افزایش تولید آنتی‌بیوتیک کلاولانیک ‏اسید با ایجاد گونه‌های استرپتومایسس کلاولی‌جروس تراریخت واجد ژن claR

نویسندگان

1 دانشجوی کارشناسی ارشد ژنتیک، دانشگاه اصفهان، ایران

2 استادیار ژنتیک، دانشگاه اصفهان، ایران

3 دانشیار ژنتیک، دانشگاه اصفهان، ایران

چکیده

  مقدمه : کلاولانیک‏اسید از جمله آنتی‌بیوتیک‌های مهار کننده‌ی β لاکتاماز بوده که توسط استرپتومایسس کلاولی‌جروس تولید‌ می‏شود. کلاولانیک‏اسید در ترکیب با سایر آنتی‌بیوتیک‌های قوی و حساس به β لاکتاماز مورد استفاده بالینی قرار می‏گیرد. ژن‌ CalR از جمله ژن‌هایی بوده که نقش مهمی در تنظیم تولید کلاولانیک‏اسید ایفا نموده و به منظور بیان ژن‌های اواخر مسیر بیوسنتز کلاولانیک‏اسید مورد نیاز است‏‏.   مواد و روش‏‏ها: کانسترک نوترکیب pMTclaR حاوی ژن تنظیمی claR از دانشگاه اصفهان تهیه و به منظور استفاده، از سویه‌ استرپتومایسس لیویدنس با استفاده از روش لیز قلیایی استخراج شد. به منظور انجام ترانسفورماسیون پروتوپلاست از باکتری استرپتومایسس کلاولی‌جروس تهیه و در مرحله‌ بعد با استفاده از پلی‌اتیلن‌‌گلایکول در سویه‌ استرپتومایسس کلاولی‌جروس ترانسفورم شد. با استفاده از استخراج پلاسمید و انجام PCR ترانسفورماسیون تأیید شد. در نهایت به منظور بررسی نحوه‌ تأثیر ژن claR اضافه شده از روش بایواسی استفاده شد.   نتایج: کلونی‏‌های گچی حاصل از رشد استرپتومایسس کلاولی‌جروس ترانسفورم شده بر روی محیط GYME حاوی آنتی‌بیوتیک مشاهده شد که تأیید انجام ترانسفورماسیون است. از سویه‌ ترانسفورم شده پلاسمید استخراج و ساختار آن توسط ژل الکتروفورز تأیید شد. با استفاده از پلاسمید استخراج شده و پرایمرهای اختصاصی claR واکنش PCR انجام و باند 1334 جفت‌بازی مشاهده شد. در نهایت با انجام روش بایواسی و مشاهده‌ی هاله‌ عدم رشد در نمونه‌ ترانسفورم شده و مقایسه‌ آن با نمونه‌ کنترل مشخص شد که حضور پلاسمید نوترکیب سبب افزایش 3/3 برابری تولید کلاولانیک‏اسید در سویه‌ استرپتومایسس کلاولی‌جروس شده است.   بحث و نتیجه‏گیری: در مطالعه‌ حاضر، با انتقال پلاسمید نوترکیب حاوی ژن claR میزان تولید آنتی‌بیوتیک کلاولانیک‏اسید تا 5/2 برابر افزایش یافت. با توجه به اهمیت دارویی کلاولانیک‏اسید ایجاد سویه‌هایی که توانایی تولید بیشتر کلاولانیک‏اسید را داشته باشند می‌توانند به بومی‌سازی تولید آنتی‌بیوتیک کلاولانیک‏اسید با صرفه‌ اقتصادی بیشتر درمقیاس صنعتی کمک شایانی نماید.  

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Increase of Clavulanic acid production by using recombinant Streptomyces clavuligerus strain including claR gene

نویسندگان [English]

  • Maryam Kay 1
  • zohreh Hojati 2
  • Majid Motovali-Bashi 3
1 M.Sc. Student of Genetic, Isfahan University, Iran
2 Assistant professor of Genetic, Isfahan University, Isfahan, Iran
3 Associate professor of Genetic, Isfahan University, Isfahan, Iran
چکیده [English]

