بررسی فعالیت ACC دآمیناز در ریزوباکتری‏های جدا شده از خاک‏های مناطق شمال کشور

نویسندگان

1 کارشناس ارشد میکروبیولوژی، هیات علمی جهاد دانشگاهی سازمان، تهران، ایران

2 کارشناس میکروبیولوژی، دانشگاه تهران، ایران

3 استاد میکروبیولوژی، دانشگاه شاهد، ایران

4 دکترای تخصصی ژنتیک، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، تهران، ایران

چکیده

مقدمه: باکتری‏های ریزوسفری محرک رشد گیاه که حاوی آنزیمِ (1- آمینـو سـیکلوپروپان -1- کربوکـسیلیک اسید) دآمیناز هستند، می‏توانند برای بهبود رشد گیاهان به‏ویژه تحت شرایط تنش محیطی کاربرد داشته باشند. این تحقیق با هدف بررسی توان سویه‏های بومی در تولید آنزیم ACCدآمیناز انجام گرفت‏‏.
مواد و روش‏‏ها: از 8 نمونه خاک ریزوسفری و غیر‏ریزوسفری، کشت به روش تهیه رقت‌های متوالی در محیط‏های اختصاصی تهیه شد. به منظور آزمون نیمه کمی توان تولید ACCدآمیناز در جدایه‏های به‏دست آمده، قطر کلونی‏ها در پلیت به روش لکه‏گذاری پس از مایه‏کوبی و گرماگذاری در روزهای 1، 2 و 5 ارزیابی شد. توانایی تولید آنزیم ACCدآمیناز در سویه‏های منتخب، با استفاده از تراکم نوری رشد در طول موج 504 نانومتر در محیط‏های مناسب ارزیابی شد. میزان فعالیت آنزیمACC‏ دآمیناز با تعیین غلظت آلفا کتوبوتیرات آزاد شده برای سویه‏های منتخب انجام گرفت. آزمون‌های بیوشیمیایی و میکروبیولوژیک برای شناسایی تمامی سویه‏های منتخب انجام شد. در نهایت، شناسایی سویه منتخب که دارای بیش‏ترین میزان فعالیت آنزیم بود، با تکثیر و تعیین توالی ژن 16S rRNAانجام گرفت.
نتایج: تعداد 445 جدایه، خالص شد و با آزمون نیمه کمی توان تولید ACC‏دآمیناز، تعداد 17سویه انتخاب شد. بر اساس توانایی جدایه‏ها در تولید آنزیم، 9 سویه انتخاب شد و نتایج شناسایی مقدماتی نشان داد که سویه‌های منتخب به جنس‏های Pseudomonas، Bacillusو گروهActinomycetesمتعلق هستند. بررسی میزان فعالیت آنزیم نشان داد که سویه 12  Kot با بیش‏ترین مقدار فعالیت آنزیم به میزان 4369/826 نانومول آلفا کتوبوتیرات/میلی‏گرم پروتئین/ ساعت، در گروه سودوموناس های فلورسنت و به گونه Pseudomonas brassicacearum متعلق هستند.
بحث و نتیجه‏گیری: با توجه به فعالیت در خور توجه آنزیم ACCدآمیناز در این سویه بومی به‏دست آمده (4369/826 نانومول آلفا کتوبوتیرات/میلی‏گرم پروتئین/ ساعت) در مقایسه با سویه‏های مشابه، می‏توان با بهینه‏سازی شرایط تولید آنزیم و تهیه فرمولاسیون مایه تلقیح بر پایه باکتری محرک رشد گیاه به منظور استفاده در مزرعه بهره گرفت.
 

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Study of ACC deaminase activity of Rhizobacteria isolated from soils of northern Iran

نویسندگان [English]

  • zeinab sadat Motesharrei 1
  • Hajar Mahmoodi 2
  • Parviz Owlia 3
  • Hassan Salimi 4
1 M.Sc of Microbiology, Academic member of ACECR (Tehran Organization), Iran
2 BSc of Microbiology, Tehran University, Iran
3 Professor of Microbiology, Shahed University, Tehran, Iran
4 Ph.D. of Genetics, NIGEB, Tehran, Iran
چکیده [English]

IntroductionPlant growth promoting rhizobacteria with ACC deaminase activity can be used for stimulating plant growth under tension situations. This study held to surveyed native bacteria having ACC deaminase activity.
Materials and methods: 8 (none) rhizospherial soils were cultured by preparing serial dilution in selective media. The isolates screened by semi quantity assay of determining ACC deaminase in which diagonal colony after inoculation and incubation was measured in first, second and fifth day. The ability of these strains in accdeaminase production was investigated by optical density of bacterial growth in 504nm. ACC deaminase activity was assayed by measuring the production of α-KB. The selected strains recognized by biochemical and microbiological tests and the best strain in production of ACCD was identified by PCR amplification and sequencing of 16s rRNA..
Results: 445 stains were isolated. Then, 17 stains were selected by semi quantity assay. Then, 9 strains belong to Bacillus and Pseudomonas genera and Actinomycete group, were selected based on their abilities in the enzymes production. The study of Acc deaminase activity showed Pseudomonas brassicacearum strain KOT12 belonged to the fluorescent pseudomonad group had highest activity (826/4369 nmol kb/mg pr/h).
Discussion and conclusion: Based on high production of ACCD in the selected isolate in comparison with other strains, this strain can be used for PGPR inoculums in the field by optimizing enzyme production and formulation.

