جداسازی و شناسایی ژن‏ها‏ی ‏مقاومت آنتی‏بیوتیکی در ایزوله‏ها‏ی استافیلوکوکوس اورئوس جدا شده از عفونت‏ها‏ی دستگاه تنفسی در شهرستان شهرکرد

نویسندگان

1 دانشجوی کارشناسی ارشد میکروبیولوژی، دانشگاه آزاد اسلامی واحد شهرکرد، ایران

2 استادیار میکروبیولوژی، دانشگاه آزاد اسلامی واحد شهرکرد، ایران

3 دانشیار میکروبیولوژی، دانشگاه آزاد اسلامی واحد شهرکرد، ایران

چکیده

  مقدمه : استافیلوکوکوس اورئوس یکی ازعوامل اصلی بیماری‏زا‏‏ در انسان محسوب می‏‏‏شود که با درگیر کردن قسمت‏ها‏ی مختلف بدن از جمله دستگاه تنفس باعث صرف هزینه‏ها‏ی فراوان و طولانی شدن دوره درمان بیمار می‏‏‏شود. این مطالعه، با هدف جداسازی وبررسی الگوی مقاومت آنتی‏بیوتیکی در ایزوله‏ها‏ی استافیلوکوکوس اورئوس جدا شده از عفونت‏ها‏ی فوقانی دستگاه تنفسی در شهرستان شهرکرد انجام شد ‏‏.   مواد و روش‏‏ها: این تحقیق، به شکل‏‏ مقطعی- توصیفی بر روی 200 نفر از افراد مشکوک به عفونت‏ها‏ی دستگاه تنفسی فوقانی مراجعه کننده به کلینیک امام علی شهرستان شهرکرد در سال 1391 انجام شد‏‏. پس از جداسازی استافیلوکوکوس اورئوس از ترشحات بینی کشت داده شده، به منظور شناسایی ژن‏ها‏ی کد کننده مقاومت آنتی‏بیوتیکی در ایزوله‏ها، آزمون واکنش زنجیره ای پلیمراز ‏(‏ PCR ) با استفاده از زوج پرایمرهای اختصاصی انجام شد.   نتایج: از 200 نمونه مورد بررسی، در 60 مورد ‏(‏30 درصد) ‏آلودگی با استافیلوکوکوس اورئوس ‏(‏در روش کشت و PCR ) ‏تعیین شد که در بررسی الگوی مقاومت ضدمیکروبی، بیش‏ترین مقاومت میکروبی به پنی سیلین و سفوتاکسیم ‏(‏100 درصد) ‏و کم‏ترین میزان مقاومت آنتی‏بیوتیکی ایزوله‏ها‏ به وانکومایسین ‏(‏5/0 درصد) ‏برآورد شد‏‏. ژن mecA ‏(‏کد کننده مقاومت به متی سیلین) ‏با فراوانی 18/85 درصد و ژن aacA-D ‏(‏کد کننده مقاومت به آمینوگلیکوزیدها) ‏با فراوانی 33/28 درصد بیش‏ترین و کم‏ترین ژن‏ها‏ی کد کننده مقاومت آنتی‏بیوتیکی ردیابی شده در ایزوله‏ها‏ی استافیلوکوکوس اورئوس بودند.   بحث و نتیجه‏گیری: شیوع ایزوله‏ها‏یاستافیلوکوکوس اورئوس مقاوم به آنتی‏بیوتیک در افراد مبتلا به بیماری‏ها‏ی دستگاه تنفسی لزوم کنترل دائمی ناقلین و درمان آن‏ها‏ را برای جلوگیری از اشاعه این باکتری وعفونت‏ها‏ی حاصل از آن را توصیه می‏‏‏کند.  

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Isolation and identification of antibiotic resistance genes in Staphylococcus aureus isolates from respiratory system infections in shahrekord, Iran

نویسندگان [English]

  • Maryam Reisi 1
  • Elahe Tajbakhsh 2
  • Hassan Momtaz 3
1 M.Sc. Student of Microbiology, Shahrekord Branch, Islamic Azad University, Iran
2 Assistant Professor of Microbiology, Shahrekord Branch, Islamic Azad University, Iran
3 Associate Professor of Microbiology, Shahrekord Branch, Islamic Azad University, Iran
چکیده [English]

  Introduction : Staphylococcus aureus is considered as one of pathogenic agents in humans, that engages different body parts including respiratory system and causes to spend lots of costs and extending patient’s treatment period. This study which is performed to separate and investigate the pattern of antibiotic resistance in Staphylococcus aureus isolates from upper respiratory system infections in Shahrekord.   Materials and methods: This study was done by sectional-descriptive method On 200 suspicious persons to the upper respiratory system infections who were referred to the Imam Ali clinic in Shahrekord in 2012. After isolation of Staphylococcus aureus from cultured nose discharges, antibiotic resistance genes were identified by polymerase chain reaction (PCR) by using defined primer pairs .   Results : Among 200 investigated samples in 60 cases (30%) Staphylococcus aureus infection (by culturing and PCR method) was determined. Isolates showed the lowest amount of antibiotic resistance to vancomycin (0.5%) and the highest amount of resistance to the penicillin G and cefotaxime (100%). mecA gene (encoding methicillin resistance) with frequency of 85.18% and aacA-D gene (encoding resistance to aminoglycosides) with frequency of 28.33% showed the highest and lowest frequency of antibiotic resistance genes coding in Staphylococcus aureus isolates respectively .   Discussion and conclusion : Notable prevalence of resistant Staphylococcus aureus isolates in community acquired respiratory infections, recommend continuous control necessity to impede the spreading of these bacteria and their infections.  

