جداسازی و شناسایی یک سویه تولیدکننده ریبوفلاوین از نکتارین

نویسندگان

1 دانشجوی کارشناسی‏ارشد میکروبیولوژی، دانشگاه شهید چمران، اهواز، ایران

2 استاد میکروبیولوژی، دانشگاه شهید چمران، اهواز، ایران

3 دانشیار فارماکولوژی، دانشگاه شهید چمران، اهواز، ایران

چکیده

  مقدمه : بسیاری میکروارگانیسم­ها همچون قارچ­ها، باکتری­ها و مخمرها به طور ذاتی توانایی تولید ویتامین­ها از جمله ویتامین B2 یا ریبوفلاوین را دارند. در این راستا پژوهش حاضر با هدف جداسازی و غربال‏گری مخمرهای تولیدکننده ریبوفلاوین از منابع مختلف خاک، برگ و میوه­ها انجام شد‏‏.   مواد و روش‏‏ها: نمونه­هایی از برگ، خاک درختان و نیز انواع میوه­ها به منظور بررسی حضور مخمرها و توانایی تولید ریبوفلاوین توسط آن‏ها تهیه شد. پس از خالص و غنی­سازی نمونه­ها، به منظور سنجش احتمالی تولید ریبوفلاوین از روش­های اسپکتروفتومتر، کروماتوگرافی لایه نازک و کروماتوگرافی مایع با کارآیی بالا استفاده شد. در انتها، شناسایی جدایه برتر انتخابی با استفاده از تکنیک­های رایج ریخت‏شناسی، بیوشیمیایی و مولکولی انجام شد.   نتایج: در این تحقیق، 26جدایه مخمری از نمونه­های محیطی جداسازی شد که 6 جدایه توانایی تولید ریبوفلاوین را نشان دادند. نتایج شناسایی جدایه برتر انتخابی به‏وسیله ویژگی‏های بیوشیمیایی و فنوتیپی مشخص کرد که این جدایه وابسته به مخمر کلاویسپورا لوسیتانیا است و با توجه به جداسازی آن از میوه شلیل، این جدایه، کلاویسپورا لوسیتانیا جدایه N3 (شماره ثبت ژن: JQ586258 ) نام‏گذاری شد.   بحث و نتیجه‏گیری: تنها یک جدایه از 6 جدایه تولیدکننده، بررسی و شناسایی نهایی شد ولی بر رسی روی سایر جدایه هانشان داد که23 در صدآن ‏ ها توان تولید را دارند. این نتیجه موید این مطلب است که کشور ایران پتانسیل لازم برای جدا سازی مخمرهای تولید کننده ریبو فلاوین را دارد.  

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Isolation and identification of a riboflavin producer yeast from Nectarine

نویسندگان [English]

  • Roya Daneshazari 1
  • Mohammad Roayaei 2
  • Hossein Najafzadeh 3
1 M.Sc. of Microbiology, Shahid Chamran university, Ahvaz, Iran
2 Associate Professor of Microbiology, Shahid Chamran university, Ahvaz, Iran
3 Associate Professor of Pharmacology, Shahid Chamran university, Ahvaz, Iran
چکیده [English]

  Introduction : Many microorganisms like fungi , bacteria and yeasts, have a natural ability to produce vitamins included vitamin B2 or riboflavin. In this regard, the present study was performed to isolation and screening for riboflavin producing yeasts from various sources of soil, leaf and fruit s.   Materials and method s: samples of leaf , soil and fruits were prepared for the presence of yeasts and by its ability to produce riboflavin . After purification and enrichment of samples , in order to assay riboflavin production, spectrometry , thin layer chromatography and high performance liquid chromatography were used . Finally, the best selected isolate was identified using conventional morphological , biochemical and molecular techniques .   Results : In this study , 26 yeast strains were isolated from environmental samples, that 6 isolates showed the ability to produce riboflavin . Identification results of the best selected isolate by biochemical and phenotypic characteristics revealed that this isolate is related to Clavispora lusitaniae and considering isolation of it from nectarine, has named it Clavispora lusitaniae strain N3 (Gene accession no: JQ586258 ).   Discussion and conclusion : Although only one of the six producing strains was studied and identified , observation of ability to produce among 23% of strains showed necessity for further investigation. And according to the result of absence of viewing report about production by investigated strain, it can be said that Iran has potentiality for isolation of yeasts and is capable of producing riboflavin.