کلیدواژه‌ها [English]

  • Accdeaminase
  • ACC
  • Selected strains

مقدمه

ریزوباکترهای محرک رشد گیاه بخش اصلی میکروارگانیسم‏های ریزوسفر را تشکیل می‌دهند. از مهم‏ترین مکانیسم‏هایی که باعث افزایش رشد و نمو گیاه می‏شوند، تولید و ترشح تنظیم کننده‏های رشد گیاهی[1] است (1). امروزه پژوهشگران تنظیم باکتریایی تولید اتیلن در گیاهچه‏های جوان را بهترین مکانیسم ریزوباکتری‏های محرک رشد گیاه در افزایش رشد گیاهان دانسته‏اند (2). در کشاورزی کنترل سطح اتیلن در گیاه از اهمیت زیادی برخوردار است. کنترل سطح اتیلن در گیاهان زراعی به ویژه در مواقعی که گیاه در معرض تنش قرار می‏گیرد می‏تواند از خسارت اقتصادی ناشی از افزایش غلظت اتیلن که باعث کاهش رشد و عملکرد گیاه می‏شود، جلوگیری کند. سازوکارهای متداول در کنترل سطح اتیلن در گیاهان شامل این موارد است: استفاده از بازدارنده‌های شیمیایی بیوسنتز و فعالیت اتیلن‏، تهیه ارقام موتانت گیاهی که به سطح بالای اتیلن حساسیت کمتری داشته باشند، تهیه گیاهان تراریخته‏ای که در شرایط تنش، اتیلن کمتری تولید کنند و به‏تازگی استفاده از برخی باکتری‏های محرک رشد گیاه که قادرند سطح اتیلن درون گیاه را کاهش دهند. با وجود این، استفاده از باکتری‏های محرک رشد گیاه، روشی است که بیشتر مورد پسند قرار گرفته است (3). در گیاهان عالی، پیش ماده اتیلن، ترکیب ACC[2] است. آنزیم ACC‏دآمیناز توسط تعداد زیادی از باکتری‏های محرک رشد گیاه و برخی از مخمرها و قارچ‏ها تولید می‏شود (4). آنزیم (1- آمینـو سـیکلوپروپان -1- کربوکـسیلیک اسید) دآمیناز مانع تبدیل ماده ACC به اتیلن شده و از اثرات بازدارنده رشد اتیلن تنشی که در پاسخ به تـنش‏هـای محیطـی در گیاه تولید می‏شود، جلوگیری می‏نماید. آنزیم ACC دآمیناز به این میکروارگانیسم‏ها امکان می‏دهد که از ACC به عنوان تنها منبع نیتروژن استفاده کند (4).

مواد و روش‏ها

از نواحی ریزوسفری و غیرریزوسفری گیاهان مناطق کومله، اطاقور، پرشکوه و لیلی‏کوه در شمال کشور (با عرض و طول جغرافیایی به ترتیب N"88/10 '10°37 وE"62/54'10°50 -N"00/34 '6°37وE"00/51 '6°50-N"21/39'8°37 وE "90/9 '10°50  -  N"30/20 '11°37وE"10/47 '8°50)، تعداد 8 نمونه خاک از عمق 20 تا 40 سانتی‏متری جمع‏آوری شد. نمونه‏برداری از ریزوسفر گیاهان شاداب و سالم و از درختانی که رشد و نمو بهتری داشتند انجام شد. کشت از نمونه‏های خاک به روش تهیه رقت‏های متوالی و پخش بر 3 نوع محیط کشت جامد DF  (5)، YM (6) وKing B (7) به‏وسیله میله سرکجِ استریل انجام شد. ترکیب اجزای محیط‏های کشت در جدول 1 آمده است. به سطح محیط‏های کشت بلافاصله قبل از تلقیح باکتری، 150 میکرولیتر از محلول آمونیوم سولفات 3/0 مولار اضافه شد. تمامی پلیت‏ها به مدت یک هفته در دمای28 درجه سانتی‏گراد‏ انکوبه شدند و روزانه رشد کلونی بر روی محیط‏های کشت بررسی و در نهایت کشت خالص به‏دست آمد.