کلیدواژه‌ها [English]

  • Antibiotic resistance genes
  • Staphylococcus aureus
  • Respiratory system infection

مقدمه

استافیلوکوکوس اورئوس[1] یک کوکسی گرم مثبت دارای کروموزوم حلقوی است که ژن‏ها‏ی بیماری‏زا‏‏یی و مقاومت آنتی‏بیوتیکی روی آن قرار دارد ‏(‏1 و 2)‏. استافیلوکوکوس اورئوس مهم‏ترین پاتوژن خانواده میکروکوکاسیه محسوب می‏‏‏شود که عامل بیش از 80 درصد از موارد بیماری‏ها‏ی چرکی و دومین عامل عفونت‏ها‏ی بیمارستانی[2] (‏3) ‏بوده و همچنین، به عنوان عامل بیماری‏ها‏ی سندرم فلسی شدن پوست ‏(‏SSS) ‏[3]، مسمومیت غذایی[4]، سندرم شوک سمی ‏(‏TSS) ‏[5]، باکتریمی[6]، اندوکاردیت[7] و پنومونی[8] شناخته شده است (‏4). سویه‏ها‏ی مختلف استافیلوکوکوس اورئوس و نیز برخی از استافیلوکوکوس‏ها‏ی کواگولاز منفی ‏(‏CNS) ‏[9] از عوامل عفونت‏ها‏ی بیمارستانی و عفونت‏ها‏ی اکتسابی از جامعه در سراسر جهان هستند ‏(‏5).

تجویز نامناسب آنتی‏بیوتیک‏ها‏ و مصرف بی رویه آن‏ها‏ در انتخاب سوش‏ها‏ی مقاوم استافیلوکوکوس اورئوس نقش دارند ‏(‏6 و 7). در سال 1942 بعضی از سوش‏ها‏ی استافیلوکوک به پنی سیلین مقاوم شدند ‏(‏6). در طی یک دهه بعد سوش‏ها‏ی مقاوم چندگانه به تتراسایکلین، کلرامفنیکل و اریترومایسین گزارش شدند (‏8 و 9). برای نخستین‏‏ بار در سال 1960 استافیلوکوکوس اورئوس مقاوم به متی سیلین ‏(‏MRSA)‏[10] به عنوان یک پاتوژن بیمارستانی معرفی شد (‏10). استافیلوکوکوس اورئوس یکی از عوامل ایجاد کننده عفونت‏ها‏ی دستگاه تنفسی مانند پنومونی است‏‏‏ که این بیماری توسط آنتی‏بیوتیک‏ها‏ی سیستمیک ‏(‏وانکومایسین، کلیندامایسین یا سفالوسپورین‏ها‏ی نسل اول) ‏درمان می‏‏‏شود ‏(‏4 و 11). از طرف دیگر، این باکتری قادر به مقاومت در برابر بیگانه خواری و ایمنی‏سلولی است ‏(‏12) ‏و آنزیمی را تولید می‏‏‏کند که اکثر درمان‏ها‏ی بر پایه پنی‏سیلین را بی اثر می‏‏‏کند ‏(‏4). سوش‏ها‏یاستافیلوکوکوس اورئوسعلاوه بر آنتی‏بیوتیک متی سیلین، ممکن است نسبت به آنتی‏بیوتیک‏ها‏ی دیگری مانند بتالاکتام‏ها‏، ماکرولیدها، لینکوزامیدها، فلوروکوئینولون‏ها‏، استرپتوگرامین‏ها‏ و آمینوگلیکوزیدها مقاوم باشند. به همین علت گاهی به درمان آنتی‏بیوتیکی پاسخ نمی‏‏‏دهند ‏(‏13 و 14).

مقاومت علیه آنتی‏بیوتیک‏ها‏ به وسیله مکانیسم‏ها‏ی غیرژنتیکی ‏(‏غیرفعال‏سازی‏‏‏ آنزیماتیک دارو، تغییر سایت هدف ریبوزوم، کاهش نفوذ پذیری و پس زدگی دارو[11]) ‏و مکانیسم‏ها‏ی ژنتیکی ‏(‏کانژوگاسیون[12]، ترانسفورماسیون[13] و ترانس داکسیون[14]) ‏ایجاد می‏‏‏شود ‏(‏11). ژن‏ها‏ی مقاومت به آنتی‏بیوتیک mecA ‏(‏متی‏سیلین)، aacA-D ‏(‏آمینوگلیکوزیدها)، tetM و tetK ‏(‏تتراسایکلین‏ها‏)، msrA و msrB ‏(‏ماکرولیدها) ‏در دهه اخیر در ایزوله‏ها‏ی استافیلوکوکوس اورئوس مشاهده شده که این ژن‏ها‏ عملکردهای متفاوتی را انجام می‏‏‏دهند ‏(‏15 و ‏16). ژن mecA، PBP2a[15] را کد می‏‏‏کند ‏(‏6)، ژن aacA-Dآنزیم‏ها‏ی دو عملکردی را کد می‏‏‏کند ‏(‏17)، ژن msr (‏A,B) ‏در استافیلوکوک‏ها‏ موجب مقاومت نسبت به ماکرولیدها و استرپتوگرامین‏ها‏ی تیپ B می‏‏‏شود که به فنوتیپ [16]MSLB معروف است و بر روی فعالیت پمپ افلوکس تأثیر می‏‏‏گذارد ‏(17- 19) ‏و tet (‏K,M) ‏که موجب تغییر سایت هدف و یا افلوکس می‏‏‏شود ‏(‏17). بنابراین، تشخیص ژن‏ها‏ی مقاومت به آنتی‏بیوتیک‏ها‏ در سویه‏ها‏ی استافیلوکوکوس اورئوس با ویرولانس بالا به منظور استفاده صحیح از آنتی‏بیوتیک‏ها‏ برای درمان مؤثر ضروری است ‏(‏15- 17).

