جداسازی و شناسایی باکتری‏های تجزیه کننده پسماند نفت از مخزن بهره‏برداری شماره 9 مسجد سلیمان

نویسندگان

1 دانشجوی کارشناسی ارشد میکروبیولوژی، دانشگاه آزاد اسلامی واحد قم، ایران

2 دانشیار گروه میکروبیولوژی، دانشگاه شهید چمران اهواز، ایران

3 استادیار گروه میکروبیولوژی، دانشگاه آزاد اسلامی واحد قم، ایران

چکیده

  مقدمه : زیست پالایی یکی از روش‏های موثر برای حذف آلاینده‏های نفتی است. هدف از مطالعه حاضر جداسازی باکتری‏‏های بومی پسماند نفت مخزن بهره بردای شماره 9 مسجدسلیمان و بررسی تأثیر استفاده از آن‏ها در کاهش ترکیبات سنگین نفت و تبدیل آن‏ها به ترکیبات سبک است ‏‏.   مواد و روش‏‏ها: به منظور تکثیر باکتری‏های موجود در پسماند نفت، 2درصد پسماند نفتی به محیط پایه معدنی تلقیح و پس از گرماگذاری و رشد، جهت سنجش تجزیه پسماند به میزان 5 درصد به محیط حاوی مخلوط پسماند و نفت تلقیح شد. سپس، در زمان های مختلف میزان هیدروکربن‏های باقیمانده نفت اندازه‏گیری شدند. شناسایی باکتری‏ها با استفاده از آزمون‏های بیوشیمیایی و تعیین توالی ژن 16S rRNA انجام شد. منحنی رشد جدایه‏های منتخب رسم و بهینه‏سازی منابع نیتروژن و فسفات برای آن‏ها انجام شد. از کروماتوگرافی گازی برای تعیین میزان تجزیه هیدروکربن‏های پسماند استفاده شد .   نتایج: در این تحقیق 10 جدایه باکتریایی از پسماند نفت جداسازی شد. اندازه­گیری هیدروکربن­های کلی نفت با روش Soxhlet - extraction نشان داد که دو جدایه MIS1 و MIS2 تجزیه‏کنندگی نفت را در طی 7 روز، به ترتیب با بازدهی 62 و 72 درصد انجام می‏دهند. به‏علاوه این دو جدایه به ترتیب در ساعت 48 و120 به انتهای فاز لگاریتمی می‏رسند. بهترین منبع نیتروژن و فسفات برای هر دو جدایه نیز، به ترتیب نیترات آمونیوم و پتاسیم دی هیدروژن فسفات بود. این جدایه‏ها در آزمون­های تشخیصی به ترتیب Arthrobacteraurescens و Pseudomonasaeruginosa تشخیص داده شدند. تحلیل‏ کروماتوگرافی گازی جدایه‏ها نشان داد سودوموناس بیش‏ترین میزان تجزیه ترکیبات سنگین و تبدیل آن‏ها به ترکیبات سبک را انجام می­دهد .   بحث و نتیجه‏گیری: باکتری‏های ساکن پسماند نفت قادر به استفاده ار هیدروکربن‏های موجود در پسماند به عنوان منبع کربن و انرژی هستند و با متابولیزه کردن این ترکیبات، موجب کاهش آن‏ها در محیط زیست از طریق شکستن آن‏ها و تبدیل به ترکیبات سبک و یا فرار می‏شوند .

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Isolation and identification of oil sludge degrading bacteria from production tank Number 9 Masjed Soleiman

نویسندگان [English]

  • Yalda Sheyni 1
  • Hossein Motamedi 2
  • Ahmadali Pourbabaei 3
1 M.Sc. Student of Microbiology, Islamic Azad University, Qom branch, Iran
2 Associate Professor of Microbiology, Shahid Chamran University, Ahvaz, Iran
3 Assistant Professor of Microbiology, Islamic Azad University, Qom branch, Iran
چکیده [English]

  Introduction: “Bioremediation” is one of the most effective methods to remove petroleum contaminants. The aim of the present study is to isolate the indigenous bacteria from the waste petroleum in the Masjed Soleiman No. 9 production tank and to examine the effect of their application on the elimination of petroleum heavy chain hydrocarbons and converting them into light compounds .   Materials and methods: Two percent of petroleum sludge was inoculated to the mineral basal medium and after proliferation of its indigenous bacteria, they were inoculated into the mixture of oil sludge and sand at level of 5%, and the amount of total hydrocarbons and residual oil were measured and compared. The isolates were identified based on biochemical tests and 16S rRNA gene sequencing. Optimization of nitrogen and phosphate sources was done based on growth curves of selected isolates. Gas chromatography was used to determine degradation of sludge hydrocarbons.   Results: In this study, 10 bacterial isolates were isolated from petroleum sludge . Measurement of petroleum total hydrocarbons, using Soxhlet-extraction method, showed that two isolates named MIS1 and MIS2 are able to decompose oil sludge hydrocarbons within 7 days, with the yields of 62% and 72%, respectively. Furthermore, the two isolates reach the end of the logarithmic phase at 48 and 120 hrs, respectively. The best source of nitrogen and phosphate for both isolates was ammonium nitrate and potassium di ­hydrogen phosphate, respectively. The isolates were identified as Arthrobacter aurescens and Pseudomonas aeruginosa , respectively. In gas chromatography analysis it was revealed that Pseudomonas aeruginosa was more potent in degradation of heavy chain hydrocarbons and their conversion to light chain compounds.   Discussion and conclusion: Resident bacteria are present in the oil sludge and are able to degrade the heavy petroleum compounds and convert them into light compounds. These bacteria are effective in the reduction of environmental pollution and production of low molecular weight hydrocarbons.