  Introduction : Clavulanic acid is a major β-lactam antibiotic which is produced by Streptomyces clavuligerus. Clavulanic acid is used in combination of strong but sensitive to β-lactamase antibiotics. The claR gene has an important role in regulation of clavulanic acid production and is needed for the expression of the genes in final step of clavulanic acid biosynthesis.   Materials and methods: The recombinant construct pMTclaR which contains claR gene is obtained from Isfahan University and plasmid extraction was done from Streptomyces lividans for next steps. The Streptomyces clavuligerus protoplast was prepared and transformation was done by using polyethylene glycol. Transformation was confirmed by plasmid extraction and PCR. Finally, bioassay method was used to survey the effect of extra copy of claR on clavulanic acid production .   Results : The typical chalky white colony of Streptomyces clavuligerus was seen on GYME plates containing thiostrepton antibiotic. Plasmid extraction was initially carried out. Furthermore, PCR reaction was done by claR specific primers and the 1334 bp band which was belonging to claR was detected. Finally, the bioassay was done and the diameters of zone of inhibition in control and sample were compared. The results of the bioassay show that amplification of the claR gene in multicopy plasmids resulted in a 2.5 fold increase in clavulanic acid production .   Discussion and conclusion : In this study the 3.3 fold increase in clavulanic acid production was obtained by using an expression vector containing claR. According to the clinical use of clavulanic acid, production of bacterial strains which are able to produce high level of antibiotic can help significantly in customization of antibiotic production.

کلیدواژه‌ها [English]

  • Streptomyces clavuligerus
  • Clavulanic acid
  • Bioassay
  • pMTclaR plasmid
  • ClaR gene

مقدمه

اکتینومیست‌ها از باکتری‌های رشته‌ای گرم مثبت بوده که تولید کننده‌ دو سوم متابولیت‌های ثانویه با فعالیت زیستی گسترده هستند. در میان اکتینومیست‌ها اعضای جنس استرپتومایسس‌ها بیش از 70 درصد متابولیت‌های ثانویه را تولید می‌کنند(1). این دسته از باکتری‌ها قادرند با تولید آنزیم‌های هیدرولیتیک خارج سلولی، بسیاری از ترکیبات از جمله قند‌ها، الکل‌ها، اسیدهای آمینه و ترکیبات آروماتیک را متابولیزه کنند (2). استرپتومایسس‌ها به علت داشتن کروموزوم خطی بزرگ در میان باکتری‌ها ساختار ژنتیکی غیر معمول را نشان می‌دهند (3). استرپتومایسس‌ها واجد دسته‌ای از ژن‌های تنظیم ‌کننده‌ تولید آنتی‌بیوتیک و اسپورزایی هستند. در این بین استرپتومایسس کلاولی‌جروس[1] تولید‌کننده‌ تعدادی از ترکیبات β لاکتام از قبیل سفامایسین C و کلاولانیک‏اسید است(4). مهم‌ترین دسته‌ آنتی‌بیوتیک‌ها، β لاکتام بوده که برای درمان انواع آلودگی‌های باکتریایی استفاده می‌شود. β لاکتام با آنزیم‌های دخیل در مراحل نهایی بیوسنتز دیواره سلولی واکنش داده و موجب مهار سنتز پپتیدوگلیکان می‌شود. با توجه به این موضوع که این واکنش در میان یوکاریوت‌ها جایی ندارد، سمیت این آنتی‌بیوتیک‌ها برای موجودات عالی مانند انسان به شدت پایین بوده، در نتیجه به طور وسیع استفاده می‌شوند (5 و 6). کلاولانیک‏اسید نخستین مهار کننده‌ β لاکتاماز بوده که مورد استفاده بالینی قرار گرفته و مصرف آن از سال 1981 آغاز شده است (4). این آنتی‌بیوتیک به طور گسترده توسط سویه‌ استرپتومایسس کلاولی‌جروس تولید می‏شود. اگرچه کلاولانیک‏اسید فعالیت ضد باکتریایی ضعیفی داشته ولی مهار کننده‌ قوی طیف وسیعی از آنزیم‌های β لاکتاماز است. در نتیجه به همراه سایر آنتی‌بیوتیک‌های قوی و حساس به β لاکتاماز استفاده می‏شود. محصول تجاری آگمنتین (کوآموکسی کلاو) از تلفیق کلاولانیک‏اسید با آموکسی‌سیلین و محصول تجاری تیمنتین از تلفیق کلاولانیک‏اسید با تیکارسیلین به‏دست می‌آید (4، 6 و 7). حدود 23 ژن در مسیر بیوسنتز کلاولانیک‏اسید دخالت داشته و مسئول بیوسنتز، انتقال و تنظیم تولید کلاولانیک‏اسید هستند (8). در این میان، ژن‌ CalR از جمله ژن‌هایی است که نقش مهمی در تنظیم تولید کلاولانیک‏اسید ایفا می‌کند. ژن ClaR با طول 1299 جفت باز غنی از CG بوده و یک فعال کننده‌ رونویسی مسیر بیوسنتز کلاولانیک‏اسید را تولید می‌کند. پروتئین تنظیمی ClaR مولکول فعال کننده‌ اختصاصی مسیر بیوسنتز کلاولانیک‏اسید بوده که به منظور بیان ژن‌های اواخر مسیر بیوسنتز کلاولانیک‏اسید مورد نیاز است(9). سویه‌ وحشی توان تولید انبوه یک محصول که توجیه کننده‌ منافع اقتصادی و تجاری باشد را ندارد. با اصلاح سویه و تولید سویه‌های بهبود یافته با استفاده از روش‌های مهندسی ژنتیک می‌توان به هدف تولید اقتصادی یک محصول دست‌ یافت(4). در این راستا در ابتدا سازه‌ نوترکیب ساخته شده حاوی ژن ClaR استفاده شد. به منظور انتقال سازه‌های‌ نوترکیب می‌توان از روش‌های مختلفی استفاده کرد. ترانسفورماسیون یکی از روش‌های پرکاربرد در انتقال پلاسمید به سویه‌های باکتریایی است. کارایی ترانسفورماسیون با استفاده از پلی‌اتیلن گلایکول[2] به میزان چشمگیری افزایش می‌یابد. این مولکول موجب الحاق غشاهای سلولی برای انتقال DNA به سلول می‏شود (10). به علت حضور سیستم‌های محدود کننده، کارایی ترانسفورماسیون در استرپتومایسس به شدت کاهش می‌یابد. به این منظور در ابتدا پلاسمیدهای نوترکیب به سویه‌ حد واسط استرپتومایسس لیویدنس[3] منتقل شده تا شرایط به منظور ترانسفورماسیون در سویه‌ اصلی استرپتومایسس کلاولی‌جروس فراهم شود. در این پژوهش سعی شده است که کانسترکت نوترکیب حاوی ژن ClaR به سویه‌ اصلی استرپتومایسس کلاولی‌جروس ترانسفورم شده و میزان تأثیر آن در تولید آنتی‌بیوتیک کلاولانیک‏اسید با روش بایواسی[4] بررسی شد.