کلیدواژه‌ها [English]

  • Isolation and identification
  • Riboflavin production
  • Yeast
  • Clavispora lusitaniae

مقدمه

ویتامین‏ها، ترکیبات شیمیایی آلی شامل دو گروه محلول در چربی و محلول در آب هستند. این ترکیبات در کنترل فرآیندهای فیزیولوژی، رشد و سوخت و ساز موجودات نقش دارند. بنابراین، تامین مقادیر اندک آن‏ها در رژیم غذایی برای پیشگیری از بروز اختلال‏های شدید متابولیکی در بدن ضروری است(1 و 2).

 ویتامین B2 یا ریبوفلاوین یکی از ویتامین‏های خانواده B و وابسته به گروه فلاووآنزیم‏هاست که دارای دو شکل کوعاملی فلاوین مونو نوکلئوتید (FMN) و فلاوین آدنین دی نوکلئوتید (FAD) است این دو ماده بخش پرروستاتیک بسیاری از آنزیم‏ها را تشکیل می‏دهند. از این‏رو ریبوفلاوین در رشد سلولی  عملکرد آنزیمی و تولید انرژی نقش دارد. بنابراین، تامین روزانه 2/1 تا 6/1 میلی‏گرم از این ویتامین در رژیم غذایی به منظور پیشگیری از ایجاد عوارض کمبود، همچون ریزش مو، التهاب پوست، کاهش بینایی و اختلال در رشد ضروری است(3 و 4). اما با توجه به مشاهده گزارش‏هایی مبنی بر کمبود این ویتامین در افراد به علت رژیم غذایی نامناسب، تولید آن در صنعت به روش­های شیمیایی و بیوشیمیایی انجام شده و به طور گسترده­ای در صنایع غذایی و دارویی استفاده می‏شود (5).

در ابتدا تولید تجاری ریبوفلاوین به شکل شیمیایی بوده‏است. تولید عوامل سمی طی انجام این فرآیند- که نیازمند تیمارهای ویژه پیش از ورود به محیط زیست برای پیشگیری از ایجاد آلودگی زیستی است- یکی از معایب بزرگ این روش به شمار می‏رود و موجب شده محققان توجه خود را به متابولیت‏های بیولوژیک معطوف کرده تا محصولات زیستی را از میکروارگانیسم‏ها تهیه کنند. در این میان ریبوفلاوین نیز به عنوان یکی از ترکیبات ضروری برای انسان و سایر موجودات از اهداف پژوهش‏های امروزی است(2).

ریبوفلاوین، ویتامین منحصربه فردی است که توسط انواعی از میکروارگانیسم‏ها تولید می‏شود. این میکروارگانیسم‏ها بر اساس میزان تولید به سه گروه قارچ‏ها (تولیدکنندگان قوی)، مخمرها (تولیدکنندگان متوسط) و باکتری­ها (تولیدکنندگان ضعیف) تقسیم می‏کنند.