کلیدواژه‌ها [English]

  • Bioremediation
  • Oil sludge
  • Total petroleum hydrocarbons
  • Gas Chromatography

مقدمه

ذرات جامد موجود در نفت خام استخراج شده که در مخازن نفتی ذخیره می‏شوند به همراه واکس، آب و امولسیون‏های نفتی، مواد چسبناک لجنی را در کف مخازن پدید می‏آورند که همواره مشکل ساز بوده و در ضمن کاهش ظرفیت مخازن مشکلات خوردگی را نیز در نقاط مختلف مخزن[1] به دنبال دارند. این امر موجب می‏شود تا دردوره‏های مناسب نسبت به پاک‏سازی مخازن و خارج ساختن لجن‏های مذکور اقدام کنند. ویژگی لجن‏ها در مخازن یکسان نبوده و تفاوت‏های چشمگیری در بین این لجن‏ها وجود دارد(1). در پالایشگاه‏های نفت در سراسر دنیا در بخش‏های ذخیره فرآوری و انتقال نفت، همواره مقدار زیادی پسماند تولید می‏شود. برای مثال‏ در پالایشگاه‏های نفت در کشور هندوستان تقریبا سالیانه 28 هزار تن پسماند که مخلوطی از پسماند هیدروکربنی مضر است تولید می‏شود. تیمار یا از بین‏ بردن این پسماندهای نفتی موضوع مهمی است که صنایع نفتی با آن روبه رو هستند. این پسماندهای نفتی اثرات مخرب و زیان‏باری را در محیط زیست بر جای می‏گذارند. انهدام نامناسب پسماند نفتی باعث آلودگی محیط زیست به‏ویژه آلودگی خاک می شود و برای آب‏ها نیز تهدیدی جدی به حساب می آید. همچنین پسماند نفتی محتوی چندین ترکیب سمی هیدروکربنی است که خاصیت سرطان‏زایی و خاصیت سمیت قوی برای سیستم ایمنی دارند(2). پالایشگاه‏های نفت در سراسر جهان از فن آوری‏های مختلفی از جمله روش‏های تیمار‏ زیستی، شیمیایی و فیزیکی برای مدیریت این پسماندها که طی فرآیند پالایش و ذخیره نفت تولید می‏شوند استفاده می‏کنند. در میان انواع روش‏های موجود برای خنثی کردن اثرات مضر این ترکیبات در جایگاه‏های آلوده، اصلاح زیستی با استفاده از میکروارگانیسم‏های ساکن در محل‏های آلوده یکی از پرکاربردترین روش‏هاست(3). این باکتری‏ها در منابع مختلفی از جمله آب، فاضلاب، خاک‏های آلوده به نفت، پسماند نفتی و غیره وجود دارند و با استفاده از مکانیسم‏های مختلفی باعث تجزیه نفت می‏شوند از جمله با تولید گازهایی مانند: هیدروژن، نیتروژن، متان و دی اکسید کربن که ویسکوزیته نفت را کاهش می‏دهند و ویژگی‏های جریان نفت را بهبود می‏بخشند؛ تولید اسیدها (اسیدهای با وزن مولکولی پایین)، تولید حلال‏هایی مانند الکل‏ها و کتون‏هایی که کمک سورفاکتانت‏های شاخص هستند؛ تولید بیوسورفاکتانت‏ها که کشش بین سطحی آب/ سنگ و نفت را کاهش می‏دهند(4). مهمترین عواملی که در تجزیه زیستی مؤثرند، نوع ترکیبات نفتی و میزان هواخوردگی آن‏هاست. هواخوردن باعث افزایش تبخیر اغلب ترکیبات نفتی که خاصیت سمی دارند می‏شود. علاوه بر منبع کربن لازم است منابع دیگری بخصوص نیتروژن و فسفر در محیط فراهم شوند تا تجزیه ترکیبات هیدروکربنی نفت را تحریک کند(1).

هدف از این تحقیق حاضر، بررسی حضور باکتری‏هایی است که قادر به تجزیه هیدروکربن‏های موجود در پسماند نفت موجود در مخزن بهره‏برداری نفت شماره 9 بی بیان، به منظور استفاده از آن‏ها در فرآیند زیست پالایی پسماند نفتی است.

 

مواد و روش‏ها

نمونه‏گیری

نمونه گیری از پسماند نفتی که در کف مخزن ذخیره نفت واحد بهره‏برداری شماره 9 منطقه بی بیان شهرستان مسجد سلیمان، ته‏نشین شده بود، هنگام لایه روبی مخزن، توسط واحد عملیات شرکت نفت مسجد سلیمان انجام شد. نمونه پسماند مخزن بهره‏برداری نفت، درون ظروف شیشه ای در پیچ دار استریل ریخته شد و سریع به آزمایشگاه میکروبیولوژی منتقل شد. به منظور هوادهی مناسب درب آن‏ها به شکل نیمه باز گذاشته شد.