 

مواد و روش‏ها

تهیه‌ سازه‌ نوترکیب: پلاسمید pMT3206 حاوی ژن ClaR کلون شده در دانشگاه اصفهان تهیه شد. این پلاسمید در سویه‌ باکتریای استرپتومایسس لیویدنس ترانسفورم شده تا بتوان برای ترانسفورماسیون در استرپتومایسس کلاولی‌جروس استفاده کرد. این سازه یک ناقل بیانی ویژه استرپتومایسس است که از یک پروموتر القایی قوی GylP1/P2 و همچنین، رپرسور آن تشکیل شده است. به منظور استفاده، پلاسمید مورد نظر از باکتری استرپتومایسس لیویدنس استخراج و استفاده شد.

تهیه‌ پروتوپلاست: به منظور تهیه‌ پروتوپلاست از روشی که توسط اوکانیشی[5] و همکارانش در سال 1974 ارئه شد استفاده شد. به این منظور 1 سی‌سی از اسپور استرپتومایسس درون محیط YEMEG کشت داده شد. پس از 72 ساعت رشد ساکارز 3/10 به باکتری‌ها اضافه و به مدت 10 دقیقه با دور 3000 سانتریفو‍ژ انجام شد. مرحله‌ شستشوی باکتری‌ها با ساکارز 3/10 درصد دو بار تکرار شد. به رسوب حاصله 4 میلی‌لیتر محلول لیزوزیم اضافه شده و در حمام بن ماری30 درجه سانتی‏‌گرادی به مدت 15 دقیقه انکوبه شد. پس از این مدت، 5 میلی‌لیتر بافر P به محلول اضافه کرده و برای 15 دقیقه‌ دیگر در شرایط قبل انکوبه شد. پروتوپلاست‌ها با استفاده از فیلتر کتانی، فیلتر و به مدت 7 دقیقه در 3000 دور سانتریفوژ شدند. رسوب حاصله به آرامی در 1 میلی‌لیتر بافر P حل و مجدد سانتریفوژ شد. در پایان رسوب در 5 میلی‌لیتر بافر P حل شد.