هدف از این تحقیق، ردیابی ژن‏ها‏ی کد کننده مقاومت به آنتی‏بیوتیک‏ها‏ی مختلف از جمله ژن‏ها‏ی مقاومت به متی سیلین (mecA)‏، ماکرولیدها (msrA, msrB)، آمینوگلیکوزیدها (aacA-D) ‏و تتراسایکلین‏ها‏ (tetM, tetK) ‏با تکنیک مولتی پلکس PCR در ایزوله‏ها‏ی استافیلوکوکوس اورئوس جدا شده از موارد عفونت‏ها‏ی دستگاه تنفسی در شهرستان شهرکرد است‏‏‏.

 

مواد و روش‏ها

نمونه‏گیری‏‏‏ و جداسازی استافیلوکوکوس اورئوس

تعداد 200 نمونه سواب بینی از افراد مشکوک به عفونت‏ها‏ی قسمت فوقانی دستگاه تنفس ‏(‏رینیت[17]، لارنژیت[18]، تراکئیت[19] و غیره ... ) ‏اخذ شد‏‏. نمونه‏ها‏ با استفاده از سواب استریل از قسمت قدامی بینی افراد بیمار مراجعه کننده به کلینیک امام علی شهرستان شهرکرد در طول 6 ماهه دوم سال 1391 اخذ و به مدت 24 ساعت در 37 درجه سانتی‏گراد در محیط پپتون واتر ‏(‏مرک، آلمان)‏[20] کشت داده شدند. پس از غنی‏سازی‏‏‏ اولیه، نمونه‏ها‏ی رشد کرده در محیط‏ها‏ی جامد بلاد آگار ‏(‏مرک، آلمان)‏[21] و مانیتول سالت آگار ‏(‏های مدیا، هند) ‏[22] کشت داده شد. روی پرگنه‏ها‏ی مشکوک به استافیلوکوکوس اورئوس آزمایش‏هایی مانند: رنگ‏آمیزی گرم[23]، کاتالاز[24]، کواگولاز[25] و دزاکسی ریبونوکلئاز[26]انجام و باکتری‏ها‏ی جداشده پس‏‏ از شناسایی به عنوان ایزوله‏ها‏ی استافیلوکوکوس اورئوس، برای مطالعات بعدی در محیط مایع مغز و قلب ‏(‏BHI) ‏‏(‏مرک، آلمان) ‏[27] کشت و نگهداری شد‏‏ند ‏(‏20-22).

آزمایش‏های مولکولی

به منظور تائید قطعی وجود استافیلوکوکوس اورئوس در نمونه‏ها‏ی کشت داده شده و ردیابی ژن‏ها‏ی کد کننده مقاومت آنتی‏بیوتیکی در ایزوله‏ها‏، از واکنش زنجیره ای پلیمراز ‏(‏PCR) [28] ‏استفاده شد. در این راستا، ابتدا DNA ژنومی باکتری‏ها‏ی رشد یافته در محیطBHI با استفاده از کیت استخراج DNA ‏(‏فرمنتاز، آلمان) ‏[29]، استخراج و در دو مرحله آزمایش PCR روی DNA تخلیص شده انجام شد:

در مرحله اول، حضور قطعی استافیلوکوکوس اورئوس در ایزوله‏ها‏ با ردیابی ژن کد کننده
16S rDNA باکتری با استفاده از زوج پرایمرهای نشان داده شده در جدول 1 انجام شد. در این مرحله واکنش PCR در حجم 50 میکرولیتر واجد 5 میکرولیتر بافر PCR[30] ‏(‏10x)، 200 میکرومول dNTP ‏(‏سیناژن، ایران)، 2 میلی‏مول MgCl2، 1 میکرومول از زوج پرایمرهای R و F، 1 واحد آنزیم DNATaq پلیمراز ‏(‏سیناژن، ایران) ‏[31] و 5 میکرولیتر از DNA هر نمونه تنظیم و با برنامه حرارتی 94 درجه به مدت 6 دقیقه یک سیکل، 30 سیکل تکراری 95 درجه 50 ثانیه، 61 درجه 70 ثانیه، 72 درجه 60 ثانیه و یک سیکل انتهایی 72 درجه 8 دقیقه واکنش PCR در دستگاه ترموسایکلر مستر سایکلر گرادیانت ‏(‏اپندرف، آلمان) ‏[32] انجام شد.