نخستین فرآیند تولید بیولوژیک با باکتری کلستریدیوم استوبوتیلیکوم آغاز شد. این باکتری با استفاده از دانه مالت یا آب پنیر به عنوان سوبسترا، قادر به تولیدی در حدود 100 میلی‏گرم بر لیتر بود. اما طی مطالعات گیلرماند[1] و همکاران و نیز ویکرهام[2] و همکاران مشخص شد که به ترتیب قارچ­های ارموتسیوم آشبی و آشبیا گوسپی توانایی تولید مقادیر بیشتری از این ویتامین را دارند. بنابراین، این دو قارچ، جایگزین باکتری یاد شده شدند(3 و 6). علاوه بر باکتری یاد شده، تاکنون تولید ریبوفلاوین در هر دو گروه باکتری‏های گرم مثبت و گرم منفی مطالعه شده است. بیشتر باکتری‏ها مانند لاکتوباسیلوس پلنتاروم[3]، لاکتوباسیلوس لاکتیس[4]، میکروکوکوس لوتئوس[5]، اشریشیا کولی[6]، پروپیونی‏باکتریوم فردونریچی[7] و مایکوباکتریوم فلی[8] این ویتامین را به میزان اندک تولید می‏کنند. اگرچه بیشترین میزان تولید طبیعی در میان باکتری‏ها به برخی سویه‏های کلستریدیا متعلق است، اما باسیلوس سوبتیلیس و کورینه‏باکتریوم آمونیوژنز[9] از باکتری‏های تولیدکننده در میزان کم در شرایط طبیعی بوده که سویه‏های نوترکیب آن‏ها قادر به تولید در بازده بالا هستند(1، 7 و 8). مخمرها به‏ویژه جنس کاندیدا از دیگر تولیدکنندگان این ویتامین هستند. این تولیدکنندگان متوسط، بر طبق فهرست ارائه شده توسط دمین[10] در سال 1972 شامل: کاندیدا فماتا، کاندیدا گیلرماندی، کاندیدا روبوستا[11]، دبارومایسس ساب­گلوبوسوس[12] و کاندیدا قوشی[13] هستند. امروزه با انجام تحقیقات بیشتر در این زمینه، گونه‏هایی از جنس‏های دیگر همچون پیشیا[14]، ساکارومایسس[15]، ترولوپسیس[16] و هانسنولا[17] به این فهرست افزوده شده‏است. تمامی مخمرها و باکتری‏ها باید بر اثر مهاری آهن در هنگام بیوسنتز غلبه نمایند اما این مهار در قارچ‏ها وجود ندارد (2 و 9). قارچ­ها تولیدکنندگان قوی‏تری نسبت به سایر میکروارگانیسم‏ها به­شمار می‏آیند و اثر مهار آهن در آن‏ها مشاهده نمی‏شود اما کوشش برای دستیابی به مخمرها و باکتری‏های تولیدکننده به علت سرعت رشد بیشتر، هزینه‏های کمتر و نیاز به محیط­های رشد با پیچیدگی کمتر افزایش یافته­است(1). امروزه علاوه بر آشبیا گوسپی، مخمر کاندیدا فماتا و باکتری باسیلوس سوبتیلیس، میکروارگانیسم­های دیگری هستند که برای تولید در مقیاس صنعتی استفاده می‏شوند(3، 5 و 6).

بنابراین، اگرچه تولید شیمیایی چند دهه با موفقیت انجام می­گرفت، اما در سال­های اخیر فرآیندهای بیوتکنولوژی بسیاری برای جایگزینی تولید شیمیایی با تولید زیستی بررسی شدند. علت این امر، مزایای روش زیستی همچون استفاده از منابع تجدید‏پذیر، کاهش پسماندها و همچنین، کاهش انرژی مصرفی و هزینه‏ها است(1 و 3).

بنابراین، با توجه به اهمیت ذکر شده برای ویتامین ریبوفلاوین و مطالعه محدود میکروارگانیسم‏های تولید کننده آن، هدف اصلی در این تحقیق جداسازی و غربال‏گری برخی مخمرهای تولیدکننده این ویتامین از منابع محیطی در نظر گرفته شد تا پتانسیل کشور در زمینه مخمرهای تولیدکننده بررسی شود.

مواد و روش‏ها

جمع‏آوری نمونه

 نمونه‏هایی از برگ، خاک درختان و نیز انواع میوه‏ها به منظور بررسی حضور مخمرها و توانایی تولید ریبوفلاوین توسط آن‏ها تهیه شد. تمامی نمونه­ها بلافاصله پس از نمونه‏برداری بر روی یخ نگهداری و به آزمایشگاه منتقل شدند. در آزمایشگاه نیز تا زمان جداسازی مخمرها، نمونه‏ها در یخچال 4 درجه سانتی‏گراد نگهداری شدند.

محیط و شرایط کشت مخمرها

ابتدا غنی‏سازی نمونه‏ها در محیط YM broth با ترکیب عصاره مخمر، عصاره مالت، پپتون و دکستروز به ترتیب با مقادیر3، 3، 5 و10 گرم در لیتر انجام شد. ارلن‏ها در دمای 28 درجه سانتی‏گراد و شدت هم‏زنی 130 دور در دقیقه به مدت 24 ساعت گرمخانه‏گذاری شدند. سپس، از محیط [18]YGC agar به منظور جداسازی اولیه مخمرها استفاده شد. پس از گرمخانه­گذاری، پلیت‏ها به مدت 72 تا 96 ساعت در دمای 28 درجه سانتی‏گراد و تایید کلونی‏‏های مخمری رشد یافته بر روی محیط با لام گرفتن و مشاهده در زیر میکروسکوپ، این کلونی‏­ها در مورد توانایی تولید ریبوفلاوین بررسی شدند(10 و 11).