 

 

شکل1- ساختار شماتیک وکتور نوترکیب pMTclaR حاوی ژن claR

 

ترانسفورماسیون: به منظور تسهیل در انجام ترانسفورماسیون از پلی‌اتیلن‌گلایکول استفاده شد. از آنجایی که غلظت، وزن مولکولی و زمان مجاورت پروتوپلاست‏ها با پلی‌اتیلن‌گلایکول مهم است، پس از بهینه‏سازی‌های متعدد غلظت 40 درصد از پلی‌اتیلن‌گلایکول 1000 به کار رفته و هنگام استفاده 5/2 میلی‌‏لیتر بافر P به آن افزوده شد. به منظور انجام ترانسفورماسیون در صورت استفاده از پروتوپلاست‏های منجمد، آن‏ها را در بن ماری 37 درجه سانتی‌گراد قرار داده تا زود ذوب شوند. نمونه‏ها در دور3000 به مدت 10 دقیقه در دمای اتاق سانتریفوژ شدند و مایع رویی دور ریخته شد. 500 میکرولیتر از پلی‌اتیلن‌گلایکول 40 درصد و 20 میکرولیتر از نمونهDNA به شکل هم‏زمان به نمونه‌ پروتوپلاست‌ها اضافه شد. پس از گذشت 1 دقیقه، 5/2 میلی‏لیتر از بافر Pبه محلول اضافه شد. نمونه‏ها در دور 3000 به مدت 3 دقیقه در دمای اتاق سانتریفوژ و پروتوپلاست­ها در 1 میلی­لیتر از بافر P حل شدند. به منظور بازیابی پروتوپلاست­های استرپتومایسس کلاولی­جروس از محیط RSM فاقد آنتی­بیوتیک استفاده شد. 200 میکرولیتر از نمونه روی پلیت RSM کشت داده شد. پس از حدود 72 ساعت انکوباسیون در دمای 26 درجه سانتی‌گراد و بازیابی کامل پروتوپلاست‌ها، پلیت‌ها به وسیله 5/2 میلی‏لیتر محیط سافت آگار حاوی آنتی‏بیوتیک تایواسترپتون با غلظت 1 ماکروگرم در هر میلی‌لیتر پوشانده شدند. انکوباسیون به مدت یک هفته‌ دیگر در شرایط قبلی ادامه یافت.

استخراج پلاسمید: به منظور استخراج پلاسمید از روش لیز قلیایی که توسط بیرن‌بویم[6] و دالی[7] در سال 1979 ارائه شده بود استفاده شد. به این منظور، اسپور باکتری در محیط YEME به مدت سه روز در دمای 28 درجه سانتی‌گراد کشت داده شد. محیط کشت حاوی باکتری به مدت 5 دقیقه دردمای 4 درجه سانتی‌گراد و دور 13000 سانتریفوژ شده و به رسوب حاصله 200 میکرولیتر از محلول 1 حاوی گلوکز، TrisHCl، EDTA و لیزوزیم اضافه و در دمای 37 درجه سانتی‌گراد به مدت 30 دقیقه انکوبه شد. در ادامه محلول حاوی SDS و NaOH اضافه و به مدت 5 دقیقه بر روی یخ انکوبه شد. 300 میکرولیتر استات پتاسیم به ترکیب موجود اضافه و مدت 10 دقیقه در دمای 4 درجه سانتی‌گراد و دور 13000 سانتریفوژ شد. محلول فنل/ کلروفرم/ ایزوآمیل الکل به محلول رویی اضافه شده و به مدت 5 دقیقه در شرایط مرحله قبل سانتریفوژ شد. فاز آبی رویی برداشته، ایزوپروپانول سرد به آن اضافه و به مدت 5 دقیقه در دمای اتاق سانتریفوژ شد. به رسوب به دست آمده 1 میلی‌لیتر اتانول70 درصد اضافه شد. پس از گذشت 5 دقیقه در دور 13000 در دمای اتاق به مدت 5 دقیقه سانتریفوژ و مایع رویی کاملاً تخلیه شد. پس از خشک شدن کامل رسوب، 200 میکرولیتر محلول TE حاویRNase به رسوب اضافه شد.