در مرحله دوم، ژن‏ها‏ی کد کننده مقاومت آنتی‏بیوتیکی شامل: ژن‏ها‏ی mecA ‏(‏مقاومت به متی‏سیلین)، aacA-D ‏(‏مقاومت به آمینوگلیکوزیدها)، tetM و tetK ‏(‏مقاومت به تتراسایکلین) ‏و msrA و msrB ‏(‏مقاومت به ماکرولیدها) ‏به روش PCR چندگانه ای با استفاده از زوج پرایمرهای نشان داده شده در جدول 1 به شرح زیر انجام شد:

واکنش PCR در حجم 50 میکرولیتر شامل: 5 میکرولیتر بافر PCR ‏(‏10x)، 5/1 میلی‏مول MgCl2، 250 میکرومول dNTP Mix، 5/0 میکرومول از زوج پرایمرهای F و R مربوط به هر ژن، 5/1 واحد آنزیم DNA Taq پلیمراز و 5 میکرولیتر DNA هر نمونه بود. برنامه حرارتی مورد استفاده در این مرحله شامل:
یک سیکل 95 درجه به مدت 6 دقیقه، 34 سیکل تکراری 94 درجه 60 ثانیه، 56 درجه 70 ثانیه، 72 درجه 90 ثانیه و یک سیکل انتهایی 72 درجه به مدت 10 دقیقه.

پس‏‏ از انجام آزمایش‏های PCR، محصول PCR روی ژل 1درصد آگاروز واجد اتیدیوم بروماید[33] در ولتاژ ثابت 90 ولت در حضور نشانگر 100 جفت بازی DNA ‏(‏فرمنتاز، آلمان) ‏الکتروفورز و نتیجه با دستگاه تصویر بردار از ژل ‏(‏انگلستان، یووی تک[34]) بررسی شد ‏(‏20).

آزمایش آنتی‏بیوگرام

 به منظور تعیین الگوی مقاومت آنتی‏بیوتیکی ایزوله‏ها‏ی استافیلوکوکوس اورئوس از روش کربی بائر[35] (‏انتشاراز دیسک) ‏طبق دستورالعمل NCCLS[36] (‏2006) ‏استفاده شد. برای این منظور باکتری‏ها‏ی جدا شده به مدت 24 ساعت در محیط جامد مولر هینتون آگار ‏(‏های مدیا، هند) ‏[37] در حضور دیسک‏ها‏ی آنتی‏بیوتیکی پنی سیلین (‏10 واحد)، سیپروفلوکساسین ‏(‏5 میکروگرم)، اگزاسیلین ‏(‏1 میکروگرم)، ‏‏جنتامیسین ‏(‏10 میکروگرم)، ‏تتراسایکلین ‏(‏30 میکروگرم)، اریترومایسین ‏(‏15 میکروگرم)، کوتریموکسازول (‏25 میکروگرم)، ریفامپین ‏(‏30 میکروگرم)، ‏‏سفتازیدیم ‏(‏30 میکروگرم)، سفالوتین ‏(‏30 میکروگرم)، ‏‏کلوگزاسیلین ‏(‏5 میکروگرم)، وانکومایسین (‏30 میکروگرم)، آموکسی کلاو ‏(‏30 میکروگرم)، سفالکسین ‏(‏30 میکروگرم)، سفوتاکسیم ‏(‏30 میکروگرم) ‏و متی سیلین ‏(‏5 میکروگرم) ‏‏(‏شرکت پادتن طب) ‏در دمای 37 درجه کشت و با اندازه‏گیری‏‏‏ قطر هاله عدم رشد، مقاومت میکروبی نسبت به آنتی‏بیوتیک‏ها‏ی مورد نظر تعیین و ثبت شد‏‏ ‏(‏22 و ‏23).

تجزیه و تحلیل آماری

داده‏ها‏ی حاصل از مطالعه با استفاده از نرم افزار آماری اس.پی.اس.اس[38] و مدل‏ها‏ی آماری کای اسکوار و دقیق فیشر ارزیابی شده و وجود ارتباط بین حضور انواع ژن‏ها‏ی کد کننده مقاومت آنتی‏بیوتیکی و الگوی مقاومت ضدمیکروبی در ایزوله‏ها‏ی استافیلوکوکوس اورئوس جدا شده از عفونت‏ها‏ی قسمت فوقانی دستگاه تنفس تعیین شد. در این راستا، وجود ‏(‏P value <0.05) ‏به عنوان وجود رابطه آماری معنی‏دار بین دو عامل‏‏ مورد مطالعه در نظر گرفته شد.

 

 

جدول 1- توالی پرایمرهای مورد استفاده برای ردیابی ژن‏ها‏ی مقاومت آنتی‏بیوتیکی در ایزوله‏ها‏ی استافیلوکوکوس اورئوس جدا شده از دستگاه تنفسی ‏(‏20) ‏

ژن

توالی پرایمرها

اندازه محصول ‏(‏bp) ‏

mecA

(‏متی سیلین) ‏

F: AAAATCGATGGTAAAGGTTGGC

R: AGTTCTGCAGTACCGGATTTGC

532

aacA-D

(‏آمینوگلیکوزیدها) ‏

F: TAATCCAAGAGCAATAAGGGC

R: GCCACACTATCATAACCACTA

227

tet K

(‏تتراسایکلین‏ها‏) ‏

F: GTAGCGACAATAGGTAATAGT

R: GTAGTGACAATAAACCTCCTA

360

tet M

(‏تتراسایکلین‏ها‏) ‏

F: AGTGGAGCGATTACAGAA

R: CATATGTCCTGGCGTGTCTA

158

msrA

(‏ماکرولیدها) ‏

F: GGCACAATAAGAGTGTTTAAAGG

R: AAGTTATATCATGAATAGATTGTCCTGTT

940

msrB

(‏ماکرولیدها) ‏

F: TATGATATCCATAATAATTATCCAATC

R: AAGTTATATCATGAATAGATTGTCCTGTT

595

16S rDNA

F: GTAGGTGGCAAGCGTTACC

R: CGCACATCAGCGTCAG

228

 