غنی‏سازی و جداسازی باکتری‏های ساکن پسماند

به این منظور از یک محیط پایه معدنی حاوی (8/0)K2HPO4، (2/0)KH2PO4، (05/0)CaSO4.2H2O، (5/0)MgSO4.H2O، (09/0)FeSO4.7H2O، (1)(NH4)2SO4 (گرم در لیتر)که تنها منبع کربن و انرژی آن 2 درصد پسماند نفت استریل بود، ساخته شد. 1 گرم از پسماند نفتی به عنوان تلقیح باکتریایی وارد شد و ارلن‏ها به مدت 7 روز در شیکر انکوباتور با دمای 2±28 درجه سانتی‏گراد و دور rpm 180 گرماگذاری شدند. پس از این مدت 100 میکرولیتر از محیط کشت مایع به محیط کشت پایه معدنی حاوی پسماند و آگار (5/1 درصد) تلقیح و کشت خطی از آن تهیه شد. محیط‏ها به مدت 7 روز در انکوباتور 2±28 درجه سانتی‏گراد گرماگذاری و پس از خالص‏سازی در نوترینت آگار نگه داری شدند(5).

غربال‏گری باکتری‏های تجزیه کننده پسماند نفت

از یک رآکتور زیستی 500 میلی‏‏لیتری متحرک برای تشخیص میزان توانایی باکتری‏های خالص شده در تجزیه پسماند نفتی استفاده شد. برای این منظور، پسماند نفت با شن‏های شسته شده و استریلیزه رودخانه مخلوط شد تا غلظت 5 درصد (w/w) از پسماند نفتی ایجاد شود. نمونه‏ها با توجه به اندازه گیری محتوای کربن موجود در پسماند نفتی با روش ASTM-D189، برای ایجاد نسبت کربن: نیتروژن: فسفر 100: 5 : 1 با اوره و یا نیترات آمونیوم غنی شدند. یک نمونه تلقیح نشده هم به‏عنوان شاهد انتخاب شد. ارلن‏ها برای مدت 7 روز و در شیکرانکوباتور در دمای (2 28) درجه سانتی‏گراد و دور rpm 180 گرماگذاری شدند. در این صورت بررسی تجزیه پسماند نفتی به شکل چشمی هم امکان‏پذیر است.

اندازه گیری مقدار هیدروکربن‏های کلی نفت (TPH)[2]

اندازه گیری مقدار هیدروکربن‏های کلی نفت TPH با استفاده از روش Soxhlet-extraction و به شکل وزنی تعیین شد. مقدار 25/6 گرم از پسماند نفتی برای استخراج هیدروکربن‏های کلی نفتدرون یک انگشتانه ریخته شد. عصاره گیری از پسماند نفتی با استفاده از حلال دی­کلرومتان انجام شد. عصاره تهیه شده در دمای اتاق توسط تبخیر حلال در یک هود بخار خشک شد و سپس، مقدار هیدروکربن­های کلی پسماند به شکل وزنی تعیین شد(6 و 7).

اندازه گیری مقدار TPH باقیمانده

پس از انجام تیمار پسماند نفتی با باکتری‏های جداسازی شده در محیط سنجش میزان تجزیه کنندگی نفت، پسماندهای باقیمانده موجود در محیط جمع آوری و مقدار هیدروکربن‏های باقیمانده در آن با روش بالا اندازه گیری شد. پس از انجام این آزمایش، دو جدایه باکتریایی به نام‏های MIS1 و MIS2 برای شناسایی بیشتر و انجام آزمایش‏‏های تکمیلی انتخاب شد(6).

 

بررسی تجزیه زیستی ترکیبات اشباع شده موجود در پسماند نفتی

بررسی تجزیه زیستی ترکیبات اشباع موجود در پسماند نفتی با استفاده از کروماتوگرافی گازی[3] در محدوده دمایی 35 تا 220 درجه سانتی‏گراد و به مدت 300 دقیقه انجام شد. به این منظور از ستون CPSil5CB60 متری استفاده شد. به این شکل که ابتدا 5 دقیقه در 35 درجه سانتی‏گراد ماند، سپس، 1درجه، 1 درجه به دمای 60 درجه سانتی‏گراد رسید. 20 دقیقه در دمای 60 درجه ماند و سپس 2 درجه، 2 درجه به دمای 220 درجه رسید و در نهایت 200 دقیقه در دمای 220 درجه سانتی‏گراد ماند. مقدار یک میکرولیتر از محلول‏های باقی مانده تیمار شده با باکتری به منظور مشخص شدن نوع ترکیبات اشباع و آروماتیک موجود، به دستگاه کروماتوگرافی گازی تزریق شد. همچنین، مقداری از مایع رویی پسماند نفتی نیز با حلال نرمال هپتان مخلوط شد و آسفالتن و رزین آن جداسازی شد. مقداری از مایع باقیمانده به منظور مشخص شدن نوع ترکیبات اشباع موجود در پسماند نفتی به دستگاه کروماتوگرافی­گازی تزریق شد. نمودارهای به دست آمده از دستگاه کروماتوگرافی گازی با همدیگر مقایسه شدند.