روش بایواسی: به منظور مشاهده‌ تأثیر ClaR در بیان کلاولانیک‏اسید از روش بایواسی استفاده شد. در این روش نمونه‌های اسپور وحشی و موتانت حاوی وکتور بر روی محیط GYME حاوی آنتی‌بیوتیک تایواسترپتون کشت داده می‌شود. به این منظور، در ابتدا رقت یکسانی از اسپورها تهیه و 30 ماکرولیتر از استوک باکتریایی بر روی محیط GYME کشت داده شد. پس از 72 ساعت باکتری کلبسیلا پنمونیا[8] در محیط TSB کشت داده شد. زمانی که OD600 محیط به 9/0 تا 1 رسید 3/3 میلی‌لیتر از محیط حاوی باکتری را با 100 میلی‌لیتر محیط TSA مایع (دمای حدود 47 درجه) و 100 ماکرولیتر پنی‌سیلین G با غلظت 10 میلی‌گرم در میلی‌لیتر کاملاً مخلوط و بلافاصله بر روی پلیت‌های حاوی باکتری ریخته شد. هاله‌ عدم رشد باکتری‌های کلبسیلا پنمونیاپس از 24 ساعت مشاهده شد.

 

نتایج

سازه‌ نوترکیب pMTClaR حاوی ژن ClaR از دانشگاه اصفهان تهیه و به منظور استفاده از سویه‌ استرپتومایسس لیویدنس استخراج شد. پلاسمیدهای استخراج شده به منظور انجام ترانسفورماسیون به سویه‌ اصلی استرپتومایسس لیویدنس استفاده شد. به منظور تهیه‌ پروتوپلاست، باکتری استرپتومایسس کلاولی‌جروس در محیط YEMEG که حاوی گلیسین و گلیسرول بوده و شرایط را به منظور رشد مناسب استرپتومایسس کلاولی‌جروس فراهم آورده، کشت داده شد. پس از 72 ساعت پروتوپلاست تهیه شد. پروتوپلاست‌های تهیه شده به منظور‌ انجام ترانسفورماسیون استفاده شدند. ترانسفورماسیون سویه‌ استرپتومایسس کلاولی‌جروس با استفاده از PEG انجام شد، پس از 72 ساعت آنتی‌بیوتیک به محیط RSM اضافه و به مدت یک هفته در شرایط مناسب انکوبه شد. کلونی‏‌های گچی استرپتومایسس کلاولی‌جروس بر روی محیط مشاهده شد و بلافاصله بر روی محیط GYME حاوی آنتی‌بیوتیک تایواسترپتون کشت داده شد. کلونی‏‌ها بر روی محیط رشد کرده و پس از یک هفته اسپورهای خاکستری رنگ بر روی آن‏ها تشکیل شد.

رشد کلونی‏‌های باکتری در محیط حاوی آنتی‌‌بیوتیک خود نشان از تأیید انجام ترانسفورماسیون دارد. اما به منظور تأیید نهایی فرآیند ترانسفورماسیون، استخراج پلاسمید از سویه‌ ترانسفورم شده انجام شد. پلاسمید pMTClaR استخراج شده بر روی ژل 0. 7 درصد آگاروز برده شده و باند پلاسمیدی با طول 8642 مشاهده شد.

 

 

شکل2- کلونی‏‌های گچی استرپتومایسس کلاولی جروس تراریخت بر روی محیط GYME حاوی آنتی‌بیوتیک

 

 

8642bp

 

 

1

 

2

 

1000 bp

 

 

3000 bp

 

10000 bp

 

شکل3- وکتور pMTclaR استخراج شده از استربتومایسس کلاولی‌جروس تراریخت

 1) نشانگر 1 kb؛ 2: پلاسمید استخراج شده

 

پلاسمید استخراج شده با استفاده از پرایمرهای اختصاصی ClaR، PCR شد تا حضور ژن ClaR درون پلاسمید تأیید شود (جدول 1). محصول PCR بر روی ژل 1 درصد برده شد. باند 1334 جفت‌بازی مربوط به ژن ClaRمشاهده شد که تأیید کننده‌ حضور ژن در پلاسمید استخراج شده است.