نتایج

از مجموع 200 بیمار مورد مطالعه در 60 مورد ‏(‏30 درصد) ‏استافیلوکوکوس اورئوس از ترشحات بینی جدا و با انجام آزمایش PCR وجود قطعی آلودگی اثبات شد. در آزمایش آنتی‏بیوگرام برای تعیین الگوی مقاومت آنتی‏بیوتیکی ایزوله‏ها‏ی استافیلوکوکوس اورئوس از آنتی‏بیوتیک‏ها‏ی معمول در درمان عفونت‏ها‏ی بالینی تنفسی در انسان استفاده شد که همان‏گونه که در جدول 2 ‏نشان داده شده است، تمام ایزوله‏ها‏ نسبت به دو آنتی‏بیوتیک پنی سیلین و سفوتاکسیم مقاوم بودند. در این آزمایش 33/58 درصد از ایزوله‏ها‏ نسبت به تتراسایکلین و تنها 5/0 درصد از آن‏ها‏ نسبت به آنتی‏بیوتیک وانکومایسین مقاوم بودند.

در تجزیه و تحلیل آماری اطلاعات حاصل از جدول 2 اختلاف آماری معنی‏دار بین میزان مقاومت آنتی‏بیوتیکی ایزوله‏ها‏ی استافیلوکوکوس اورئوس نسبت به پنی سیلین و سفوتاکسیم با دیگر آنتی‏بیوتیک‏ها
‏(‏P value= 0.015) ‏و نیز بین مقاومت به تتراسایکلین و دیگر آنتی‏بیوتیک‏ها‏ ‏(‏P value= 0.026) ‏مشاهده شد. در تحلیل‏‏ آماری این اطلاعات، اختلاف آماری معنی‏داری بین جنسیت وحضوراستافیلوکوکوس اورئوس و همچنین، نوع عفونت و حضور استافیلوکوکوس اورئوس با
‏(‏P value<0.05) ‏مشاهده نشد‏‏.

برای ردیابی برخی از ژن‏ها‏ی کد کننده مقاومت آنتی‏بیوتیکی از جمله ژن‏ها‏ی کد کننده مقاومت به آمینوگلیکوزیدها، ماکرولیدها، تتراسایکلین و متی‏سیلین از آزمایش PCR چندگانه استفاده شد. همان گونه که در جدول 2، مشهود است، شایع‏ترین ژن‏ها‏ی کد کننده مقاومت آنتی‏بیوتیکی در ایزوله‏ها‏ی مورد مطالعه ژن mecA با 18/85 درصد فراوانی و نادرترین آن‏ها‏ ژن کد کننده مقاومت به آمینوگلیکوزیدها ‏(‏aacA-D) ‏33/28 درصد بود. در تحلیل‏‏ آماری این اطلاعات، اختلاف آماری معنی‏دار بین فراوانی حضور دو ژن mecA و tetK با ژن aacA-Dدر سطح اطمینان 95 درصد مشاهده شد ‏(‏P value=0.0364). نتایج الکتروفورز ژل آگاروز حاصل از PCR چندگانه ژن‏ها‏ی کدکننده مقاومت آنتی‏بیوتیکی درایزوله‏ها‏ی استافیلوکوکوس اورئوس جداشده از دستگاه تنفسی در شکل‏های 1 و 2 مشاهده می‏شوند.

 

شکل1- تصویر الکتروفورز ژل آگاروز PCR چندگانه مربوط به ژن‏ها‏ی کد کننده مقاومت آنتی بیوتیکی در  ‏استافیلوکوکوس اورئوس‏ها‏ی جداشده از دستگاه تنفسی. mecA ‏(‏532 جفت باز)، tetK (‏‏360 جفت باز) ‏و tetM ‏(‏158 جفت باز) ؛ ستون M: DNA نشانگر با وزن مولکولی 100 جفت باز، ‏ستون 1: کنترل منفی، ستون‏ها‏ی2-7: نمونه‏ها‏ی مثبت.

 

 

شکل2- تصویر الکتروفورز ژل آگاروز PCR چندگانه مربوط به ژن‏ها‏ی کد کننده مقاومت آنتی بیوتیکی در  ‏استافیلوکوکوس اورئوس‏ها‏یجداشده از دستگاه تنفسی. msrA ‏(‏940 جفت باز)، msrB (‏595جفت باز) ‏و aacA-D ‏(‏227 جفت باز)، ستون M: DNA نشانگر با وزن مولکولی 100 جفت باز، ستون 1: کنترل منفی، ستون‏ها‏ی2-7: نمونه‏ها‏ی مثبت.