رسم منحنی رشد جدایه‏های MIS1 و MIS2 در محیط پایه معدنی

رسم منحنی رشد با روش رقت‏سازی متوالی در بافر فسفات و شمارش کلونی‏ در تریپتیکاز سویآگار[4]، هر 12 ساعت و به مدت 7 روز انجام شد. به منظور رسم منحنی رشد، باکتری در ارلن‏های 250 میلی لیتری حاوی 100 میلی لیتر محیط Bushnel-Haas، (2/0)MgSO4.7H2O، (002/0)CaCl2.2H2O، (1) KH2PO4، (1) K2HPO4، (1) NH4NO3و
(05/0) FeCl3 (گرم در لیتر) حاوی 2 درصد پسماند نفتی به عنوان تنها منبع کربن و انرژی کشت داده شد و به مدت 7 روز در دمای2 28 درجه سانتی گراد و دور
rpm 150 انکوبه شد. در ساعت صفر و پس از هر 12 ساعت یک‏بار 100 میکرولیتر از محیط کشت برداشت و پس از تهیه رقت‏های سریال در محیط کشت تریپتیکاز سوی آگار به شکل دو تکرار، کشت داده شد. میانگین کلونی‏‏های رشد کرده در دو پلیت شمارش شد(8).

بهینه‏سازی منابع نیتروژن و فسفات

به منظور بهینه‏سازی منبع نیتروژن و فسفات، جدایه‏های  MIS1و MIS2 در فلاسک‏های 250 میلی‏لیتری حاوی 100 میلی لیتر محیطBushnel-Haas با منابع نیتروژن مختلف شامل: (1)NaNO3، (1)NH4NO3 و (75/0) (NH2)2CO (گرم در لیتر)برحسب اکی‏والان نیتروژن در NH4NO3 (کنترل) کشت داده شدند. همچنین، برای فسفات نیز در ارلن‏های 250 میلی‏لیتری حاوی 100 میلی‏لیتر محیط Bushnel-Haas با منابع فسفات مختلف شامل(گرم در لیتر) (1)KH2PO4،
(84/0) NaH2PO4 برحسب میزان اکی والان فسفر در نمونه کنترل (KH2PO4) کشت داده شدند. اسیدیته محیط‌ها قبل از اتوکلاو بر روی 7 تنظیم شد. فلاسک‏ها پس از تلقیح یک میلی‏لیتر از کشت باکتری در شیکر انکوباتور دار در دمای (2 28)درجه سانتیگراد و دور rpm 150گرماگذاری شدند. رشد باکتری‏ها با روش رقت­سازی متوالی در فاز رشد نمایی باکتری تعیین شد(8).

شناسایی و تعیین توالی 16S rRNA دو جدایه برتر MIS1 و MIS2

شناسایی دو جدایه MIS1 وMIS2 از طریق تست‏های تشخیصی بیوشیمیایی و تعیین توالی ژن 16S rRNA انجام شد. به منظور استخراج ژنوم دو جدایهMIS1 وMIS2 از کیت استخراج ژنوم شرکت تکاپوزیست استفاده شد. برای اطمینان از استخراج و بررسی کیفیت ژنوم استخراج شده، 5 میکرولیتر از محلول حاوی ژنوم بر روی ژل آگاروز یک درصد با ولتاژ 90 ولت و به مدت 50 دقیقه الکتروفورز شد. برای انجام واکنش زنجیره ای پلیمراز[5] از پرایمرهای عمومی (توالی پرایمر) Fd1 و (توالی پرایمر) Rp1 که قابلیت تکثیر ژنوم در ناحیه ژن 16S rRNA را داشتند استفاده شد.

 

جدول 1- پرایمرهای انتخاب شده برای انجام واکنش زنجیره ای پلیمراز

پرایمر رفت

37 باز

CCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG

Fd1

پرایمر برگشت

37 باز

CCCGGGATCCAAGCTTACGGTTACCTTGTTACGACTT

Rp1

 

 

با در نظر گرفتن تعداد نمونه و حجم مورد نیاز (25 میکرولیتر) با استفاده از ترکیبات واکنش زنجیره ای پلیمراز شامل dNTPs، MgCl2، پرایمرها، بافر و آب مقطر استریل، مخلوط اصلی واکنش زنجیره‌ای پلیمراز تهیه شد. واکنش PCR در برنامه دمایی شامل دناتوراسیون اولیه (94 درجه سانتی‏گراد، 5 دقیقه،) 30 سیکل شامل دناتوراسیون ( 94 درجه سانتی‏گراد، 60 ثانیه)، اتصال پرایمر ها (62 درجه سانتی‏گراد 40 ثانیه) و سنتز (72 درجه سانتی‏گراد، 150 ثانیه) و در نهایت یک مرحله طویل سازی انتهایی(72 درجه سانتی‏گراد، 20 دقیقه) انجام شد. محصول PCR در ژل آگاروز 1درصد حاوی اتیدیوم بروماید (50 میکروگرم در میلی لیتر) و در کنار نشانگر 1 کیلوباز الکتروفورز شد.

با مشاهده تک باند مشخص قرار گرفته در ناحیه 1500 جفت بازی، محصول واکنش زنجیره ای پلیمراز به شرکت ماکروژن کره جنوبی ارسال شد. نتایج مربوط به تعیین توالی با استفاده از نرم افزار بیوادیت[6]مرتب شده و توسط برنامه بلاست[7]موجود در پایگاه اینترنتی مرکز ملی اطلاعات بیوتکنولوژی[8] بررسی شد.