بررسی تولید ریبوفلاوین

 به منظور بررسی تولید ریبوفلاوین توسط مخمرهای جداسازی شده، ابتدا از محیط کشت پیش تولید YPD با ترکیب عصاره مخمر، پپتون و دکستروز با مقادیر 10، 20 و 20 گرم در لیتر استفاده شد(5). یک لوپ از مخمرهای تازه رشد یافته بر روی محیط YGC agar به محیط پیش تولید YPD تلقیح کرده و به مدت 48 ساعت در دمای 28 درجه سانتی‏گراد گرمخانه‏گذاری شدند. سپس، 200 میکرولیتر از محیط فوق را به محیط تولید یاد شده در جدول 1 تلقیح نموده و نمونه­ها به مدت 5 روز با شدت هم‏زنی 170 دور در دقیقه و دمای 28 درجه سانتی‏گراد گرمخانه­گذاری شدند.

جدول1- ترکیبات محیط کشت تولید ریبوفلاوین

گرم در لیتر

نام ترکیب

5

(NH4)2SO4

1

KH2PO4

5/0

MgSO4. 7H2O

1/0

CaCl2. 2H2O

2

عصاره مخمر

20

سوکروز

1/0

کلرید سدیم

 

سنجش تولید ریبوفلاوین در محیط

 به منظور سنجش ریبوفلاوین تولیدی، از محیط کشت تولید تحت شرایط استریل نمونه‏گیری کرده و سانتریفیوژ با دور 5000 در دقیقه به مدت 5 دقیقه انجام شد. سپس، سوپرناتانت برای بررسی تولید کیفی و کمی ویتامین استفاده شد. در ابتدا جذب سوپرناتانت در طول موج 440 نانومتر به وسیله دستگاه اسپکتروفتومتر آنالیتیکژنا[19] خوانده شد؛ اما به علت آن که طول موج انتخابی، برای ریبوفلاوین اختصاصی محسوب نمی‏شود از روش‏های کروماتوگرافی برای تایید حضور این ویتامین در محیط تولید استفاده شد(14). کروماتوگرافی لایه نازک با نمونه‏گذاری بر روی پلیت‏های کروماتوگرافی ساخت شرکت مرک[20] و با استفاده از تانک حاوی n-بوتانول، استیک‏اسید و آب مقطر با نسبت 1:4:4 حجمی/ حجمی به عنوان فازهای حلال انجام شد. زمانی که حلال نزدیک به انتهای پلیت رسید، پلیت از تانک خارج و خشک شد. سپس، بررسی نقاط با استفاده از نور ماورای بنفش در طول موج 254 نانومتر و با استفاده از دستگاه آشکارساز UV شرکت دزاجا[21] انجام شد. پس از آن، کروماتوگرافی مایع با کارایی بالا (شرکت شیمادزو[22]) استفاده شد که در این مرحله 1 میلی‏لیتر محلول از فیلتر 22/0 میکرونی عبور داده و سپس 20 میکرولیتر از این محلول فیلتر شده با سرنگ میکرولیتری هامیلتون به دستگاه تزریق شد. اساس آزمایش سنجش ریبوفلاوین استفاده از جذب در 254 نانومتر، استفاده از فاز معکوس با سیستم متانول و آب (به نسبت حجمی 30 به 70) با جریان حلال 1 میلی‏لیتر در دقیقه در درجه حرارت 40 درجه سانتی‏گراد است. با مقایسه زمان ماندگاری نمونه‏های مجهول نسبت به نمونه‏های استاندارد، ریبوفلاوین را شناسایی کرده و با توجه به سطح زیر منحنی پیک‏ها بر اساس منحنی‏های استاندارد مربوطه، غلظت تعیین شد(12 و 13).

