‏ سیگنال‏ نشانه‏ از‏ ژن‏ nep1حذف‏ شد و‏ یک‏ قطعه‏ حدود‏ 700‏ نوکلئوتیدی‏ مربوط‏ به‏ ORF‏ پروتئین‏ Nep1‏ قارچی‏ به‏ دست‏ آمد‏ (شکل 1). کلون‏ نهایی‏ ژن‏ جدا‏ شده‏ در‏E. coliبیانی‏ باعث‏ تولید‏ بسیار‏ زیاد‏ پروتئین‏ نوترکیب‏ Nep1‏ (حدود 17‏ میلی‏‏‏‏گرم‏ در‏ لیتر) شد‏ (شکل 2). در‏ پژوهش‏های‏ ‏‏انجام‏ شده‏ قبلی‏ پروتئین‏ نوترکیب‏ Nep1‏ در‏ مخمر‏ pastorisPichia به‏ شکل نوترکیب‏ تولید‏ شده‏ بود، ولی‏ به‏ میزان‏ تولید‏ پروتئین‏ اشاره‏ نشده‏ و‏ هدف‏ از‏ تولید‏ پروتئین‏ بررسی‏ فعالیت‏ آن‏ روی‏ سلول‏های‏ ‏‏گیاهی‏ بوده‏ و فعالیت‏ علف‏‏کشی‏ آن‏ بررسی‏ نشده‏ بود‏ (12). در‏ این‏ پژوهش‏، با‏ به‏ کارگیری‏ روش‏ خالص‏سازی‏ ‏‏با‏ یون‏های‏ ‏‏نیکل‏ پروتئین‏ نوترکیب‏ به‏ شکل‏ خالص‏ تولید‏ شد‏ (شکل‏ 2). از‏ مزایای‏ این‏ روش‏ خالص‏سازی‏ ‏‏می‏‏توان‏ به‏ خالص‏سازی‏ ‏‏سریع‏ و‏ پربازده‏ پروتئین‏ نوترکیب‏ اشاره‏ کرد.