نتایج

با استفاده از تیمار نمونه پسماند نفت در محیط پایه معدنی که تنها منبع کربن و انرژی آن پسماند نفتی بود، سپس، تلقیح آن به پلیت­های نفت- آگار، 10جدایه باکتریایی از پسماند نفت جداسازی شد. در محیط سنجش میزان تجزیه کنندگی پسماند نفت، تجزیه باکتری‏ها به شکل چشمی دیده شد. پسماند نفت به شکل تکه‏های ریز شناوری که توانایی اتصال به یکدیگر را نداشتند بر روی سطح محیط دیده شد(شکل 1)؛ در حالی که در محیط شاهد هیچ گونه تجزیه کنندگی پسماند دیده نشد.

مقدار کربن موجود در پسماند نفتی به شکل درصد جرمی با استفاده از روش ASTM-D189 برابر 4/83 درصد محاسبه شد. اندازه‏گیری مقدار هیدروکربن‏های کلی موجود در پسماند نفتی با روش
Soxhlet-extraction و با استفاده از حلال دی کلرومتان انجام شد. مقدار هیدروکربن‏های کلی نفت موجود در 25/6 گرم پسماند نفتی، 725/1 گرم به‏دست آمد. میزان هیدروکربن‏های باقی مانده از تیمار باکتری‏ها و میزان تجزیه‏کنندگی آن‏ها در جدول 2 آورده شده است.

 

 

 

شکل1- الف: نمونه شاهد؛ ب: نمونه پسماند تیمار شده با باکتری

 

جدول 2- مقدار هیدروکربن‏های کلی نفت باقیمانده و درصد میزان تجزیه کنندگی پسماند نفت

سویه

مقدار پسماند نفت (گرم)

مقدار هیدروکربن‏های باقی مانده نفت(گرم)

میزان تجزیه کنندگی پسماند نفت(درصد)

MIS1

25/6

07/1

62

MIS2

25/6

9/0

72

MIS3

25/6

11/1

57

MIS4

25/6

16/2

18

MIS5

25/6

31/1

51

MIS6

25/6

42/1

40

MIS7

25/6

34/2

10

MIS8

25/6

30/2

10

MIS9

25/6

56/1

35

MIS10

25/6

64/1

24

شاهد

25/6

41/2

5

 

 

تزریق یک میکرولیتر از مایع رویی پسماند به‏دست آمده از استخراج هیدروکربن‏های نفتی موجود در پسماند نفتی، وجود انواع ترکیبات اشباع شده از 7 تا 20 کربن را نشان داد. شکل2 و 3 نتیجه حاصل از کروماتوگرافی گازی پسماند نفتی را نشان می‏دهند. شکل 2 منحنی ترکیبات اشباع و شکل 3 ترکیبات آروماتیک را نشان می‏دهد. همان گونه که در این دو کروماتوگرام مشاهده می‏شود، ترکیبات سنگین در این منحنی با فاصله گرفتن از خط پایه خود را نشان داده است.

تزریق یک میکرولیتر از مایع رویی پسماند حاصل از تیمار جدایه‏های MIS1 و MIS2 که حاوی هیدروکربن‏های برداشت شده توسط این باکتری‏ها بود، در کروماتوگرافی گازی نشان داد که تمامی ترکیبات آلکان در مایع رویی جدایه MIS1 و MIS2 وجود دارند. این کروماتوگرام‏ها نشان می‏دهند که میزان ترکیبات سنگین کاهش یافته و منحنی افزایش ترکیبات سبک را نشان می‏دهد.

 

 

 

شکل2- کروماتوگرافی گازی ترکیبات اشباع در پسماند نفتی

 

 

شکل 3- کروماتوگرافی گازی ترکیبات آروماتیک در پسماند نفتی

 

 

 

شکل 4- کروماتوگرافی گازی ترکیبات اشباع مایع رویی پسماند باقی مانده حاصل از تیمار جدایه MIS1

 

 

شکل 5- کروماتوگرافی گازی ترکیبات آروماتیک مایع رویی پسماند باقیمانده حاصل از تیمار جدایه MIS1

 

 

 

شکل 6- کروماتوگرافی گازی ترکیبات اشباع مایع رویی پسماند باقی مانده‏ حاصل از تیمار جدایه MIS2

 

 

شکل 7- کروماتوگرافی گازی ترکیبات آروماتیک مایع رویی پسماند باقی مانده حاصل از تیمار جدایه MIS2

 

 

 

در واکنش زنجیره ای پلیمراز برای دو سویه MIS1 و MIS2 تکثیر قطعه 16SrRNA با موفقیت همراه بود و قطعه 1500 جفت بازی در الکتروفورز مشاهده شد(شکل 8). براساس نتایج به دست آمده از مقایسه توالی ژن16SrRNA، 2 سویه با اطلاعات موجود در پایگاه اینترنتی مرکز ملی اطلاعات بیوتکنولوژی، مشخص شد که سویه MIS1،
Arthrobacteraurescens و سویه MIS2، Pseudomonasaeruginosa است. این باکتری‏ها در بانک ژنی به ترتیب با شماره دسترسی KF991512.1 و KF991513.1 ثبت شدند.

 

شکل 8- الکتروفورز محصول واکنش زنجیره ای پلیمراز برای جدایه‏های MIS1 و MIS2

M: شاخص[ix] 1 کیلو بازی، 1: فرآورده واکنش زنجیره ای پلیمراز حاصل از جدایه MIS1،

2: فرآورده واکنش زنجیره ای پلیمراز حاصل از جدایه MIS2

 

همانگونه که از نتایج جدول مشخص می‏شود جدایه MIS1 یک باکتری میله ای گرم مثبت هوازی، کاتالاز مثبت و اکسیداز منفی است که با توجه به سایر ویژگی‏ها
به جنس آرتروباکتر متعلق است. جدایه MIS2 جزو باکتری میله ای گرم منفی هوازی، کاتالاز مثبت و اکسیداز مثبت است و باکتری به جنس سودوموناس متعلق است.