شناسایی مخمر

شناسایی مخمرها بر اساس ویژگی‏های ریخت‏شناسی، رشد و ویژگی‏های بیوشیمیایی آن‏ها از جمله توانایی تخمیر و جذب هیدرات‏های کربن و نیز شناسایی مولکولی انجام می‏گیرد. آزمون‏های بیوشیمیایی بر اساس مطالعات کارتزمن[23] و استخراج ژنوم به روش هافمن[24] انجام شد. با توجه به منابع معتبر موجود، جفت پرایمری که توالی آن‏ها در زیر آورده شده است، انتخاب و در واکنش زنجیره ای پلیمراز به کار گرفته شدند(15 و 16).

پرایمر رفت (19 باز)

3´ TCCGTAGGTGAACCTGCGG 5´

پرایمر برگشت (20 باز)

‏3´ TCCTCCGCTTATTGATATGC 5´

 پس از استخراج ژنوم به روش هافمن و با استفاده از دو پرایمر عمومی ذکر شده، واکنش زنجیره پلیمراز به روش زیر در دستگاه ترمال­سایکلر بایورد[25] انجام شد:

دمای دناتوره شدن اولیه 94 درجه سانتی‏گراد و مدت زمان آن 5 دقیقه بود. 36 سیکل شامل: 30 ثانیه در دمای 94 درجه سانتی‏گراد، 30 ثانیه در دمای 6/55 درجه سانتی‏گراد و 45 ثانیه در دمای 72 درجه سانتی‏گراد انجام شد. پس از این مراحل، 10 دقیقه دما در 72 درجه سانتی‏گراد به منظور تکمیل سنتز DNA نهایی نگه داشته شد. پس از انجام واکنش زنجیره پلیمراز، به منظور تایید تکثیر ژنوم و تعیین اندازه قطعه تکثیر یافته، الکتروفورز روی ژل آگاروز و در نهایت تعیین توالی انجام شد و سپس نتیجه حاصل در سایت NCBI، BLAST شد(15).

 

نتایج

جداسازی مخمرها

به طور کل 26 جدایه مخمری از نمونه­ها به دست آمد که به تفکیک تعداد مخمرهای جداسازی شده و نیز تعداد تولیدکنندگان در میان این جدایه­ها در جدول 2 مشاهده می‏شوند. بیش‏ترین تعداد مخمر جداسازی شده و نیز بیش‏ترین تعداد جدایه تولیدکننده از خاک است. اما همانگونه که در ادامه بیان می­شود بهترین تولیدکننده از میوه جداسازی می‏شود.

 

جدول2- تعداد مخمرهای جداسازی­شده و تولیدکننده ریبوفلاوین از منابع مختلف

نوع نمونه

تعداد مخمرهای جداسازی شده

تعداد مخمرهای تولیدکننده

خاک اطراف درختان میوه

12

4

برگ انواع درختان میوه

11

1

انواع میوه

3

1

 

 غربال‏گری مخمرهای تولیدکننده ریبوفلاوین

در ابتدا بر اساس اسپکتروفتومتر تنها 6 جدایه توانایی تولید ریبوفلاوین را نشان دادند که به علت عدم اختصاصیت طول موج انتخابی، در ادامه با استفاده از روش‏های کروماتوگرافی لایه نازک و کروماتوگرافی مایع با کارایی بالا تولید توسط این جدایه­ها تایید شد. نتایج حاصل از کروماتوگرافی لایه نازک در شکل 1 مشاهده می‏شود. نمونه‏های شاهد، رقت‏های 20 و 40 میلی‏گرم بر میلی‏لیتر ریبوفلاوین خالص تهیه شده از شرکت سیگما[26] هستند و با مقایسه نمونه‏های مجهول با شاهد، تولید یا عدم تولید بررسی می‏شود. همچنین، با مقایسه تراکم و نحوه توزیع باند‏های حاصل، می‏توان به طور کیفی میزان تولید را مقایسه کرد.

 

 

شکل1- آشکارسازی باندهای حاصل از TLC با مشاهده در زیر نور ماورای بنفش باطول موج 254 نانومتر

3، 1: شاهد؛ 19، 13، 11: نمونه­های مثبت ؛ 17، 15، 9، 5: نمونه‏های منفی

 

به منظور دستیابی به نتایج دقیق‏تر می‏توان تحلیل‏ کمی توسط کروماتوگرافی مایع با کارایی انجام داد. در این تکنیک ابتدا با تزریق غلظت‏های استاندارد و دستیابی به مساحت سطح زیر پیک، منحنی استاندارد رسم کرده و معادله خطی به دست آورده که در نهایت با قرار دادن مساحت سطح زیر پیک نمونه‏های مجهول در این معادله می‏توان به مقادیر کمی تولید، دست یافت. غلظت ریبوفلاوین تولیدی حاصل از برخی جدایه‏ها در شکل 2 مشاهده می‏شود.