استفاده‏ از‏ پروتئین‏ Nep1‏ به‏ عنوان‏ علف‏کش‏ زیستی‏ توسط‏ سایر‏ دانشمندان‏ نیز‏ مورد‏ توجه‏ قرار‏ گرفته‏ است‏ و‏ کوشش‏هایی‏ برای‏ استفاده‏ از‏ قارچ‏ مولد‏ و‏ یا‏ پروتئین‏ تولید‏ شده‏ توسط‏ قارچ‏ به‏ عنوان‏ علف‏کش‏ زیستی‏ انجام‏ شده‏ است‏ (13‏ و‏ 14). همچنین‏، در‏ پژوهش‏ دیگر‏ انجام‏ شده‏ آثار‏‏‏ علف‏کشی‏ پروتئین‏ Nep1‏ روی‏ گیاه‏ خردل‏ وحشی‏ ارزیابی و عنوان‏ شد‏ که‏ می‏‏توان‏ از‏ این‏ علف‏کش‏ زیستی‏ برای‏ کنترل‏ آن‏ استفاده‏ کرد‏ (15). قارچ‏ F. oxysporum‏‏به‏ تنهایی‏ به‏ عنوان‏ علف‏کش‏ زیستی‏ علیه‏ برخی‏ از‏ علف‏‏ها از‏ جمله:
obtusifoliaCassia، occidentalis‏‏ Cassia و‏ exaltataSesbania‏ به‏ کار برده‏ شده‏ است.‏ اما‏ نکته‏‏ای‏ که‏ این‏ پژوهش‏ را‏ نسبت‏ به‏ سایر‏ پژوهش‏های‏ ‏‏انجام‏ شده‏ برجسته‏ می‏کند، این‏ است‏ که‏ در‏ این‏ پژوهش‏ از‏ پروتئین‏ نوترکیب‏ تولید‏ شده‏ استفاده‏ شده‏ است‏ که‏ مشکلات‏ استفاده‏ از‏ قارچ‏ طبیعی‏ را‏ از‏ جمله‏ نیازمندی‏ به‏ میزبان‏ اختصاصی، رطوبت‏ بالا‏ برای‏ تندش‏ اسپور‏ قارچ‏ و‏ آلودگی‏ مزارع‏ مجاور‏ با‏ قارچ‏ بیماری‏زای
F. oxysporum‏‏را‏ ندارد‏ (9‏ و‏ 18). همچنین‏، میزان‏ تولید‏ پروتئین‏ نوترکیب‏ در‏ این‏ پژوهش‏ حدود 17‏ میلی‏‏‏‏گرم‏ در‏ لیتر‏ بوده‏ است‏ که‏ در‏ مقایسه‏ با‏ پروتئین‏ تولید‏ شده‏ توسط‏ قارچ‏ F. oxysporum‏‏بسیار‏ بیشتر‏ است؛‏ و‏ برای‏ اولین‏ بار‏ در‏ این‏ پژوهش‏ از‏ یک‏ علف‏کش‏ زیستی‏ برای‏ کنترل‏ گیاه‏ هرز‏ پیچک‏ صحرایی‏ استفاده‏ شده‏ است. همان‏گونه‏ که‏ اشاره‏ شد‏ برای‏ کنترل C. arvensis در‏ مزارع‏ به‏ طور‏ رایج‏ از‏ سموم‏ شیمیایی‏ نظیر‏ 2,4-D و MCPA‏ استفاده‏ می‏‏شود. گزارش‏ شده‏ مصرف‏ این‏ سموم‏ در‏ بعضی‏ از‏ کشورها‏ مانند‏ دانمارک‏ سبب‏ افزایش‏ نرخ‏ سرطان‏ شده‏ است. همچنین،‏ در‏ پژوهشی‏ که‏ توسط‏ سادلورا‏ [xix]و‏ همکاران‏ انجام‏ شده‏ سمیت‏ این‏ آفت‏کش‏ بر‏ حیوانات‏ نیز‏ گزارش‏ شده‏ است (16). در‏ گزارشی‏ دیگر‏ افزایش‏ خطر‏ این‏ آفت‏کش‏ بر‏ روی‏ انسان‏ و‏ محیط‏ بیان‏ شده‏ است (17). این‏ علف‏کش‏‏ها فرار‏ بوده‏ و‏ انتقال‏ آن پس ‏‏از‏ مصرف‏ موجب‏ بروز‏ خسارت‏ بر‏ روی‏ مزارع‏ مجاور‏ در‏ گونه‏های‏ ‏‏زراعی‏ پهن‏ برگ‏ (به‏ ویژه‏ مزارع‏ چغندرقند، پنبه، کلم، سبزی‏ و‏ محصولات‏ صیفی، باغ‏های‏ ‏‏گلابی، تاکستان‏ها‏ و‏ غیره) می‏ شود. MCPA به‏ راحتی‏ توسط‏ گیاهان‏ جذب‏ می‏‏شود‏ و‏ مقدار‏ باقیمانده‏ از‏ این‏ سم‏ در‏ محصولات‏ غذایی‏ باعث‏ افزایش‏ نگرانی‏ در‏ مورد‏ سلامت‏ بشر‏ می‏‏شود، تا‏ حدی‏ که‏ آژانس‏ بین‏ المللی‏ پژوهش‏ بر‏ روی‏ سرطان،‏ این‏ علف‏کش‏ را‏ به‏ عنوان‏ یک‏ عامل‏ سرطان‏زا‏ معرفی‏ کرده‏ است‏ (16). در‏ این‏ پژوهش،‏ برای‏ اولین‏ بار‏ کنترل‏ زیستی‏ C. arvensis‏‏ به‏ روش‏ زیستی‏ و‏ با‏ پروتئین‏ نوترکیب‏ Nep1‏ مطالعه‏ شد. نتایج‏ به‏دست‏ آمده‏ از‏ این‏ پژوهش‏ نشان‏ می‏هد‏ که‏ می‌توان‏ پروتئین‏ نوترکیب‏ Nep1‏ را‏ به‏ عنوان‏ یک‏ عامل‏ زیستی‏ توانمند‏ برای‏ کنترل‏ علف‏ هرز‏ پیچک‏ صحرایی‏ استفاده‏ کرد.