آزمون نیمه کمی توان تولید آنزیم ACC‏دآمیناز

به منظور آزمون نیمه کمی توان تولید ACC‏دآمیناز در سویه‏های به‏دست آمده، آزمون‏‏ لکه‏گذاری در 3 حالت کنترل منفی (فاقد منبع نیتروژن)، کنترل مثبت (دارای منبع نیتروژن کلرید آمونیوم) و نمونه مورد بررسی (دارای منبع نیتروژن ACC) مشابه با روش خسروی و همکاران[3] (8) انجام گرفت. بدین‏منظور، کشت تازه از سویه‏های مورد نظر بر روی محیط‏های جامد DF، YM و King B تهیه شد و محیط‏های کشت مزبور به گونه‏ای که منابع نیتروژن در آن‏ها حذف شده بود، نیز در 3 سری آماده شد؛ در سری اول به سطوح محیط کشت بلافاصله قبل از تلقیح باکتری، 150 میکرولیتر از محلول 15/0 مولار ACC اضافه شد (محلول ACC کمی قبل از شروع از فریزر خارج و پس از ذوب شدن با یک میله شیشه‏ای سرکج استریل روی سطح پلیت پخش و در مدت کوتاهی خشک شد). در سری دوم به سطح محیط کشت 150 میکرولیتر کلرید‏آمونیوم 15/0 مولار اضافه شد (به عنوان شاهد مثبت) و در سری سوم هیچ منبع نیتروژنی به سطح محیط کشت اضافه نشد (به عنوان شاهد منفی). برای حذف منبع نیتروژن احتمالی موجود در آگار به‏کار رفته در محیط‏های کشت، آگار مرک[4] طبق روش ریان[5] (9) شستشو شد. از کشت تازه جدایه‏ها سوسپانسیونی معادل یک مک فارلند در سرم فیزیولوژی برای تلقیح تهیه شد. از هر سوسپانسیون میزان 2 میکرولیتر در خانه‏های مربوطه لکه‏گذاری شد. مایع‏تلقیح هر 3 سری پلیت با جدایه‏ها در یک زمان واحد انجام شد و پلیت‏ها در دمای 28 درجه سانتی‏گراد‏ برای یک هفته گرماگذاری شدند.

 

جدول 1- الف) ترکیب محیط کشت DF ب) محیط کشت YM ج) محیط کشت King B د) محیط کشت M9 در 1 لیتر آب مقطر

الف

KH2PO4

4 گرم

Na2HPO4

6 گرم

MgSO4 _ 7H2O

2/0 گرم

Glucose

2 گرم

FeSO4 _ 7H2O

1 میلی گرم

H3BO3

10 ماکروگرم

MnSO4 _H2O

19/11 ماکروگرم

ZnSO4 _ 7H2O

6/124 ماکروگرم

gluconic acid

2 گرم

citric acid

2 گرم

CuSO4 _ 5H2O

22/78 ماکروگرم

MoO3

10 ماکروگرم

 

ب

KHPO4_3H2O

65/0 گرم

NaCl

1/0 گرم

MgSO4 _ 7H2O

2/0 گرم

Yeast Extract

5/0 گرم

Mannitol

10 گرم

Congo Red 1%

5/2 میلی‏لیتر

 

ج

Proteose Peptone

20 گرم

MgSO4 _ 7H2O

5/1 گرم

K2HPO4

5/1 گرم

Glycerol

10 میلی‏لیتر

 

د

KH2PO4

6 گرم

Na2HPO4

3 گرم

NaCl

5/1 گرم

 

عناصر زیر نیز به طور جداگانه استریل و به ترکیبات یاد شده محیط کشت M9 در حجم نهایی یک لیتر افزوده شدند.

 

MgSO4×7H2O

493میلی‏گرم

CaCl2×2H2O

47/1میلی‏گرم

Glucose

2 گرم

Thamine HCl

میلی‏گرم 337

 

تعیین توانایی سویه‏ها در استفاده از ACC به عنوان منبع نیتروژن

توانایی تولید آنزیم ACCدآمیناز با استفاده از روش تغییر یافته پنروز و گلیک[6] ارزیابی شد (10). برای این منظور یک لوپ از هر جدایه به 20 میلی‏لیتر محیط کشت نوترینت براث در لوله‏های 50 میلی‏لیتری تلقیح شد و پس از 24 ساعت از رشد باکتری در28 درجه سانتی‏گراد‏، میزان 50 میکرولیتر از سوسپانسیون هر جدایه به 30 میلی‏لیتر محیط نوترینت براث تازه اضافه شد و 24 ساعت در 28 درجه سانتی‏گراد‏ تکان داده شد. سپس، 50 میکرولیتر از سوسپانسیون هر سویه به هر یک از لوله‏های 50 میلی‏لیتری حاوی 20 میلی لیتر از محیط حداقل M9، محیط حداقل M9 حاوی 15/0 مولار ACC و محیط حداقل M9 حاوی 2 گرم در لیتر آمونیوم کلرید تلقیح و به مدت 48 ساعت روی شیکر با دمای 28 درجه سانتی‏گراد‏ و دور rpm80تکان داده شد. دانسیته نوری این محیط‏ها در طول موج 504 نانومتر به‏وسیله اسپکتروفتومتر به عنوان معیاری از رشد باکتری در آن محیط در روزهای اول، دوم و پنجم اندازه‏گیری شد.