اگرچه در این شکل به نظر می‏رسد که 4 جدایه 1، 3، 4 و 8 تولید مشابهی دارند اما تحلیل‏ نهایی نتایج حاصل از تکنیک‏های ذکر شده، جدایه جداسازی شده از میوه شلیل را بهترین تولیدکننده مشخص نمود. بنابراین، در گام بعدی شناسایی این جدایه انجام شد.

 

شکل 2- غلظت ریبوفلاوین در نمونه­های موردآزمون

 

شناسایی جدایه برتر تولیدکننده ریبوفلاوین

شناسایی اولیه این مخمر بر اساس ویژگی‏های کلونی‏ بر روی پلیت و آزمون‏های بیوشیمیایی انجام شد. سلول‏های تخم مرغی شکل، کرم رنگ، کدر با حاشیه چروک (شکل3 ) از ویژگی‏های ریخت‏شناسی این مخمر بوده که همراه با بررسی آزمون‏های بیوشیمیایی ذکر شده در جدول3 و نیز تعیین توالی ژنوم تکثیریافته (شکل 4) مشخص شد که این جدایه بیشترین شباهت را به کلاویسپورا لوسیتانیا[27]داراست.

 

شکل4- الکتروفورز محصول زنجیره‏ای پلیمرازجدایهN3

 

جدول3 - نتایج آزمون­های بیوشیمیایی جدایه N3

آزمون

ترکیب

N3

تخمیری

مالتوز

+

گالاکتوز

+

لاکتوز

_

گلوکز

+

سوکروز

+

جذب

مانیتول

+

رافینوز

_

سالیسین

+

اینوزیتول

_

اینولین

_

تره­هالوز

+

آرابینوز

_

ژلاتین

_

 

 

 

 

شکل3- شکل میکروسکوپی (40X) و پلیت جدایه N3


بحث و نتیجه‏گیری

هر چند اکثر مطالعات در زمینه افزایش میزان تولید و بررسی موتاسیون‏های مولکولی در یک‏سری میکروارگانیسم‏های خاص همچون قارچ فیلامنتی آشبیا گوسپی، مخمر کاندیدا فماتا و باکتری باسیلوس سوبتیلس است، اما در این میان تحقیقاتی نیز در زمینه دستیابی به دیگر سویه‏های مناسب تولیدکننده انجام می‏شود. چنان که در گزارش انجام شده توسط وانگ[28] و همکاران، جدایه مخمری معرفی شد که برای نخستین بار از دریا جدا شده و قادر است بر اثر مهاری آهن غلبه کند(5). بدیهی است گزارش‏هایی از این گروه می‏تواند به افزایش تولید بیولوژیک این ویتامین کمک کند. بنابراین، بررسی تولید ریبوفلاوین از منابع مختلف محیطی در این پژوهش در نظر گرفته شد.

به منظور جداسازی مناسب مخمرها باید درنظر داشت که ویژگی‏های فیزیکی- شیمیایی محیط، یک عامل مهم اکولوژیک برای تعیین زیستگاه آن‏هاست. این ویژگی به همراه ویژگی‏های تغذیه‏ای در تنوع زیستگاه مخمرها نقش دارد. جداسازی انواعی از جنس‏های مخمری از میوه و سبزیجات (مارتینی[29] و همکاران و چانچای‏چاویوات[30] و همکاران)، خاک (سوزوکی[31] و همکاران، لیترز[32] و همکار و مارگارت[33])، محصولات لبنی (ساووا[34] و همکار)، آب (وانگ و همکاران) گزارش شده­است(5، 15، 17 و 18). این گزارش‏ها و مواردی مشابه آن‏ها، بیانگر تنوع گستردگی مخمرها در طبیعت بوده  است. بر این اساس، منابع محیطی در این مطالعه، به شکل تصادفی انتخاب شده که با توجه به تنوع ذکر شده، جداسازی مخمرها از منابع محیطی انتخابی دور از انتظار نیست و با نتایج حاصل از مطالعات سایر پژوهشگران هم‏خوانی دارد.