[1]- 2,4-Dichlorophenoxyacetic acid

[2]- 2-methyl-4-chlorophenoxyacetic acid

[3]- Necrosis and ethylene inducing protein1

[4]- Bailey

[5]- University of Tehran Microorganisms Collection (UTMC)

[6]- Czapek-Dox broth

[7]- Heidolph-Germany- Silent crusher S

[8]- High Pure RNA Extraction

[9]- Roche -Germany

[10]- Expand reverse Transcriptase

[11]- E. coli novablue

[12]- Isopropyl-β-D-thiogalactoside

[13]- phenylmethanesulfonyl fluoride or phenylmethylsulfonyl fluoride

[14]- Nickelnitrilotriacetic acid agarose

[15]- Qiagen

[16]- NCBI-GenBank

[17]- DNA Size marker

[18]- Protein size marker

[xix]- Sadlohora

 

 

 

(1)     Saxena‏ S.,‏ Pandey‏ AK. Microbial‏ metabolites‏ as‏ eco- friendly‏ agrochemicals‏ for‏ the‏ next‏ millennium. Applied‏ microbiology‏ and‏ biotechnology‏ 2001;‏ 55 (4): 395- 403.

(2)     Hoagland‏ R.,‏ Boyette‏ C.,‏ Weaver‏ MA.,‏ Abbas‏ HK. Bioherbicides:‏ Research‏ and‏ risks. Toxin‏ Reviews 2007;‏ 26 (4): 313- 42.

(3)     Ash‏ GJ. The‏ science.,‏ art‏ and‏ business‏ of‏ successful‏ bioherbicides. Biological Control‏ 2010;‏ 52 (3): 230- 40.

(1)     Davison‏ JG. Control‏ of‏ the‏ bindweeds‏ Convolvulus arvensis‏ and‏ Calystegia sepium‏ in‏ fruit‏ crops. Pesticide Science 1976;‏ 7 (5): 429- 435.

(2)     Crafts‏ AS., Kennedy‏ PB. The‏ physiology‏ of‏ Convolvulus Arvensis‏ (morning- glory‏ of‏ bindweed) in‏ relation‏ to‏ its‏ control‏ by‏ chemical‏ sprays. Plant‏ Physiology‏ 1930;‏ 5 (3):‏ 329- 44.

(3)     Bailey‏ BA. Purification‏ of‏ a‏ protein‏ from‏ culture‏ filtrates‏ of‏ Fusarium oxysporum‏ that‏ induces‏ ethylene‏ and‏ necrosis‏ in‏ leaves‏ of‏ Erythroxylum coca. Phytopathology 1995;‏ 85: 1250- 55.

(4)     Bailey BA.,‏ Apel- birkhold‏ PC.,‏ Luster‏ DG. Expression‏ of‏ NEP1‏ by‏ Fusarium oxysporum f. sp‏. erythroxyli‏ after‏ gene‏ replacement‏ and‏ overexpression‏ using‏ polyethylene‏ glycol- mediated‏ transformation. Phytopathology 2002;‏ 92 (8): 833- 41.

(5)     Gijzen‏ M.,‏ Nurnberger‏ T. Nep1- like‏ proteins‏ from‏ plant‏ pathogens:‏ Recruitment‏ and‏ diversification‏ of‏ the‏ NPP1‏ domain‏ across‏ taxa‏ Phytochemistry. Phytochemistry 2006;‏ 67 (16): 1800- 07.