سنجش آنزیم (1- آمینـو سـیکلوپروپان -1- کربوکـسیلیک اسید) دآمیناز[7] در سویه‏های منتخب

میزان فعالیت آنزیم ACC‏دآمیناز با تعیین غلظت آلفا کتوبوتیرات آزاد شده و بر طبق روش تغییر یافته پنروز (10) انجام گرفت. در این روش، از محیط کشت مایع BHI به عنوان محیط پیش کشت استفاده شد. برای این منظور، ابتدا از باکتری‏ها، کشت تازه در محیط جامد BHI تهیه شد. سوسپانسیون سلولی از کشت جامد سویه‏ها با غلظت معادل 1 مک فارلند آماده و به میزان 100 ماکرولیتر به 10 میلی لیتر محیط کشت مایع BHI تلقیح و در دمای 28 درجه سانتی‏گراد‏ گرماگذاری شد. با بررسی میزان جذب نوری محیط کشت سویه‏ها، زمان مناسب برای رسیدن سویه‏ها به فاز سکون رشد ارزیابی شد. در این مقطع زمانی سلول‏ها طی 1 مرحله سانتریفوژ در دمای4 درجه سانتی‏گراد‏ به مدت 10 دقیقه با دور rpm 6000 جمع‏آوری و محلول رویی دور ریخته شد. برای القای آنزیم، سلول‏های باقیمانده پس از شستشو با محیط کشت حداقل M9، در 5/7 میلی‏لیتر محیط کشت مایع M9 حاوی 40 میکرولیتر از محلول 5/0 مولار معلق و برای 48 ساعت در دمای 28 درجه سانتی‏گراد‏ و دور rpm 120 قرار گرفت. 50 ماکرولیتر از سوپ رویی سلول‏های لیز شده با تولوئن 5 درصد (حجمی/ حجمی) برداشته شد و پس از افزودن 5 ماکرولیتر ACC 5/0 مولار، ورتکس و برای 30 دقیقه در30 درجه سانتی‏گراد‏ نگهداری شد. از نمونه حاوی 50 ماکرولیتر سوپ باکتریایی به همراه 5 ماکرولیتر آب مقطر و نیز نمونه حاوی 50 ماکرولیتر بافر تریس-کلریدریک اسید[8] 1/0 مولار (اسیدیته 5/8) و 5 ماکرولیتر محلول ACC 5/0 مولار به ترتیب به عنوان کنترل منفی و بلانک استفاده شد. سپس، 500 ماکرولیتر کلریدریک اسید 56/0 نرمال به هر لوله اضافه شد. پس از آن محلول نهایی درون هر لوله با استفاده از ورتکس مخلوط و برای حذف بقایای سلولی، نمونه‏ها به مدت 5 دقیقه با دور rpm 18000 در دمای اطاق سانتریفوژ شد. سپس، 500 ماکرولیتر از محلول رویی هر لوله میکروسانتریفوژ برداشته و با 400 ماکرولیتر کلریدریک اسید 56/0 نرمال درون یک لوله آزمایش کوچک ورتکس شد. 150 ماکرولیتر از محلول 2-4 دی نیتروفنیل هیدرازین[9] (محلول 2/0 درصد در کلریدریک اسید 2 نرمال: 02/0 گرم 2-4 دی نیتروفنیل هیدرازین در 61/9 میلی‏لیتر استون حل و 330 ماکرولیتر کلریدریک اسید 2 نرمال به آن اضافه شد) به هر لوله افزوده و ورتکس شد. محتویات 30 دقیقه در30 درجه سانتی‏گراد‏ نگهداری شد. سپس، به محلول فوق 1 میلی‏لیتر سدیم هیدروکسید 2 نرمال اضافه و مخلوط شد تا یکنواخت شود. مقدار جذب نور در طول موج 540 نانومتر قرائت شد. مقادیر جذب کنترل منفی و بلانک برای هر سویه از جذب نمونه، کسر شد و مقدار به‏دست آمده برای سنجش فعالیت آنزیم، به کار رفت.

شناسایی سویه‏های منتخب

شناسایی سیستماتیک سویه‏ها طی 2 سری از آزمایش‏ها انجام شد. در سری نخست، آزمون‏های بیوشیمیایی و میکروبیولوژیک برای شناسایی تمامی سویه‏های منتخب طبق روش پیشنهادی برگی[10] (6)، انجام شد. در نهایت، شناسایی سویه منتخب که دارای بیش‏ترین میزان فعالیت آنزیم ACCدآمیناز بود، با تکثیر و تعیین توالی ژن 16S rRNAانجام گرفت. برای این منظور، استخراج DNA باکتری به کمک مواد لیز کننده سلولی انجام گرفت و در ادامه با روش فنل‏/ کلروفرم/ ایزوآمیل الکل خالص شد. در این تحقیق، برای تکثیر ژن 16S rRNAسویه منتخب از آغازگر رفت:

 F27)P1) ´3AGAGTTTGATCCTGGCTTAG´5

و آغازگر برگشت:

P2 (R1492) ´3TAAGGAGGTGATCCAGC´5 استفاده شد و ژن 16S rRNA تکثیر یافته به کمک واکنش زنجیره ای پلیمراز[11] که برای تعیین توالی مناسب بود (تراکم مناسب، بدون اسمیر و باند اضافه) به شرکت ماکروژن[12] برای تعیین توالی با استفاده از دستگاه
(ABI 3730 XL DNA sequencer) ارسال شد.