رسم منحنی این دو جدایه در محیط پایه معدنی و با روش رقت‏سازی متوالی انجام شد. همانطور که مشاهده می‏شود(شکل 9)، جدایه MIS1 پس از گذشت 24 ساعت برای نخستین بار به بیش‏ترین میزان رشد خود می‏رسد و سپس، در ساعت 48 وارد فاز مرگ می‏شود و دوباره شروع به رشد می‏کند. جدایه  MIS2(شکل 10) رشد بسیار سریعی در طی 7 روز دارد و در محیط پایه معدنی پس از 84 ساعت به حداکثر رشد خود می‏رسد و سپس رفته رفته در ساعت 120 به حداقل رشد رسیده و دوباره شروع به رشد با سرعت بالا می‏کند. به همین ترتیب در طی 7 روز انکوباسیون چندین مرحله رشد لگاریتمی و سپس فاز مرگ برای هر دو باکتری وجود دارد.

جدول3- نتایج ویژگی‏های ریخت‏شناسی و آزمون‏های بیوشیمیایی دو جدایه تجزیه کننده پسماند نفت

Character or test

Strain

MIS2

MIS1

Cell Shape

Rod

Rod

Colony colour

Brown

Cream

Gram Reaction

+

Catalase

+

+

Oxidase

+

Motility

Indol production

Citrate Utilizitation

+

+

Urease

+

TSI

Alk-Alk

Acid-Acid

O-F Test

+

+

Nitrate Reduction

+

MR-VP

(MR – , VP +)

(MR – , VP +)

 

 

شکل9- منحنی رشد جدایه MIS1

 

 

شکل10- منحنی رشد جدایه MIS2

 

همانگونه که از شکل11 ملاحظه می‏شود بهترین منبع نیتروژن برای رشد جدایهMIS1، نیترات آمونیوم است. در حالی که اوره و نیترات سدیم تأثیر کمتری در رشد این جدایه در محیط پایه معدنی مربوطه داشتند. همچنین، بر طبق این شکل، بهترین منبع نیتروژن برای رشد جدایه MIS2 هم، نیترات­آمونیوم بود، در حالی که اوره و نیترات سدیم میزان رشد کمی را در محیط پایه معدنی موجب می­شوند.

 

     NANO3           (NH2)2CO                NH4NO3

شکل11- نمودار مقایسه ای بهینه سازی منبع نیتروژن

 

همچنین، بهترین منبع فسفات برای رشد جدایهMIS1، پتاسیم دی هیدروژن فسفات است. در حالی که سدیم دی هیدروژن فسفات تأثیر کمتری در رشد این جدایه در محیط پایه معدنی مربوطه داشتند. همچنین، بر طبق شکل 12 بهترین منبع فسفات برای رشد جدایه MIS2، نیز پتاسیم دی هیدروژن فسفات بوده در حالی که سدیم دی هیدروژن فسفات میزان رشد کمی را در محیط پایه معدنی موجب می‏شوند.

 

 

            KH2PO4                                 NAH2PO4

شکل12- نمودار مقایسه ای بهینه سازی منبع فسفات

بحث و نتیجه­گیری

در میان انواع روش‏های موجود برای کاهش اثرات مضر ترکیبات نفت در جایگاه‏های آلوده، اصلاح زیستی با استفاده از میکروارگانیسم‏های ساکن در این محل‏های آلوده یکی از پرکاربردترین روش‏هاست. با کمک این روش‏های اصلاح زیستی تهدید برای آب‏های جاری کاهش و میزان تجزیه زیستی افزایش می‏یابد(9، 10). علاوه بر این چون در این پسماندهای نفتی مقدار زیادی نفت باقی می‏ماند و این کار هم از لحاظ اقتصادی و هم از لحاظ زیست محیطی دارای مزیت است، با استفاده از باکتری‏های تجزیه‏کننده پسماند نفت می‏توان این آلودگی را بدون هزینه‏های زیاد کنترل کرد(11).
در این پژوهش، با استفاده از تیمار نمونه پسماند در محیط پایه معدنی که تنها منبع کربن و انرژی آن پسماند نفتی بود و سپس، تلقیح آن به پلیت‏های نفت- آگار، 10 جدایه باکتریایی جداسازی شد. جدایه MIS1 و MIS2 به ترتیب متعلق به جنس آرتروباکتر و سودوموناس تشخیص داده شدند. سودوموناس‏ها از فراوان ترین جنس‏های باکتری در محیط هستند و در بررسی‏های انجام شده در مورد جداسازی باکتری‏های تجزیه کننده ترکیبات نفتی به فراوانی جداسازی شده اند و پتانسیل بالایی در استفاده از این ترکیبات برای رشد و متابولیسم دارا هستند.