 

جدول 1-توالی پرایمرهای مورد استفاده به منظور تکثیر قطعه‌ claR

نام پرایمر

توالی پرایمر

طول محصول

claR-F

5ʹACACGTCTAGATCAGCCGGACATCC3ʹ

1334 bp

claR-R

5ʹACTAGTAGATCTTGCGGAGACCTCATGG3ʹ

 

 

به منظور مشاهده‌ تأثیر سازه‌ نوترکیب در میزان تولید آنتی‌بیوتیک کلاولانیک‏اسید روش بایواسی استفاده شد. در این روش، با توجه به انجام آزمون توانایی و میزان برابر اسپور توانمند در هر دو پلیت استفاده شد. ولی با توجه به برابر نبودن غلظت هر دو استوک باکتریایی، تفاوت در قطر رشد اولیه باکتری‌ها دیده شد. میزان هاله‌ عدم رشد در نمونه‌‌‌ کنترل و نمونه‌ ترانسفورم شده بررسی شد. با مشاهده‌ هاله‌ عدم رشد و مقایسه‌ آن با نمونه‌ کنترل، مشخص شد که حضور سازه‌ نوترکیب در سویه‌ استرپتومایسس کلاولی‌جروس سبب افزایش بیان و تولید آنتی‌بیوتیک شده است. مطالعات نشان داد که پلاسمید نوترکیب pMTClaR سبب افزایش 3/3 برابری تولید آنتی‌بیوتیک کلاولانیک‏اسید در سویه‌ استرپتومایسس کلاولی‌جروس شده است.

 

1000 bp

 

1334bp

 

1500 bp

 

1

 

2

 

1334 bp

شکل 4- قطعه‌ی تکثیر شده با استفاده از پرایمرهای اختصاصی claR 1: نشانگر 1kb؛ 2: باند ژن claR

 

 

7. 57 mm

 

25 mm

 

A

 

B

شکل 5- نمایش افزایش میزان تولیدکلاولانیک‏اسید در سویه‌ تراریخت A: نمونه‌ تراریخت؛ B: نمونه‌ وحشی

 

بحث و نتیجه­گیری

کلاولانیک‏اسید نخستین مهارکننده‌ β لاکتاماز بوده که مورد استفاده‌ بالینی قرار گرفته است. کلاولانیک‏اسید فعالیت ضد باکتریایی ضعیفی داشته اما با توجه به نقش آن در مهار آنزیم‌های β لاکتاماز به همراه سایر آنتی‌بیوتیک‌های قوی استفاده می‏شود. با توجه به اهمیت دارویی کلاولانیک‏اسید ایجاد سویه‌هایی با قابلیت تولید مقادیر بالای این آنتی‌بیوتیک بسیار حائز اهمیت است. یکی از راه‌های افزایش تولید آنتی‌بیوتیک شناسایی و تکثیر ژن‌های تنظیمی این ترکیب و افزایش تعداد کپی آن‏ها بوده که می‌تواند به افزایش بیان آنتی‌بیوتیک منجر شود. ژن claRیکی از ژن‌های کنترل کننده‌ مسیر بیوسنتز کلاولانیک‏اسید بوده که تأثیر آن در افزایش بیان کلاولانیک‏اسید در مطالعات پیشین نشان داده شده است. در سال 2006 هانگ[ix] و همکارانش با ایجاد کتابخانه‌ ژنومی از DNA استرپتومایسس کلاولی‌جروس، به کلون نمودن ژن‌های تنظیمی claR، ccaR و afsR در پلاسمید pIBR25 اقدام و به استرپتومایسس منتقل کردند. به ترتیب میزان تولید کلاولانیک‏اسید توسط پلاسمیدهای تولید شده 5/2، 5/1 و 6/1 برابر افزایش یافت (11). در این تحقیق، به منظور کلون نمودن ژن claR برای نخستین بار از وکتور pMT3206 استفاده شد. این وکتور یک وکتور بیانی چند کپی ویژه‌ استرپتومایسس است که واجد پروموتر القایی gylP1/p2 تحت تنظیم گلیسرول و ژن مهار کننده‌ GylR است. ژن GylR یک رپرسور را می‌سازد که در صورت نبودن گلیسرول از بیان پروموتر القایی gylP1/P2 ممانعت می‏کند. به این ترتیب می‌توان با اضافه کردن گلیسرول، میزان بیان ژن claR را افزایش داد. مک‌نیل[x] و همکارانش در سال 1987 از روش الکتروپوریشن به منظور ترانسفورماسیون استفاده کردند (12). روش الکتروپوریشن گرچه ساده و سریع بوده اما کارایی آن نسبت به استفاده از پلی‌اتیلن‌گلایکول کمتر است. بنابراین، در این تحقیق از پلی‌اتیلن‌گلایکول استفاده شد. میانکش پلی‌اتیلن‌گلایکول با پروتئین‌ها و کربوهیدرات‌های سطح غشا سبب تسهیل انتقال پلاسمید نوترکیب به باکتری استرپتومایسس کلاولی‌جروس می‏شود. در مطالعه‌ حاضر، با انتقال پلاسمید نوترکیب حاوی ژنclaR میزان تولید آنتی‌بیوتیک کلاولانیک‏اسید تا 3/3 برابر افزایش یافت. این نتیجه می‌تواند به بومی‌سازی تولید آنتی‌بیوتیک کلاولانیک‏اسید با صرفه اقتصادی بیشتر درمقیاس صنعتی کمک شایانی نماید.