 

نتایج

در مجموع، تعداد 445 جدایه از نمونه‏های خاک به‏دست آمد که این فراوانی بالا را می‏توان با اکوسیستم غنی و پیچیده خاک مرتبط دانست. از این تعداد 242 جدایه، در محیط کشت YM، 170 جدایه در محیط در جدایه درمحیط کشت YM، 170 جدایه در محیطکشت King B و 33 جدایه در محیط کشت DF رشد یافتند. مشاهدات حاصل از بررسی لام میکروسکوپی تمامی سویه‏ها نشان داد که باکتری‏ها با ریخت‏شناسی میله‏ای کوتاه فراوان‏ترین گروه را در میان اشکالِ میله‏ای بلند، میله‏ای کوتاه، کوکوباسیل و کوکوس شامل می‏شوند.

 

 

شکل 1- آزمون نیمه کمی توان تولید آنزیم ACC دآمیناز به روش لکه‏گذاری

 

بر اساس شکل میکروسکوپی و ظاهر کلونی باکتریایی، تعداد 159 جدایه از 3 محیط کشت (33 جدایه از محیط DF، 73 جدایه از محیط YM و 53 جدایه از محیط King B) برای آزمون نیمه کمی توان تولید آنزیم ACC‏دآمیناز انتخاب شدند (شکل 1).

نتایج بررسی نیمه کمی توان تولید آنزیم در سویه‏های مورد آزمایش نشان داد، تعداد 55 سویه رشد ناچیزی (کمتر از 2میلی‏متر) در محیط کشت دارای منبع نیتروژن ACC و نیز کنترل منفی داشته و به عنوان سویه‏های ناتوان در تولید آنزیم در نظر گرفته شدند.

با توجه به میزان رشد باکتری و قطر کلونی حاصل در مقایسه با شاهد منفی، تعداد 17 سویه توانمند در تولید آنزیم ACC‏دآمیناز انتخاب شد.

در بررسی توان تولید آنزیم ACC‏دآمیناز، میزان رشد سویه‏های مورد نظر در 3 نوع محیط کشت M9 بدون هیچ منبع نیتروژن به عنوان کنترل منفی، M9 حاوی 15/0 مولار منبع نیتروژن ACC و M9 حاوی 2 گرم در لیتر منبع نیتروژن کلرید آمونیوم در روزهای اول، دوم و پنجم به شکل نانومتر 504 OD در جدول 2 آمده است.

 

جدول 2- بررسی توان تولید آنزیم ACC دآمیناز به شکل میزان رشد سویه‏های مورد نظر در 3 نوع محیط کشت در طول موج نانومتر504

روز

 

سویه

منبع نیتروژن

NH4

Control Negative

ACC

اول

دوم

پنجم

اول

دوم

پنجم

اول

دوم

پنجم

12 Kot

4/0

76/0

19/1

21/0

42/0

63/0

67/0

28/1

73/1

7 Ko

4/0

53/0

6/0

16/0

23/0

25/0

17/0

28/0

36/0

DF25

21/0

72/0

96/0

41/0

16/0

18/0

38/0

98/0

45/1

7 Kot

13/0

55/0

88/0

12/0

27/0

45/0

41/0

99/0

30/1

10 Yo

2/0

39/0

6/0

08/0

26/0

40/0

04/0

20/0

28/0

28 Kp

19/0

41/0

53/0

01/0

14/0

23/0

14/0

24/0

30/0

528 DF

038/0

12/0

17/0

07/0

10/0

12/0

11/0

17/0

20/0

2 DF

001/0

011/0

81/0

01/0

037/0

22/0

001/0

014/0

23/0

39 Kot

25/0

25/0

24/0

8/0

6/0

9/0

08/0

07/0

10/0

22 Kp

001/0

014/0

023/0

001/0

046/0

06/0

02/0

04/0

08/0

18 Yot

001/0

006/0

23/0

018/0

015/0

11/0

011/0

013/0

08/0

10 Kot

235/0

516/0

684/0

169/0

261/0

252/0

523/0

237/1

324/1

42 Kot

31/0

45/0

79/0

12/0

19/0

35/0

63/0

31/1

44/1

4 Yl

03/0

084/0

022/0

005/0

031/0

04/0

034/0

029/0

069/0

23 Yp

03/0

08/0

3/0

09/0

12/0

4/0

01/0

02/0

09/0

17 Ypn

1/0

09/0

2/0

005/0

02/0

09/0

004/0

007/0

17/0

7 Yp

2/0

19/0

22/0

07/0

03/0

1/0

03/0

03/0

1/0

 

 