ژوزف و همکاران[x] در طی تحقیقی مشابه در مورد اصلاح زیستی پسماندهای نفتی و جداسازی نفت از پسماندهای نفتی، جداسازی باکتری را از خاک‏های آلوده به ترکیبات نفتی و با روشی مشابه انجام دادند و تنها موفق به جداسازی سویه‏های مختلف جنس باسیلوس شدند(5). در یک بررسی که توسط هلمی و همکاران[xi] در مورد اصلاح زیستی پسماند نفتی و تجزیه زیستی پسماندهای نفتی انجام شد جداسازی باکتری انجام نشد اما از باکتریAzotobactervinelandii AV 01 برای جداسازی نفت صورت از پسماند نفتی و از کنسرسیوم میکروبی حاویBacillus cereus BL01، Pseudomonas stuzeri BL02 و Bacillus sp. BL04 به منظور تجزیه زیستی پسماندهای نفتی استفاده شد(11). آیوتامونو و همکاران[xii] یک بررسی در مورد اصلاح زیستی پسماندهای نفتی انجام دادند. در این بررسی گونه‏های سودوموناس و باسیلوس از پسماندهای نفتی جداسازی شد و به مخلوط پسماند نفتی و خاک کشاورزی که با نسبت 6 به 1 با هم مخلوط شده بودند به منظور اصلاح زیستی تلقیح شد. میزان کاهش هیدروکربن‏های کلی نفت پسماند نفتی پس از 2 هفته انجام اصلاح زیستی بین 40 تا 52 درصد و پس از 6 هفته بین 63 تا 84 درصد بود(4).

در این پژوهش، به منظور غربال‏گری باکتری‏های تجزیه کننده پسماند نفت از محیط‏های سنجش میزان تجزیه‏کنندگی نفت حاوی پسماند نفتی، شن‏های شسته شده و استریل رودخانه و محیط پایه معدنی استفاده شد. پسماند نفتی باغلظت 5 درصد به این محیط‏ها افزوده شد و شن‏های رودخانه به منظور ایجاد حالت سایش و کمک به تجزیه کنندگی پسماند نفت بررسی شد. در این آزمون پس از 7 روز تیمار درون این محیط‏ها برداشت نفت به شکل چشمی دیده شد. اندازه‏گیری مقدار کربن‏های کلی باقیمانده درصد برداشت نفت متفاوتی را برای باکتری‏های مختلف نشان داد یکی از باکتری‏ها جداسازی شده از پسماند نفتی 72 درصد برداشت نفت را نشان داد و دارای بالاترین تجزیه کنندگی پسماند نفت بود. ژوزف و همکاران طی تحقیقی مشابه با استفاده از همین روش به غربال‏گری باکتری‏های تجزیه کننده نفت پرداختند. در این تحقیق برای تجزیه کنندگی نفت از همین محیط‏های سنجش تجزیه کنندگی نفت استفاده شد و پسماند نفتی با غلظت‏های 5/2، 5، 10، 20، 40 و 80 درصد به این محیط‏ها اضافه شد. در این‏جا نیز پس از 7 روز تیمار تجزیه کنندگی نفت به شکل چشمی دیده شد(5). اپکو و همکارانتحقیقی با عنوان میزان تجزیه زیستی نفت خام توسط میکروارگانیسم­های جداسازی شده از محیط حاوی پسماند نفتی انجام دادند. در این تحقیق میزان تجزیه زیستی نفت خام توسط میکروارگانیسم‏های جداسازی شده از محیط آلوده به پسماند نفتی مطالعه شد. این مطالعه نشان داد که سودوموناس آئروژینوزا بالاترین میزان تجزیه زیستی را در میان دیگر باکتری‏های جداسازی شده دارد(12). بهلولگیل وهمکاران[xiii] در طی یک مطالعه آزمایشگاهی در مورد مکانیسم­های برداشت نفت در فرآیند‏های MEOR تجزیه زیستی ترکیبات نفتی را به عنوان یکی از مکانیسم‏های برداشت نفت معرفی کردند. در این بررسی مشخص شد که در طی تجزیه زیستی ترکیبات سنگین‏تر نفتی به ترکیبات سبک تر تبدیل می‏شوند و با کاهش ویسکوزیته نفت، اجزا موجود در آن، به محصولات با ارزش‏تری تبدیل می‏شوند. این تجزیه زیستی به اجزا سبک‏تر نفت به‏خصوص ترکیبات پارافینی محدود می‏شود. جنس‏های سودوموناس، باسیلوس و آرتروباکتر در تجزیه ترکیبات نفتی کارایی بالایی دارند(13). ماکوت و همکاران[xiv] تحقیقی به منظور تعیین فلور باکتریایی خاک‏های آلوده با محصولات نفتی انجام دادند. در این مطالعه، گونه‏های مختلف باکتری از جمله کلبسیلا و سودوموناس از خاک‏های آلوده به ترکیبات نفتی جداسازی شد(14). کاموترا و همکاران[xv]. در تحقیقی که در مورد اصلاح زیستی پسماندهای نفتی انجام دادند یک کنسرسیوم میکروبی متشکل دو سویه Pseudomonas aeruginosa و یک Rhodococcus sp. از خاک‏های آلوده به پسماندهای نفتی جداسازی شد. این کنسرسیوم میکروبی قادر به تجزیه 90 درصد از هیدروکربن‏ها در محیط مایع پس از 6 هفته بود(15) همان‏طور که مشاهده می‏شود در هیچ یک از بررسی­ها تجزیه کنندگی پسماند نفت بیش از 90 درصد نبود. علت آن را می‏توان به‏وسیله انجام تحقیقاتی در مورد نوع ترکیبات هیدروکربنی که در این 10 درصد باقیمانده وجود دارند مشخص کرد. ممکن است این 10 درصد باقیمانده ترکیبات رزین یا آسفالتنی باشند که امکان برداشت آن‏ها توسط باکتری وجود ندارد. در مجموع می‏توان گفت تجزیه آلودگی‏های حاصل از پسماند نفتی با استفاده از این باکتری‏ها وجود دارد و می‏توان با افزودن منابع نیتروژن و فسفر مناسب به خاک‏های آلوده به این ترکیبات نفتی رشد این باکتری‏ها را تحریک و تسریع کرد. نتیجه این عمل تجزیه ترکیبات موجود در پسماند نفتی و کاهش سمیت آن‏هاست.