(6)     Amsellem Z.,‏ Cohen‏ BA.,‏ Greaael‏ J. Engineering‏ hyper- virulence‏ in‏ a‏ mycoherbicide‏ fungus‏ for‏ efficient‏ weed‏ control. Nature biotechnology 2002;‏ 20 (10): 1035- 39.

(7)     Sambrook‏ j.,‏ Russell‏ DW. Molecular Cloning., A Laboratory Manual,‏ 3rd‏ ed. Cold‏ New York: Springr‏ Harbor‏ Laboratory‏ Press. 2001.

(8)     Jennungs‏ JC.,‏ Apel- birkhold‏ PC.,‏ Bailey‏ BA.,‏ Anderson‏ JD. Induction‏ of‏ ethylene‏ biosynthesis‏ and‏ necrosis‏ in‏ weed‏ leaves‏ by‏ a‏ Fusariumoxysporum‏ protein. Weed Science 2000;‏ 48 (1): ‏7- 14.

(9)     Schouten‏ A.,‏ Baarlen‏ PV.,‏ Van‏ Kan‏ JAL. Phytotoxic‏ Nep1- like‏ proteins‏ from‏ the‏ necrotrophic‏ fungus‏ Botrytis‏ cinerea‏ associate‏ with‏ membranes‏ and‏ the‏ nucleus‏ of‏ plant‏ cells. New‏ Phytologist 2008;‏ 177 (2): 493- 505.

(10)  Cechinl‏ A.,‏ Sinigalial‏ M.,‏ Lemke‏ N.,‏ Echeverrigaray‏ S.,‏ Cabrera‏ O.,‏ Perira‏ G.,‏ et al. Cupin:‏ A‏ candidate‏ molecular‏ structure‏ for‏ the‏ Nep1- like‏ protein‏ family. BMC‏ Plant‏ Biology 2008;‏ 8: 50- 63.

(11)  Clare‏ L.,‏ Pemberton‏ G.,‏ Salmond‏ GPC. The‏ Nep1- like‏ proteins‏ a‏ growing‏ family‏ of‏ microbial‏ elicitors‏ of‏ plant‏ necrosis. Molecular‏ Plant‏ Physiology 2004;‏ 5 (4): 353- 59.

(12)  Moghimi‏ H.,‏ Hamedi‏ J.,‏ Sepehrizadeh‏ Z.,‏ Ofoghi‏ H. Overexpression‏ of‏ recombinant‏ Nep1‏ in‏ Escherichia‏ coli‏ and‏ its‏ use‏ as‏ a‏ biological‏ agent‏ for‏ control‏ of‏ Sinapis‏ arvensis. Annals‏ of Microbiology 2013;‏ 63 (2): 669- 75.

(13)  Sadlonova‏ I.,‏ Hozova‏ R.,‏ Flaskarova‏ E. Adverse‏ effects‏ of‏ herbicide‏ MCPA‏ on‏ dogs‏ in‏ a‏ 90‏ day‏ toxicological‏ study. Neuro‏ Endocrinol‏ Letter‏ 2006: 108- 11.

(14)  Maria. Developmental‏ toxicity‏ of‏ a‏ commercial‏ herbicide‏ mixture‏ in‏ mice:‏ I. Effects‏ on‏ embryo‏ implantation‏ and‏ litter‏ size. Environ‏ Health‏ Perspect 2011;‏ 110 (11): 1081- 5.

(15)  Bailey‏ BA.,‏ Apel- birkhold‏ PC.,‏ Akingbe‏ OO.,‏ Ryan‏ JL.,‏ O’neill‏ NR.,‏ Anderson‏ JD. Nep1‏ protein‏ from‏ Fusarium‏ oxysporum‏ enhances‏ biological‏ control‏ of‏ opium‏ poppy‏ by‏ Pleospora‏ papaveracea. Phytopathology 2000;‏ 90 (8): 812- 18.