جدایه شناسایی شده در این تحقیق ابتدا در سال 1979 توسط هولزچو[35] و همکاران به عنوان میکروارگانیسم بیماری‏زای فرصت‏طلب شناسایی شد و تاکنون در موارد متعددی جداسازی آن از نمونه‏های بیماری‏زا گزارش شده‏است (9، 19 و 20). البته باید توجه داشت این مخمر، سویه صرفا بیماری‏زا نیست و جداسازی آن از نمونه‏های غیرکلینیکی مانند پوست مرکبات همچون لیمو، میوه درختان گلابی و آگاو و ریشه کاکتوس و محصولات لبنی محلی مصر توسط سائوتا[36] و همکاران، والدز[37] و همکاران، ال شارود[38] و همکاران گزارش شده است (21- 23). همچنین، نقش مفید آن مانند تولید آسکوربیک‏اسید و یا استفاده در فرآوری برخی مواد خوراکی همچون پنیرهای قالبی و فشرده بررسی شد(24). در این مطالعه، با توجه به نتایج بیوشیمیایی و مولکولی مشخص شد که میوه شلیل می‏تواند یکی دیگر از منابع جداسازی این گونه از کلاویسپورا با قابلیت تولید ریبوفلاوین باشد که این توانایی بیانگر اثر مفید دیگر این جدایه است.

ذکر این نکته در خور توجه است که بر اساس بررسی‏های انجام شده در منابع قابل دسترس، گزارشی از تولید ویتامین توسط این جدایه مشاهده نشد. در توجیه این مشاهده می‏توان به گزارش بارنز[39] و همکاران استناد کرد که بر اساس مطالعات آن‏ها، کاندیدا گیلرماندی از لحاظ تشابه ژنی، نزدیکترین سویه به کلاویسپورا لوسیتانیا است. علاوه بر آن با توجه به این که گونه‏های جنس کاندیدا از مهم‏ترین مخمرهای تولیدکننده ریبوفلاوین هستند(9)، می‏توان به این نتیجه رسید که توانایی تولید ریبوفلاوین در این گونه، که این مطالعه به آن دست یافته است، یکی از ویژگی‏هایی است که دور از نظر نست اما تایید نهایی و اثبات این مطلب نیازمند پژوهش‏های بیشتر است.

 



[1]. Guilliermond

[2]. Wickerham

[3]. Lactobacillus plantarum

[4]. Lactobacillus lactis

[5]. Micrococcus luteus

[6]. Escherichia coli

[7]. Propionibacterium freudenreichii

[8]. Mycobacterium pheli

[9]. Corynebacterium ammoniagenes

[10]. Demain

[11]. Candida robusta

[12]. Debaromyces subglobosus

[13]. Candida ghoshii

[14]. Pichia

[15]. Saccharomyces

[16]. Torulopsis

[17]. Hansenula

[18]. Yeast extract Glucose Chloramphenicol agar

[19]. Analyticjena

[20]. Merck

[21]. Desaga

[22]. Shimadzu

[23]. Kurtzman

[24]. Huffmann

[25]. Biorad

[26]. Sigma

[27]. Clavispora lusitaniae

[28]. Wang

[29]. Martini

[30]. Chanchaichaovivat

[31]. Suzuki

[32]. Leathers

[33]. Margaret

[34]. Savova

[35]. Hulzcho

[36]. Sahota

[37]. Valdez

[38]. El-Sharoud

[39]. Barns

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

References

 

(1)               Burgess CM, Smid E, Sinderen D. Bacterial vitamin B2, B11 and B12 overproduction: An overview. International Journal of Food Microbiology 2009; 133(1): 1-7.

(2)               HanLim S, Choi JS, Park EY. Microbial production of riboflavin using riboflavin overproducers, Ashbya gossypii, Bacillus subtilis, and Candida famate: An Overview. Biotechnology Bioprocess Engineering. 2001; 6(2):75-88.

(3)               Alosta HA. Riboflavin production by encapsulated Candida flarei [Dissertation]. Oklahama: Oklahoma State University; 2007.

(4)               Vergani L, Barile M, Angelini C, Burlina A, Nijtmans L, Pia Freda M, et al. Riboflavin therapy biochemical heterogeneity in two adult lipid storage myopathies. Brain Journal 1999; 122(12): 2401-11.