داده‏های جدول 2 که حاصل میانگین سه مرتبه تکرار آزمایش است، نشان داد: سویه‏های 7 KOT، KOT42، 10 KOT، KOT12 و 25 DF در محیط کشت حاوی 15/0 مولار ACC، بیشتر از محیط کشت کنترل و نیز محیط حاوی 2 گرم در لیتر آمونیوم کلرید رشد داشتند. به این معنی که، این سویه‏ها به‏واسطه آنزیم ACCD از منبع نیتروژن ACC استفاده و بهتر از حالات دیگر رشد کردند. همچنین، نتایج این بررسی نشان می‏دهد در سویه‏های 528 DF، KP22 و 4 YL با وجود رشد کم در حالات مختلف، میزان رشد در محیط حاوی 15/0 مولار ACC بیشتر است. بنابراین، سویه‏های KOT7، KOT10، KOT12، KOT42، DF25، DF528، KP22 و 4 YLبه عنوان سویه‏های منتخب، شناسایی
فراتر بیوشیمیایی شدند. سویه‏های اکتینومیستی 17 YPN و 7YP به دلیل دیر رشد بودن در مقایسه با دیگر سویه‏های باکتریایی، نتایج مشخصی نداشتند. بنابراین، سویه اکتینومیستی 17 YPN به عنوان شاخص از میان 2 سویه منتخب اکتینومیستی بر مبنای رشد بهتر در پلیت حاوی ACC و توانمند در تولید آنزیم ACCدآمیناز انتخاب شد تا برای سنجش فعالیت آنزیم در مراحل بعدی استفاده شود.

سنجش کمی آنزیم ACC‏دآمیناز در 9 سویه منتخب به روش تغییر یافته پنروز با تعیین غلظت آلفا کتوبوتیرات آزاد شده و در مقایسه با منحنی استاندارد غلظت‏های 1/0 -2/0 تا 1 میکرو مول آلفاکتوبوتیرات انجام گرفت. یک واحد فعالیت آنزیم به شکل مقدار نانومول آلفاکتوبوتیرات آزاد شده به ازای 1 میلی‏گرم پروتئین (آنزیم) در 60 دقیقه تعریف شد. برای ارزیابی مقدار پروتئین سلولی از جذب نوری غلظت‏های مختلف (1/0-4/1 میلی‏گرم در میلی‏لیتر) آلبومین سرمی گاو در 595 نانومتر به عنوان استاندارد استفاده شد. نتایج این بررسی نشان داد که در میان سویه‏های مورد آزمایش، سویه KOT12 دارای بیش‏ترین میزان فعالیت آنزیم (4369/826 نانومول آلفا کتو بوتیرات/میلی‏گرم پروتئین/ ساعت) و سویه KOT42 دارای کم‏ترین میزان فعالیت (519668/8 نانومول آلفا کتو بوتیرات/میلی‏گرم پروتئین/ ساعت) است (جدول 3).

 

جدول 3- میزان فعالیت آنزیم ACCD در سویه‏های منتخب

نام سویه

مقدارجذب آلفاکتوبوتیرات

(540 نانومتر OD)

مقدار جذب پروتئین

(595 نانومتر OD)

فعالیت آنزیم

(نانومول آلفا کتو بوتیرات/میلی‏گرم پروتئین/ ساعت)

Kot 10

028/0

835/0

9037/320

12 Kot

039/0

793/0

4369/826

Df528

031/0

85/0

2439/378

4 Yl

025/0

82/0

6202/253

7 Kot

018/0

825/0

812/30

42 Kot

0178/0

162/1

519668/8

22 Kp

0175/0

83/0

98507/14

25 Df

0195/0

79/0

8835/95

17 Ypn

0174/0

84/0

36691/11

 

از آنجا که پنروز و گلیک (10) فعالیت آنزیمی کمتر از 20 نانومول را به عنوان فعالیت کم آنزیم ACC‏دآمیناز یاد کرده اند، بر اساس نتایج، سویه‏های مورد بررسی از نظر میزان فعالیت آنزیم در 3 گروه با فعالیت زیاد، متوسط و کم به طور نسبی طبقه‏بندی شدند (جدول 4).

 

جدول 3- طبقه بندی نسبی سویه‏های منتخب بر اساس میزان فعالیت آنزیم ACCD

گروه

میزان فعالیت

(نانومول آلفا کتو بوتیرات/میلی‏گرم پروتئین/ ساعت)

درجه نسبی فعالیت آنزیمی

سویه

1

100<

زیاد

Yl4/ Df528/ Kot 10/ Kot 12

2

100-20

متوسط

Df25/ Kot7

3

20>

کم

Ypn17/ Kp22/

 Kot 42

 

آزمایش‏های اولیه شناسایی سویه‏های منتخب نشان داد که باکتری‏های به‏دست آمده به جنس‏های
سودوموناس(KOT7،KOT10، KOT12،42KOT، DF25باسیلوس(DF528، KP22،4YL)و گروهActinomycetes(YPN17) متعلق اند.

1500bp

 

از میان سویه‏های منتخب، سویه 12 KOT که بیش‏ترین میزان فعالیت آنزیم را در مقایسه با دیگر سویه‏های مورد آزمایش نشان داد، شناسایی مولکولی شد. شکل 2 تصویر ژل تکثیر ژن 16S rRNA (طول حدود1500 جفت باز) در سویه Pseudomonas KOT12 را نشان می‏دهد. نتایج به دست آمده از تعیین توالی سویه منتخب با استفاده از نرم افزار Chromas، DNA baser و Bioedit ویراش شد.