 

جدول2- الگوی مقاومت آنتی‏بیوتیکی و توزیع فراوانی ژن‏ها‏ی کد کننده مقاومت آنتی‏بیوتیکی در ایزوله‏ها‏ی استافیلوکوکوس اورئوس جدا شده از دستگاه تنفسی

آنتی‏بیوتیک

مقاومت ‏(‏با روش انتشار از دیسک)

 (درصد) ‏

مقاومت با روش بررسی ژن‏ها‏ی مقاومت درPCR

پنی سیلین و سفوتاکسیم

100

-

-

تتراسایکلین

33/58

33/58 درصد ‏‏‏=tetM

33/73 درصد ‏‏‏=tetK

اگزاسیلین

40

-

-

کلوگزاسیلین

40

-

-

سیپروفلوکساسین

25

-

-

سفتازیدیوم

25

-

-

سفالوتین

20

-

-

جنتامایسین ‏(‏آمینوگلیکوزیدها) ‏

66/16 ‏‏‏

33/28 درصد ‏‏‏=aacA- D

-

آموکسی کلاو

66/6

-

-

ماکرولیدها

-

33/38 درصد ‏‏‏=msrA

40 درصد ‏‏‏=msrB

اریترومایسین

5

-

-

کوتریماکسازول

5

-

-

ریفامپین

5 ‏‏‏

-

-

سفالکسین

33/3 ‏‏‏

-

-

وانکومایسین

5/0

-

 

متی سیلین

48

18/85 درصد ‏‏‏=mecA

-

 


بحث و نتیجه‏گیری

مطالعه حاضر، با هدف تعیین الگوی مقاومت آنتی‏بیوتیکی ایزوله‏ها‏ی استافیلوکوکوس اورئوس جدا شده از ترشحات بینی افراد مشکوک به عفونت‏ها‏ی دستگاه تنفس فوقانی مراجعه کننده به کلینیک امام علی شهرستان شهرکرد با دو روش معمول آنتی‏بیوگرام و مولکولی ‏‏PCR ‏انجام شد.

از مجموع 200 نمونه مورد مطالعه در 60 نمونه ‏(‏30 درصد) ‏آلودگی با استافیلوکوکوس اورئوس یافت شد که در آزمایش آنتی‏بیوگرام تمام این ایزوله‏ها‏ نسبت به پنی سیلین مقاوم بودند.

صادری[39]و همکاران در سال 82-1381 در 87 ایزوله استافیلوکوکوس اورئوس مقاوم به متی سیلین ‏(‏MRSA) ‏جدا شده از بینی، مقاومت به پنی سیلین را 8/90 درصد گزارش کردند ‏(‏24). تی وادروس[40] و گدبو[41] در سال 1984 میزان مقاومت به پنی سیلین را در 109 سویه استافیلوکوکوس اورئوس جدا شده از ترشحات بینی در افراد مراجعه کننده به بیمارستان 2/86 درصد برآورد کردند (‏25). توکلی[42]و همکاران در سال 1380تمام سویه‏ها‏ی استافیلوکوکوس اورئوس جدا شده در مطالعه خود را مقاوم به پنی سیلین گزارش دادند ‏(‏26).

حساسیت ایزوله‏ها‏ی استافیلوکوکوس اورئوس جدا شده به سفالکسین در مطالعه حاضر67/96 درصد تعیین شد. این در حالی است که در مطالعه صفدری[43] و همکاران در سال 1391در بیمارستان قائم مشهد این میزان 57 درصد (‏27)، ‏‏در مطالعه توکلی و همکاران 6/81 درصد ‏‏‏و در مطالعه قاسمیان[44]و همکاران در سال 1383، ‏4/69 درصد گزارش شد‏‏ (‏26 و ‏28) ‏ایزوله‏ها‏ی استافیلوکوکوس اورئوسدر مطالعه حاضر 95 درصد ‏‏‏حساسیت به اریترومایسین و 5/99 درصد حساسیت به وانکومایسین نشان دادند. رشیدیان[45] و همکاران در مطالعه خود در سال 1380 که در بیمارستان بعثت سنندج انجام شد حساسیت سویه‏ها‏ی استافیلوکوکوس اورئوس جدا شده را به اریترومایسین 59 درصد و قاسمیان و همکاران در سال 1383 حساسیت ایزوله‏ها‏ی استافیلوکوکوس اورئوس به وانکومایسین را 4/44 درصد برآورد کردند ‏(‏28 و ‏29).

در مورد دیگر آنتی‏بیوتیک‏ها‏ی مورد مطالعه نیز نتایج مشابه یا متفاوتی با دیگر محققان از ایران یافت شد که این اختلافات می‏‏‏تواند ناشی از اختصاصات بومی‏‏‏ هر منطقه، روش به کار رفته برای تعیین میزان حساسیت و عوامل دخیل در ایجاد مقاومت دارویی از جمله پلاسمیدهای قابل انتقال و غیره... باشد. در مجموع تمام ایزوله‏ها‏ی استافیلوکوکوس اورئوس مورد بررسی در مطالعه حاضر دارای مقاومت چندگانه به آنتی‏بیوتیک مختلف هستند که این خود خطر استفاده بی رویه از آنتی‏بیوتیک‏ها‏ را در سطح جامعه دو چندان می‏‏‏کند.