تشکر و قدردانی

نویسندگان مراتب تشکر خود را از شرکت ملی مناطق نفت خیز جنوب اهواز، واحد ایمنی، بهداشت و محیط[xvi]، شرکت بهره‏برداری نفت و گاز مسجد سلیمان، آقایان نجف بهادری و مهندس رامتین آموی، واحد پژوهش دانشگاه آزاد اسلامی واحد مسجد سلیمان، آقای مهندس حسین محمدپور، تمامی کارکنان محترم آزمایشگاه اداره شیمیایی مناطق نفت خیز جنوب اهواز، آقایان مهندس یحیوی، دکتر سعید شجاع و مهندس امین عفیفی به خاطر همکاری در مراحل مختلف تحقیق ابراز می‏نمایند. تحقیق حاصل مربوط به پایان نامه کارشناسی ارشد گروه میکروبیولوژی، دانشگاه آزاد اسلامی واحد قم بوده و از کلیه حامیان این تحقیق تشکر و قدردانی می‏شود.



[1]- Pitting

[2]- Total petroleum Hydrocarbon

[3]- Gas chromatography

[4]-Trypticase soy agar

[5]- Polymerase Chain Reaction

[6]-Bio edit

[7]-BLAST

[8]-NCBI

[ix]- Ladder

[x]- Joseph P, et al.

[xi]- Helmy Q, et al.

[xii]- Ayotamuno M, et al.

[xiii]- BehlulgilK, et al.

[xiv]- Makut M, et al.

[xv]- CameotraS. S, et al.

[xvi]- HSE

 

 

 

 

 

References

(1)    Arvanitis N, Katsifas E, Chalkou K, Meintanis C, Karagouni A. A refinary sludge deposition site: Presence of nahH and alkJ genes and crude oil biodegradation ability of bacterial isolates. Biotechnology Lett 2008; 30: 2105-10.

(2)  Bossert I, Bartha R. The fate of petroleum in soil ecosystems. In:R. M. Atlas,editor. PetroleumMicrobiology. 1th ed. New York; CN: MacMillan Publishing company; 1984.

(3)  May Long R. The distribution and diversity of polycyclic aromatic compound-degrading bacteria and key degradativegenes [Dissertation]. England: Exeter Univ.; 2008.

(4)  Ayotamuno M, Okparanma R, Nweneka E, Ogaji S, Probert S. Bio-remediation of a sludge containing hydrocarbons. Applied energy 2007; 84(9): 936-43.

(5)  Joseph P, Joseph A. Microbial enhanced separation of oil from a petroleum refinery sludge. Journal of hazardous materials 2009; 161(1): 522-25.

(6)  Jones D. M, Douglas A. G, Parkes R. J, Taylor J, Giger W, Schaffner C. The recognition of biodegraded petroleum-derived aromatic hydrocarbons in recent marine sediments. Marine Pollution Bulletin 1983; 14(3): 103–08.

(7)  Margesin R, Zimmerbauer A, Schinner F. Monitoring of bioremediation by soil biological activities. Chemosphere 2000; 40(4): 339-46.

(8)   Trindade P, Sobral L, Rizzo A, Leite S, Soriano A. Bioremediation of a weathered and a recently oil- contaminated soils from Brazil: a comparison study. Chemosphere 2005; 58(4): 515-22.

(9)   Kanaly R. A, Harayama S. Biodegradation of high-molecular-weight polycyclic aromatic hydrocarbons by bacteria. Journal of Bacteriology2000; 182(8): 2059-67.

(10)   Mishra S, Jyot J, Kuhad R. C, Lal B. Evaluation of inoculum addition to stimulate in situ bioremediation of oily-sludge-contaminated soil. Applied and environmental microbiology 2001; 67(4): 1675-81.

(11)  Helmy Q, Kardena E, Nurachman Z. Application of Biosurfactant Produced by Azotobactervinelandii AV01 for Enhanced Oil Recovery and Biodegradation of Oil Sludge. International Journal of Civil & Environmental Engineering 2010; 10(1): 7-14.

(12)  Dibble J, Bartha R. Effect of environmental parameters on the biodegradation of oil sludge. Appl. Environ. Microbiol 1979; 37(4): 729-739.

(13)           BehlulgilK and Mehmetoglu M. Bacteria for improvement of oil recovery: A laboratory study. Energy sources 2002; 24(5): 413-22.

(14)    Makut M and Ishaya P. Bacterial species associated with soils contaminated with used petroleum products in Keffi town, Nigeria. African Journal of Microbiology Research 2010; 4(16): 1698-1702.

(15)  Cameotra S. S and Singh P. Bioremediation of oil sludge using crude biosurfactants. International Biodeterioration& Biodegradation 2008; 62(3): 274- 80.