 با مقایسه ژن 16S rRNAبه‏دست آمده از سویه منتخب با توالی‏های موجود در پایگاه اطلاعاتی NCBI و بر اساس میزان شباهت 99 درصد، این سویه به جنس Pseudomonas متعلق بوده و به گونه Pseudomonas brassicacearumنزدیک است.

 

 

1500bp

 

شکل 2- سمت چپ مارکر وزن مولکولی 1kb ladder DNA و سمت راست محصول تکثیر ژن 16S rRNAدر سویه منتخب

 

بحث و نتیجه‏‏گیری

با توجه به عدم تهیه آسان ACC و همچنین، هزینه زیاد برای خریداری این ماده، آزمون نیمه کمی توان تولید آنزیم ACC‏دآمیناز با روش یاد شده (محاسبه قطر کلونی) دارای توجیه اقتصادی است. با وجود این‏که روش محاسبه قطر کلونی دقت کم‏تری در تفکیک سویه‏ها از نظر فعالیت آنزیم ACCدآمیناز دارد، در مواقعی که تعداد سویه‏های باکتری زیاد است (همانند پژوهش حاضر) این روش‏ می‏تواند برای غربال‏گری اولیه استفاده شود. در تایید این موضوع پنروز و گلیک (10) محیط کشت حاوی ACC را روش مناسبی برای غربالگری تعداد زیادی از سویه‏های باکتری گزارش دادند. در این پژوهش، پلیت فاقد هر گونه منبع نیتروژنی نیز به عنوان کنترل منفی در نظر گرفته شد که اختلاف آن با محیط حاوی ACC دقت کار را بیشتر کرد. شایان ذکر است، در روش پنروز و گلیک به استفاده از کنترل منفی اشاره‏ای نشده است. همچنین، پنروز و گلیک (2) اشاره داشته‏اند که تقریبا غیر‏ممکن است که بر روی پلیت‏های کشت شده، باکتری فاقد رشدی را پیدا کرد و معمولا هر سویه حداقل رشد بسیار ضعیفی را نشان خواهد داد. این نکته‏ای است که در پژوهش حاضر نیز مشاهده شد. در رابطه با این موضوع که چرا سویه‏ها در محیط کشت می‏توانند رشد حداقلی داشته باشند ولی فاقد توان سنتز ACC باشند، اشاره شده است که این مسأله می‏تواند هنگام تلقیح سویه‏ها همراه سوسپانسیون باکتری، مقدار ناچیزی محیط کشت قبلی به محیط جدید منتقل شود. از دیگر دلایل احتمالی این موضوع می‏توان به کاتابولیسم برخی از متابولیت‏های سلولی توسط سویه‏ها اشاره کرد و شاید بتوان اصطلاح جاروبگرهای نیتروژن[xiii] را برای این باکتری‏ها به کار برد. این باکتری‏ها از برخی مواد و ترکیبات دارای نیتروژن که سایر باکتری‏ها قادر به رشد در آن‏ها نیستند به عنوان منبع نیتروژن استفاده می‏کنند. در مواردی اشاره شده که برخی از باکتری‏ها قادرند حتی از آمونیاک موجود در اتمسفر نیز استفاده کنند.

گلیک و همکارانش[xiv] با تقسیم‏بندی میکروارگانیسم‏های خاکزی دارای فعالیت آنزیمیACC دآمینازی به باکتری‏های با سطح فعالیت بالا و پایئن، بیان داشتند که معمولا میکروارگانیسم‏هایی که فعالیت آنزیمی بالایی دارند به‏طور غیر اختصاصی به سطوح بسیاری از گیاهان متصل شده که بیشتر میکروارگانیسم‏های ریزوسفری به شمار می‏آیند (11).
از سوی دیگر بنیزری و همکارانش[xv] دریافتند که سویه‏های Pseudomonas fluorescens بخش مهمی از باکتری‏های ریزوسفری را تشکیل داده و پتانسیل بالایی در کلنیزه کردن ریشه گیاهان دارند (12). بنابراین، مطابق با این یافته‏ها، سویه برتر در این مطالعه، که دارای فعالیت آنزیمی بالایی است، در گروه  fluorescentPseudomonas قرار گرفته است.

در خصوص توانایی سویه‏های Pseudomonas fluorescensدر استفاده از ACC به عنوان منبع نیتروژن و به عبارت دیگر تولید آنزیم ACCدآمیناز و تحریک رشد گیاه، گزارش‏های متعددی ارائه شده است که از آن میان می‏توان به مطالعه خاوازی و همکارانش[xvi] در سال 2009 اشاره کرد که نشان دادند میزان جوانه‏زنی بذرهای آغشته شده به مایه تلقیح گونه‏های فلورسنت Pseudomonasدارای فعالیت ACCD در گیاه کلزا، تحت شرایط تنش شوری بسیار افزایش یافته است (13).