در قسمت دیگر از این تحقیق، ژن‏ها‏ی کد کننده مقاومت آنتی‏بیوتیکی در استافیلوکوکوس اورئوس بررسی شدند و از روش PCR چندگانه برای ردیابی ژن‏ها‏ی مورد مطالعه استفاده شد که نتایج نشان داد ژن mecA ‏(‏کد کننده مقاومت به متی سیلین) ‏در 18/85 درصد از ایزوله‏ها‏ی استافیلوکوکوس اورئوس جدا شده از ترشحات بینی وجود دارد.

استرومنگر[46] و همکاران در سال 2003 در آلمان از روش PCR چندگانه برای ردیابی ژن‏ها‏ی کد کننده مقاومت آنتی‏بیوتیکی در استافیلوکوکوس اورئوس استفاده کردند و نشان دادند که ژن‏ها‏ی tetM، tetK، aacA-D و mecA به ترتیب در 66/26، 66/16، 33/66 و 33/93 درصد از ایزوله‏ها‏ وجود دارد اما هیچ کدام از آن‏ها‏ حامل ژن‏ها‏ی vatA و vatB نیستند‏‏ ‏(‏30).

حیدری[47] و همکاران در سال 2001 فراوانی حضور ژن‏ها‏ی mecA، msrA، msrB، aacA-D، tetK و tetM را در سویه‏ها‏ی استافیلوکوکوس اورئوس جدا شده از عفونت‏ها‏ی بالینی انسان و ورم پستان در گاو را به ترتیب 18/85، 29/46، 07/49، 33/33، 50/80 و 66/66 درصد تعیین کردند ‏(‏20).

در مجموع، نتایج حاصل از مطالعه حاضر و مقایسه آن با سایر تحقیقات انجام شده در ایران و جهان نشان می‏‏‏دهد که اکثر سویه‏ها‏ی استافیلوکوکوس اورئوس جدا شده از موارد مختلف عفونت‏ها‏ی بالینی در انسان و دام نسبت به آنتی‏بیوتیک‏ها‏ی معمول در درمان عفونت‏ها‏ مقاوم هستند که این مقاومت می‏‏‏تواند ریشه کروموزومی یا پلاسمیدی داشته باشد. بنابراین، استفاده از روش مولکولی نظیر PCR برای ردیابی سریع ژن‏ها‏ی کد کننده مقاومت آنتی‏بیوتیکی در باکتری‏ها‏ از جمله استافیلوکوکوس ضروری به نظر رسیده و نتایج حاصل از این کار می‏‏‏تواند در انتخاب دقیق آنتی‏بیوتیک مناسب در درمان و جلوگیری از گسترش بیشتر مقاومت‏ها‏ی آنتی‏بیوتیکی در باکتری‏ها‏ کمک شایانی نماید.

تشکر و قدردانی

از کمک‏ها‏ی جناب آقای دکتر ممتاز دانشیار محترم دانشگاه آزاد اسلامی واحد شهرکردکه در انجام این پژوهش، ما را یاری کردند و همچنین، از جناب آقای مؤمنی کارشناس مرکز تحقیقات بیوتکنولوژی دانشگاه آزاد اسلامی واحد شهرکرد برای همکاری صمیمانه ایشان در مراحل انجام آزمایش تشکر و قدردانی می‏شود.

 



[1]- Staphylococcus aureus

[2]- Nosocomial infections

[3]- Scalded Skin Syndrome

[4]- Food poisoning

[5]- Toxic Shock Syndrome

[6]- Bacteriema

[7] -Endocarditis

[8]- Pneumonia

[9]- Coagulase negative Staphylococci

[10]- Methicillin Resistant Staphylococcus aureus

[11]- Efflux

[12]- Conjugation

[13]- Transformation

[14]- Transduction

[15]- PenicillinBindingProtein 2a

[16]- Macrolide- Lincosamide- StreptograminB

[17]- Rhinitis

[18]- Laryngitis

[19]- Tracheitis

[20]- Peptone water (‏Merck, Germany)

[21]- Blood agar (‏Merck, Germany) ‏

[22]- Mannitol Salt Agar (‏HiMedia, india) ‏

[23]- Gram stain

[24]- Catalase

[25]- Coagulase

[26]- DNase Test

[27]- Brain Heart Infusion (merck, Germany)

[28]- Polymerase Chain Reaction

[29]- DNA extraction kit (fermentas, Germany) ‏

[30]- PCR buffer

[31]- DNA Taq polymerase (cinna gene)

[32]- Thermocycler Master Cycler Gradient (eppendorf, Germany)

[33]- Ethidium Bromide

[34]- Uviteck

[35]- Kirby-Bauer

[36]- National Committee for Clinical Laboratory

Standards

[37]- Muller Hinton Agar (HiMedia, India) ‏

[38]- SPSS (ver 16)

[39]- Saderi

[40]- Tewodros

[41]- Gedebou

[42]-Tavakoli

[43]- Safdari

[44]- Ghasemian

[45]- Rashidian

[46]- Stromenger

[47]- Heydari

References

(1) Kloos WE. Staphylococcus. In: Mahy BWJ, Collier L, Balows A, Sussman M. Toply & Wilsons Microbiology and Microbial Infection. 9th ed. USA: Hodder Education Publishers; 1998.

(2) De Bruijn FJ, Lupski JR, Weinstock GM. The Staphylococcus aureus genome map. In: Iandolo JJ, Stewart GC. Bacterial Genomes: Physical Structure and Analysis. New York: Springer; 1998.