 

تشکر و قدردانی

 از معاونت پژوهشی دانشگاه اصفهان برای حمایت مالی (طرح 25695/90) تشکر و قدردانی می‏شود.



[1]- Streptomyces clavuligerus

[2]- Polyethylene glycol (PEG)

[3]- Streptomyces lividans

[4]- Bioassay

[5]- Okanishi

[6]- Birnboim

[7]- Doly

[8]- Klebsiella pneumoniae

[ix]- Hung

[x]- Macneil

References

(1)               Dyson P. Streptomyces. Encyclopedia of Microbiology. 3rd ed. UK: Swansea University; 2009.

(2)               Hopwood, DA. Streptomyces in nature and medicine the antibiotic maker. 1rd ed. USA: Oxford University press; 2007.

(3)               Inoue S, Higashiyama K, Uchida T, Hiratsu K, Kinashi, H. Cromosomal circularization in Streptomyces griseus by nonhomologus recombination of deletion ends. Bioscience, Biotechnology and Biochemistry 2003; 67(5): 1101-08.

(4)               Saudagar PS, Survase SA, and Singhal RS. Clavulanic acid: A review. Biotechnology Advances 2008; 26(4): 335-51.

(5)               Baggaley KH, Brown AG, Schofield CJ. Chemistry and biosynthesis of clavulanic acid and other clavams. Natural product reports 1997; 14(4): 309-33.

(6)               Livermore DM. β-lactamase mediated resistance and opportunities for its control. Journal of Antimicrobial Chemotherapy 1998; 41 (suppl 4): 25-41.

(7)               Santos VC, Pereira JB, Haga RB. Stability of clavulanic acid under variable PH, ionic strength and temperature conditions a new kinetic approach. Biochemical Engineering Journal 2004; 45(2): 89-93.

(8)               Song YJ, Jensen SE, Lee KJ. Clavulanic acid biosynthesis and genetic manipulation for its overproduction. Applied Microbiology and Biotechnology 2010; 88(3): 659-69.

 

 

(9)               Perez-Redondo R, Rodriguez-Garcia A, Martin JF, Liras P. The claR gene of Streptomyces clavuligerus encoding a lys R-type regulatory protein controlling clavulanic acid biosynthesis, in linked to the clavulanate-9-aldehyde reductase (car) gene. Gene 1998; 12; 211(2): 311-21.

(10)            Kuwano T, Shirataki C, Itoh Y. Comparison between polyethylene glycol and polyethylenimine mediated transformation of aspergillus nidulans. Current Genetics 2008; 54(2): 95-103.

(11)            Hung TV, Ishida K, Parajuli N. Enhanced clavulanic acid production in Streptomyces clavuligerus NRRL3585 by overexpression of regulatory genes. Biotechnology and Bioprocess Engineering 2006; 11(2): 116-20.

(12)            Macneil DJ. Introduction of plasmid DNA into Streptomyces lividans by electroporation. FEMS Microbiology letter 1987; 42(2-3): 239-44.