(5)               Wang L, Chi Z, Wang Z, Ju L, Ning G. Isolation and characterization of Candida membranifaciens subsp. flavinogenie W14-3 a novel riboflavin-producing marine yeast. Microbiological Research 2008; 163(3): 255-66.

(6)               Stahmann K, Revuelta JL, Seulberger H. Three biotechnical processes using Ashbya gossypii, Candida famata, or Bacillus subtilis compete with chemical riboflavin production. Applied microbial biotechnology 2000; 53(5): 509-16.

(7)               Kuizomi S, Yonetani Y, Maruyama A, Teshiba S. Production of riboflavin by metabolically Corynebacterium ammoniagenes. Applied Microbiology and Biotechnology 2000; 53(6): 674-79.

(8)               Perkins JB, Sloma A, Hermann T, Zachgo E, Pero J. Genetic engineering of Bacillus subtilis for the commercial production of riboflavin. Journal of Industrial Microbiology and Biotechnology 1999; 22(1): 8-18.

(9)               Kurtzman CP, Fell JW. The yeast:a taxonomic study. 4th ed. Netherlands: Elsevier press; 1998.

(10)           KeeSun S, Yong S, Jung HY, Yong P. Candida thermophila sp. nov. , a novel thermophilic yeast isolated from soil. International Journal of Systematic and Evolutionary Microbiology 2001; 51(6): 2167–70.

(11)           Soon H, Kang HL, Jangyul K, Kyung B. Diversity of yeasts associated with Panax ginseng. Journal of Microbiology 2006; 44 (6): 674-79.

(12)           Kealy D, Haies J. Analytical chemistry. 1sted. Oxford: Scientific Publisher; 2001.

(13)           Osman H, Jee Chee M. Sensitivity of UV detection in simultaneous separation and detection of B-vitamins using HPLC. Malaysian Journal of Analytical Sciences 2000; 7(1): 251-55.

(14)           Rucker RB, Suttie J, McCormick DB, Machlin L. Handbook of vitamins. 3rd ed. NewYork: Marcel Dekker Inc; 2001.

(15)           Chanchaichaovivat A, Ruenwongsa P, Panijpan B. Screening and identification of yeast strains from fruits and vegetables: potential for biological control of postharvest chilli anthracnose (Colletotrichum capsici). Biological Control 2007; 42(3): 326-35.

(16)           Covadonga R, Jacqueline K, Friedrich ML, Goodrich M, Parish ME. Yeast species associated with orange juice: evaluation of different identification methods. Applied and Environmental Microbiology 2002; 68(4): 1955-61.

(17)           Martini A, Kurtzman CP, Meyer S, Oneill B. Two new species in Pichia guilliermondii clade: Pichia caribbica sp, nov. , the ascorporic state of Candida fermentati and Candida carpophilba comb, nov. yeast. Research 2004; 5(4): 463-9.

(18)           Savova I, Nikolova M. Isolation and taxonomic study of yeast strains from bulgarian dairy products. Journal of Culture Collections 2002; 3(1): 59-65.

(19)           Merz WG, Khazan U, Jabra M, ChiWu L, Osterhout G, Lehmann PF. Strain delineation and epidemiology of Candida (Clavispora) lusitaniae. Journal of Clinical Microbiology 1992; 30(2): 449-54.

(20)           Noel T, Favel A, Goumar A, Fallague K, Chastin Ch, Leclerc F. Differentiation between atypical isolates of Candida Lusitaniae and Candida pulcherrima by determination of mating type. Journal of Clinical Microbiology 2005; 43(3):1430-32.

(21)           El-Sharoud WM, Belloch C, Peris D, Querol A. Molecular identification of yeasts associated with traditional Egyptian dairy products. Journal of Food Science 2009; 21(2): 380-86.

(22)           Sahota PP, Kaur D, Pandove G. Studies on the preparation of low alcoholic naturally carbonated blended beverage from guava and lemon. International Journal of Safety. 2010; 12: 165-80.

(23)           Valdez AV, Garcia LS, Kirchmayr M, Cria R, Mathis AG. Yeast communities associated with artisanal mezcal fermentations from Agave salmiana. Springer Science 2011; 10(4): 258-64.

(24)           Graham H. F. Yeasts in food and beverages. 1st ed. Germany: Springer; 2006.