(3) Walker T. S. Cocos stain- causing Gram- positive. In: Bahdor A, Alikhani M. Y, Mansouri S. H, Dogahe H. P. Microbiology Walkers. Taheri Kalani M. Tehran: Khosravi publications with Cooperation Dibaj Posted; 2008. p 151- 93.

(4) Murray PR, Rosenthal KS, Kobayashi GS,Pfaller MA. Staphylococcus. In: Murray PR, Rosenthal KS, KobayashiGS, Pfaller MA. Medical Microbiology. 4thed. Washington: Mosby; 2002. p 202- 16.

(5) Naimi TS, LeDell KH, Boxrud DJ, Groom AV, Steward CD, Johnson SK, et al. Epidemiology and clonality of community- acquired methicillin- resistant Staphylococcus aureus in Minnesota, 1996- 1998. Clin Infect Dis 2001 1;33 (7): 990- 6.

(6) Lowy FD. Antimicrobial resistance: the example of Staphylococcus aureus. J clin Invest 2003; 111 (9): 1265- 73.

(7) Cohen ML. Epidemiology of drug resistance: implications for a post- antimicrobial Era. Science 1992; 257 (5073): 1050- 55.

(8) BarberM, Rozwadowska- DowzenkoM. Infection by penicillin- resistant staphylococci. Lancet 1948; 2 (6530): 641- 4.

(9) Kirby WM. Extraction of a highly potent penicillin inactivator from penicillin resistant staphylococci. Science 1944;99 (2579): 452- 3.

(10)            Ramdani- Bouguessa N, Bes M, Meugnier H, Forey F, Reverdy ME, Lina G, et al. Detection of methicillin- resistant Staphylococcus aureus strains resistant to multiple antibiotics and carrying the Panton- Valentine leukocidin genes in an Algiers hospital. Antimicrob Agents Chemothe r 2006; 50 (3): 1083- 5.

(11)            Walker, Stuart T. Cocos stain- causing Gram- positive. In: Bahador A, Alikhani MY, Mansouri SH, PiriDogahe H, TaheriKalani M. Walkers Microbiology. Tehran: khosravi publications & Dibaj publications; 2007. p 151- 93.

(12)            Yilmaz G, Aydin K, Iskender S, Caylan R, Koksal I. Detection and prevalence of inducible clindamycin resistance in staphylococci. J Med Microbiol 2007; 56 (Pt 3): 342- 5.

(13)            Chambers HF. Coagulase- negative staphylococci resistant to beta- lactam antibiotics in vivo produce penicillin- binding protein 2a. Antimicrob Agents Chemother1987; 31 (12): 1919- 24.

(14)            Chambers HF. Methicillin resistance in staphylococci: molecular and biochemical basis and clinical implications. Clin Microbiol Rev 1997; 10 (4): 781- 91.

(15)            Wang Y, Cong- Ming Wu, Li- Ming Lu, Gao- Wa Na Ren, Xing- Yuan Cao, Jian- ZhongShen. Macrolide–lincosamide- resistant phenotypes and genotypes of Staphylococcus aureus isolated from bovine clinical mastitis. Vet Microbiol 2008; 130 (1–2): 118- 25.

(16)            Ochoa- Zarzosa A, Loeza- Lara PD, Torres- Rodríguez F, Loeza- Angeles H, Mascot- Chiquito N, Sánchez- Baca S, et al. Antimicrobial susceptibility and invasive ability of Staphylococcus aureus isolates from mastitis from dairy backyard systems. Antonie Van Leeuwenhoek 2008; 94 (2): 199- 206.

(17)            Kumar R, Yadav BR, Singh RS. Genetic determinants of antibiotic resistance in Staphylococcus aureus isolates from milk of mastitic crossbred cattle. CurrMicrobiol 2010;60 (5): 379- 86.

(18)            NaderiNasab M, Farshadzadeh Z, Yosefi F, Sasacn MS. Determination of inducible resistance to clindamycin in methicillin- resistant staphylococcus aureus and coagulase negative staphylococci. Iran J Microbiol 2008; 1 (3): 25- 30.

(19)            Merino- Díaz L, Cantos de la Casa A, Torres- Sánchez MJ, Aznar- Martín J. Detection of inducible resistance to clindamycin in cutaneous isolates of Staphylococcus spp. by phenotypic and genotypic methods. Enferm Infecc Microbiol Clin 2007; 25 (2): 77- 81.

(20)            Heidari M, Momtaz H, Madani M. Detection of the antibiotic resistance genes in Staphylococcus aureus isolated from human infections and bovine mastitis. African JMicrobiol Res 2011; 5 (31): 5745- 49.

(21)            Momtaz H, Tajbakhsh E, Rahimi E, Momeni M. Coagulase gene polymorphism of Staphylococcus aureus isolated from clinical and sub- clinical bovine mastitis in Isfahan and ChaharmahalvaBakhtiari provinces of Iran. Comp ClinPath 2011; 20: 519– 22.

(22)            Karamstaji A, Moradi N, Boushehri E, Jahed M, Dadsetan B, Sanginabadi F, et al. Nasal carriage of Staphylococcus aureus and antibiotic resistance patterns in Staff training hospitals treatment of Bandar Abbas. Hormozgan Univ Med J 2009; 12 (2): 95- 101.

(23)            Bauer AW, Kirby WM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J clin Pathol 1966; 45 (4): 493- 6.