همچنین، نوید و همکارانش[xvii] در سال 2008 نشان دادند میزان رشد و محصول ذرت در حضور کودهای آلی دارای گونه‏های فلورسنت Pseudomonas، به میزان در خور توجهی افزایش یافت (14). در مطالعه‏ای دیگر، ساراواناکومار و همکارانش[xviii] در سال 2006 دریافتند که تیمار گیاه بادام زمینی با باکتریPseudomonas fluorescensسویه TDK1 با میزان فعالیت آنزیم ACCD 342 نانومول آلفاکتوبوتیرات آزاد شده در واحد میلی‏گرم پروتئین در ساعت، در مقایسه با گیاهی که فاقد این تیمار بود، سبب افزایش مقاومت گیاه به شوری و در نهایت تولید محصول شد (15).

در نهایت، با توجه به میزان فعالیت بالای آنزیم ACCدآمیناز در سویه Pseudomonasمنتخب و نقش مثبتی که این سویه می‏تواند در افزایش رشد گیاه داشته باشد، ادامه تحقیقات در این زمینه با توجه به لزوم استفاده از راهکارهای زیستی به منظور جلوگیری از کاربرد بی‏رویه کودهای شیمیایی ضروری به نظر می‏رسد.

 

 



[1]- Plant Growth Regulators (PGPRs)

[2]- 1-آمینو سیکلوپروپان-1- کربوکـسیلیک اسید

[3]- Khosravi H. et al.

[4]- Merck

[5]- Ryan

[6]- Penrose DM, Glick BR

[7]- ACC Deaminase

[8]- Tris-HCl

[9]- DPH

[10]- Bergey

[11]- PCR

[12]- Macrogen

[xiii]- Nitrogen Scavenger

[xiv]- Glick et al

[xv]- Benizri et al

[xvi]- Khavazi et al

[xvii]- Naveed et al

[xviii]- Saravanakumar et al

References

(1) Glick BR. The enhancement of plant growth by free by free-living bacteria. Canadian Journal of Microbiology. 1995; 41 (2):109-17.

(2) Glick BR, Penrose DM, Li J. A model for the lowering of plant ethylene concentrations by plant growth-promoting bacteria. Journal of Theoretical Biology. 1998; 190 (1): 63–8.

(3) Barnawal D, Bharti N, Maji D, Chanotiya CS, Kalra A. 1-Aminocyclopropane-1-carboxylic acid (ACC) deaminase-containing rhizobacteria protect Ocimum sanctum plants during waterlogging stress via reduced ethylene generation. Plant Physiology and Biochemistry. 2012; 58: 227-35.

(4) Shahzad SH, Arif MS, Riaz M, Iqbal Z, Ashraf M. PGPR with varied ACC-deaminase activity induced different growth and yield response in maize (Zea mays L.) under fertilized conditions. Journal of Soil Biology.2013; 57: 27-34.

(5) Dworkin M, Foster J. Experiments with some microorganisms which utilize ethane and hydrogen. Journal of Bacteriology. 1958; 75: 592-601.

(6) Holt JG, Krieg NR, Sneath PHA, Staley JT, Williams ST. Bergey’s Manual of Systematic Bacteriology, 2nd ed. New York: Springer; 1989.

(7) King EO, Ward MK, Raney DE. Two simple media for the demonstration of pyocyanin and fluorescin. Journal of Laboratory and Clinical Medicine. 1954; 44 (2): 301–07.

(8) Khosravi H, Yakhchali B, Alikhani HA. Potential evaluation of some native rhizobia as plant growth promoting bacteria and their role in decreasing of stress ethylene. Iranian Journal of Biology 2009; 22 (4): 661-70.

(9) Ryan FJ. Selected methods of Neurospora genetics. Methods in Medical Research. 1950; 3: 51-75.

(10)  Penrose DM, Glick BR. Quantifying the Impact of ACC Deaminase Containing Bacteria on Plants. : In: Varma A, Abbott L, Werner D, Hampp R, editor. Plant Surface Microbiology; 2nd ed. Berlin Heidelberg: Springer; 2004.

(11) Glick BR. Modulation of plant ethylene levels by the bacteria enzyme ACC deaminase. FEMS Microbiology Letters. 2005; 251: 1-7.

(12) Benizri E, Courtade A, Picard C,. Guchert A. Role of maize root exudates in the production of auxins by Pseudomonas fluorescens. Soil Biology & Biochemistry. 1998; 30: 1481-84.

(13)   Khavazi K, Jalili F, Pazira E. Isolation and characterization of ACC deaminase-producing fluorescent pseudomonads, to alleviate salinity stress on canola (Brassica napus L.) growth. Journal of Plant Physiology. 2009; 166 (6): 667-74.

(14)   Naveed M, Khalid M. Relative Efficacy of Pseudomonas spp., Containing Acc-Deaminase For Improving Growth and Yield of Maize (Zea Mays L.) in The Presence of Organic Fertilizer. Pakistan Journal of Botany. 2008; 40 (3): 1243-51.

(15)   Saravanakumar D, Samiyappan R. ACC deaminase from Pseudomonas fluorescens mediated saline resistance in groundnut (Arachis hypogea) plants. Journal of Applied Microbiology. 2007; 102 (5): 1283–92.